TNFR2 (tumor necrosis factor receptor 2) targeting monoclonal antibody library and application thereof

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a TNFR2 (Tumor Necrosis Factor Receptor 2)-targeted monoclonal antibody library and application thereof. According to the invention, a single B cell screening technology is adopted, and 30 antibody sequences are obtained by carrying out high-throughput sequencing on each immunized B cell and have relatively high affinity to TNFR2 (Tumor Necrosis Factor Receptor 2). In further mouse and human in-vitro screening tests, part of the antibodies can effectively block TNF-induced Treg cell proliferation, and the obvious biological activity is shown. Wherein the M0101 antibody can be combined with TNFR2 of human and mouse at the same time, and the research and development bottleneck caused by the adaptation problem is solved. Furthermore, in an in-vivo tumor treatment experiment, the antibody M0101 not only shows a remarkable anti-tumor effect in vivo, but also can promote an anti-tumor immune response by adjusting an immune microenvironment. The humanized M0101 still keeps good species adaptability and druggability, and has good clinical application potential.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to a monoclonal antibody library targeting TNFR2 and an application thereof. Background Art

[0002] The antibody drug market has grown at an astonishing rate in recent years, and the market size is expected to exceed US$200 billion by 2027, becoming one of the most dynamic and promising parts of the biopharmaceutical field. The growth of the market is mainly due to the widespread use of monoclonal antibodies, especially in the treatment of cancer, immune diseases and infectious diseases. Immune checkpoint inhibitors such as PD-1 / PD-L1 and CTLA-4 antibodies have made revolutionary progress in cancer treatment and promoted the widespread clinical application of immunotherapy. This type of drug has greatly changed the traditional cancer treatment model by regulating the immune system to fight tumors, bringing significant survival benefits to patients. At the same time, advances in biotechnology, such as the development of bispecific antibodies, antibody-drug conjugates (ADCs), and chimeric antigen receptor T cell therapy (CAR-T), have further broadened the scope of application of antibody drugs. These technologies allow more precise targeting of tumor cells or diseased tissues, reduce side effects on healthy tissues, and thus improve the safety and effectiveness of treatment. However, despite the launch of a variety of successful antibody drugs, there are still a large number of unmet needs in the clinic. Some patients do not respond well to existing therapies or develop drug resistance during treatment, especially in the treatment of certain tumor types, there is still a lack of effective treatments. Therefore, the development of new antibody drugs, especially targeting new immune regulatory targets, has become an urgent need in the market.

[0003] CD4 + Foxp3 + Regulatory T cells (Tregs) play a key role in maintaining immune homeostasis and are beneficial for the treatment of autoimmune diseases. However, their role in tumors is particularly important. Tregs can suppress anti-tumor immune responses by promoting tumor growth and immune escape, so in the tumor microenvironment, Tregs often become a key factor in tumor immune escape. In the process of treating tumors, regulating the function of Tregs is crucial to inhibit tumor growth. Therefore, a deep understanding of the functional regulation of Tregs in tumors is the basis for effectively inhibiting Tregs activity to block tumor immune escape and achieve anti-tumor treatment.

[0004] The applicant has previously discovered and reported (Xin Chen, J Immunol 1 July 2007; 179(1): 154–161) that tumor necrosis factor receptor II (TNFR2) is one of the TNF receptors preferentially expressed on Tregs. Tumor necrosis factor (TNF) activates Tregs through TNFR2, and the interaction between TNF-TNFR2 plays a vital role in maintaining the function of Tregs. The applicant has previously found that Tregs lacking TNFR2 expression almost no longer have inhibitory activity. In addition, high expression of TNFR2 in tumor cells is usually associated with the malignant behavior of tumors. TNFR2 promotes cell proliferation and activation of anti-apoptotic mechanisms by activating downstream signaling pathways, such as NF-κB, PI3K / Akt, etc., thereby enhancing the survival ability of tumors. Therefore, inhibiting TNFR2 can simultaneously inhibit the proliferation and survival of tumor cells and weaken the immunosuppressive function of Tregs. Targeting TNFR2 can not only directly inhibit tumor growth, but also enhance anti-tumor immune response. Therefore, TNFR2 becomes a potential dual target for more effective tumor therapy.

[0005] Currently, the TNFR2 antibody library development technology has the following disadvantages:

[0006] 1. The traditional antibody development process usually involves multiple stages, including antibody screening, cloning, expression and purification. These steps are not only time-consuming, but each stage may encounter technical difficulties, resulting in a long overall development cycle. This delay not only increases R&D costs, but may also affect market competitiveness. Traditional hybridoma technology is widely used in antibody development, but its fusion process has a high failure rate. This technology involves fusing immune cells with tumor cells to form hybridoma cell lines to produce antibodies. However, due to unstable fusion efficiency, complex screening process and stability issues after cell fusion, the desired antibody clones cannot be reliably obtained. This high failure rate prolongs the development cycle and increases the uncertainty of R&D. Even if the antibody clone is successfully obtained, traditional methods often have difficulty in ensuring that the antibody has high affinity and long-term stability. The affinity and stability of antibodies are crucial to their clinical effects, but traditional technologies may face limitations in optimizing these properties, resulting in unsatisfactory quality of the final product.

[0007] 2. Insufficient selectivity and specificity: The current antibody technology's insufficiency in selectivity and specificity limits the clinical application of antibodies. Screening out antibodies with high specificity has always been a difficult point in antibody development. Hybridoma technology and phage display technology sometimes have difficulty distinguishing target antigens from non-target antigens with similar structures. This lack of specificity may cause the antibody to produce unintended effects in the body, such as toxic effects in normal cells or tissues, leading to side effects.

[0008] 3. Difficulty in cross-species recognition: Existing TNFR2 antibodies may not be able to effectively recognize and bind to mouse (rat) and human TNFR2 antigens at the same time when they are designed. This is because there may be structural differences between human and mouse TNFR2, such as differences in amino acid sequence or glycosylation modification, which makes the antibody show lower affinity and specificity in cross-species applications. Since antibodies cannot recognize mouse and human TNFR2 at the same time, development and validation work becomes more complicated. Researchers may need to develop different antibodies for mice and humans separately, and perform additional validation and adjustments during the translational research stage. This not only increases the time and cost of research and development, but may also lead to inefficiency and technical challenges. In the early stages of drug development, a large number of experiments are usually required in mouse models to evaluate the effect and safety of antibodies. If the antibody cannot recognize mouse TNFR2, this will limit the use of animal models for effective preliminary research, which may result in unreliable research data and affect the success rate of clinical trials. Therefore, further research and development of TNFR2-related antibodies is needed. Summary of the invention

[0009] The first aspect of the present invention aims to provide an anti-TNFR2 monoclonal antibody or an antigen-binding fragment thereof.

[0010] The second aspect of the present invention aims to provide a humanized anti-TNFR2 monoclonal antibody or an antigen-binding fragment thereof.

[0011] The third aspect of the present invention aims to provide a recombinant protein.

[0012] The fourth aspect of the present invention aims to provide biological materials related to the monoclonal antibody or antigen-binding fragment thereof described in the first aspect of the present invention, the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof described in the second aspect, or the recombinant protein described in the third aspect.

[0013] The fifth aspect of the present invention aims to provide a conjugate.

[0014] The purpose of the sixth aspect of the present invention is to provide the use of the monoclonal antibody or its antigen-binding fragment described in the first aspect of the present invention, the humanized anti-TNFR2 monoclonal antibody or its antigen-binding fragment described in the second aspect, the recombinant protein-related biomaterial described in the third aspect, or the conjugate described in the fourth aspect of the present invention in the preparation of products.

[0015] The seventh aspect of the present invention aims to provide a product.

[0016] The eighth aspect of the present invention aims to provide an antibody library.

[0017] The ninth aspect of the present invention is to provide a method for screening TNFR2 monoclonal antibodies or antigen-binding fragments thereof. In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0018] The first aspect of the present invention provides an anti-TNFR2 monoclonal antibody or an antigen-binding fragment thereof;

[0019] The monoclonal antibody or antigen-binding fragment thereof comprises a heavy chain and a light chain;

[0020] The light chain comprises:

[0021] a light chain variable region comprising CDR-L1, CDR-L2 and CDR-L3 of said light chain variable region;

[0022] The sequences of CDR-L1, CDR-L2 and CDR-L3 are selected from 3 of SEQ ID NOs: 1 to 54;

[0023] The heavy chain comprises:

[0024] a heavy chain variable region comprising CDR-H1, CDR-H2 and CDR-H3 of said heavy chain variable region;

[0025] The CDR-H1, CDR-H2 and CDR-H3 are selected from three of SEQ ID NOs: 55-122.

[0026] In some embodiments of the present invention, the CDR sequence of the light chain variable region is as shown in any one of 1) to 3):

[0027] 1) CDR-L1, CDR-L2 and CDR-L3 as shown in Table 1;

[0028] 2) CDR-L1, CDR-L2 and CDR-L3 shown in Table 1 are substituted and / or deleted and / or added with one or more amino acids and have an amino acid sequence with the same function as the protein shown by CDR-L1, CDR-L2 and CDR-L3 shown in Table 1;

[0029] 3) an amino acid sequence that has 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81% or 80% homology with CDR-L1, CDR-L2 and CDR-L3 shown in Table 1 and has the same function as the protein shown in SEQ ID NO: 36.

[0030] In some embodiments of the present invention, the CDR sequence of the heavy chain variable region is as shown in any one of 1) to 3):

[0031] 1) CDR-H1, CDR-H2 and CDR-H3 as shown in Table 2;

[0032] 2) CDR-H1, CDR-H2 and CDR-H3 shown in Table 2 are substituted and / or deleted and / or added with one or more amino acids and have an amino acid sequence with the same function as the protein shown by CDR-H1, CDR-H2 and CDR-H3 shown in Table 2;

[0033] 3) an amino acid sequence that has 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81% or 80% homology with CDR-H1, CDR-H2 and CDR-H3 shown in Table 2 and has the same function as the protein represented by CDR-H1, CDR-H2 and CDR-H3 shown in Table 2.

[0034] In some embodiments of the invention, the CDRs are defined by the Kabat scheme.

[0035] In some embodiments of the present invention, the antibodies include 30 types, including M0001, M0006, M0010, M0026, M0038, M0048, M0078, M0084, M0087, M0101, M0102, M0119, M0121, M0134, M0165, M0315, M0321, M0333, M0338, M0340, M0357, M0367, M0386, M0399, M0400, M0419, M0434, M0455, M0457, and M0465.

[0036] Specifically, the sequences of CDR-L1, CDR-L2 and CDR-L3 of the light chain variable region of the M0001 antibody are shown in SEQ ID NOs: 1, 2, and 3; the sequences of CDR-H1, CDR-H2 and CDR-H3 of the heavy chain variable region are shown in SEQ ID NOs: 55, 56, and 57.

[0037] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0006 antibody are shown in SEQ ID NOs: 4, 5 and 6; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 55, 56 and 57.

[0038] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0010 antibody are shown in SEQ ID NOs: 4, 5 and 6; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 58, 59 and 60.

[0039] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0026 antibody are shown in SEQ ID NOs: 7, 8 and 9; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 61, 62 and 63.

[0040] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0038 antibody are shown in SEQ ID NOs: 10, 11 and 12; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 64, 65 and 66.

[0041] The sequences of CDR-L1, CDR-L2 and CDR-L33 in the light chain variable region of the M0048 antibody are shown in SEQ ID NOs: 13, 14 and 15; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 67, 68 and 69.

[0042] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0078 antibody are shown in SEQ ID NOs: 16, 17 and 18; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 70, 71 and 72.

[0043] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0084 antibody are shown in SEQ ID NOs: 19, 20 and 21; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 73, 74 and 75.

[0044] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0087 antibody are shown in SEQ ID NOs: 22, 20 and 23; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 70, 76 and 77.

[0045] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0101 antibody are shown in SEQ ID NOs: 24, 11 and 25; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 78, 79 and 66.

[0046] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0102 antibody are shown in SEQ ID NOs: 26, 27 and 28; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 80, 81 and 82.

[0047] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0119 antibody are shown in SEQ ID NOs: 29, 27 and 30; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 83, 84 and 82.

[0048] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0121 antibody are shown in SEQ ID NOs: 24, 31 and 12; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 78, 85 and 86.

[0049] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0134 antibody are shown in SEQ ID NOs: 32, 20 and 33; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 87, 88 and 75.

[0050] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0165 antibody are shown in SEQ ID NOs: 34, 28 and 6; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 89, 90 and 91.

[0051] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0315 antibody are shown in SEQ ID NOs: 35, 36 and 37; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 92, 93 and 94.

[0052] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0321 antibody are shown in SEQ ID NOs: 38, 39 and 40; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 95, 96 and 97.

[0053] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0333 antibody are shown in SEQ ID NOs: 41, 17 and 42; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 98, 99 and 100.

[0054] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0338 antibody are shown in SEQ ID NOs: 43, 44 and 45; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 101, 102 and 103.

[0055] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0340 antibody are shown in SEQ ID NOs: 26, 27 and 46; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 104, 105 and 106.

[0056] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0357 antibody are shown in SEQ ID NOs: 47, 38 and 78; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 107, 108 and 109.

[0057] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0367 antibody are shown in SEQ ID NOs: 26, 49 and 6; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 89, 110 and 111.

[0058] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0386 antibody are shown in SEQ ID NOs: 50, 27 and 6; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 78, 112 and 113.

[0059] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0399 antibody are shown in SEQ ID NOs: 49, 27 and 6; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 78, 112 and 111.

[0060] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0400 antibody are shown in SEQ ID NOs: 51, 52 and 15; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 67, 68 and 114.

[0061] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0419 antibody are shown in SEQ ID NOs: 33, 27 and 6; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 115, 116 and 111.

[0062] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0434 antibody are shown in SEQ ID NOs: 26, 27 and 53; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 117, 118 and 111.

[0063] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0455 antibody are shown in SEQ ID NOs: 33, 27 and 54; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 119, 120 and 111.

[0064] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0457 antibody are shown in SEQ ID NOs: 33, 27 and 6; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 78, 121 and 122.

[0065] The sequences of CDR-L1, CDR-L2 and CDR-L3 in the light chain variable region of the M0465 antibody are shown in SEQ ID NOs: 26, 27 and 6; the sequences of CDR-H1, CDR-H2 and CDR-H3 in the heavy chain variable region are shown in SEQ ID NOs: 78, 118 and 111.

[0066] In some embodiments of the present invention, the light chain further comprises a light chain constant region; and the heavy chain further comprises a heavy chain constant region.

[0067] In some embodiments of the present invention, the light chain further comprises a light chain signal peptide; and the heavy chain further comprises a heavy chain signal peptide.

[0068] Preferably, the amino acid sequence of the light chain constant region is as shown in any one of 1) to 3):

[0069] 1) FR-L1, FR-L2, FR-L3 and FR-L4 as shown in Table 3;

[0070] 2) FR-L1, FR-L2, FR-L3 and FR-L4 shown in Table 3 are substituted and / or deleted and / or added with one or more amino acids and have an amino acid sequence with the same function as the proteins shown in FR-L1, FR-L2, FR-L3 and FR-L4 shown in Table 3;

[0071] 3) an amino acid sequence that has 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81% or 80% homology with FR-L1, FR-L2, FR-L3 and FR-L4 shown in Table 3 and has the same function as the proteins shown in FR-L1, FR-L2, FR-L3 and FR-L4 shown in Table 3.

[0072] Preferably, the amino acid sequence of the heavy chain constant region is as shown in any one of 1) to 3):

[0073] 1) FR-H1, FR-H2, FR-H3 and FR-H4 as shown in Table 3;

[0074] 2) FR-H1, FR-H2, FR-H3 and FR-H4 shown in Table 3 are substituted and / or deleted and / or added with one or more amino acids and have an amino acid sequence with the same function as the proteins shown in FR-H1, FR-H2, FR-H3 and FR-H4 shown in Table 3;

[0075] 3) an amino acid sequence that has 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81% or 80% homology with FR-H1, FR-H2, FR-H3 and FR-H4 shown in Table 3 and has the same function as the proteins shown in FR-H1, FR-H2, FR-H3 and FR-H4 shown in Table 3.

[0076] In some embodiments of the present invention, the monoclonal antibody or antigen-binding fragment thereof comprises at least one of a full-length antibody, Fab, Fab', F(ab')2, Fv, scFv, a bispecific antibody, and a multispecific antibody.

[0077] The second aspect of the present invention provides a humanized anti-TNFR2 monoclonal antibody or an antigen-binding fragment thereof.

[0078] The sequences of CDR-L1, CDR-L2 and CDR-L3 of the light chain variable region of the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof are shown in SEQ ID NOs: 24, 11, 25;

[0079] The sequences of CDR-H1, CDR-H2 and CDR-H3 of the heavy chain variable region of the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof are as shown in SEQ ID NOs: 78, 79, 65;

[0080] In some embodiments of the present invention,

[0081] The VL and CL sequences of the light chain of the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof are shown in SEQ ID NOs: 272 and 273, respectively;

[0082] The VL and CL sequences of the heavy chain of the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof are shown in SEQ ID NOs: 270 and 271, respectively.

[0083] The third aspect of the present invention provides a recombinant protein comprising: the monoclonal antibody or antigen-binding fragment thereof of the first aspect of the present invention, or the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof of the second aspect of the present invention; and an optional tag sequence for facilitating expression and / or purification.

[0084] Preferably, the tag sequence is selected from at least one of the following groups: a His tag, a GGGS sequence, a FLAG tag; further a His tag; and further a 6×His tag.

[0085] The fourth aspect of the present invention provides a biomaterial related to the monoclonal antibody or antigen-binding fragment thereof of the first aspect of the present invention, or the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof of the second aspect of the present invention, or the recombinant protein of the third aspect of the present invention, wherein the biomaterial comprises at least one of a1) to a16):

[0086] a1) a nucleic acid molecule encoding the monoclonal antibody or antigen-binding fragment thereof of the first aspect of the present invention, or the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof of the second aspect of the present invention, or the recombinant protein of the third aspect of the present invention;

[0087] a2) an expression cassette comprising the nucleic acid molecule described in a1);

[0088] a3) a vector comprising the nucleic acid molecule described in a1);

[0089] a4) a vector comprising the expression cassette described in a2);

[0090] a5) a transgenic cell line comprising the nucleic acid molecule described in a1);

[0091] a6) a transgenic cell line comprising the expression cassette described in a2);

[0092] a7) a transgenic cell line comprising the vector described in a3);

[0093] a8) a transgenic cell line comprising the vector described in a4);

[0094] a9) a microorganism comprising the nucleic acid molecule described in a1);

[0095] a10) a microorganism comprising the expression cassette described in a2);

[0096] a11) a microorganism comprising the vector described in a3);

[0097] a12) a microorganism comprising the vector described in a4);

[0098] a13) a virus comprising the nucleic acid molecule described in a1);

[0099] a14) a virus comprising the expression cassette described in a2);

[0100] a15) a virus comprising the vector described in a3);

[0101] a16) A virus comprising the vector described in a4).

[0102] Preferably, the transgenic cell line comprises no reproductive material.

[0103] Preferably, the nucleic acid molecule encoding the monoclonal antibody or antigen-binding fragment thereof as described in the first aspect of the present invention comprises a nucleic acid molecule encoding the heavy chain of the monoclonal antibody or antigen-binding fragment thereof described in the first aspect of the present invention and a nucleic acid molecule encoding the light chain of the monoclonal antibody or antigen-binding fragment thereof described in the first aspect of the present invention.

[0104] The fifth aspect of the present invention provides a conjugate comprising at least one of the monoclonal antibody or antigen-binding fragment thereof of the first aspect of the present invention, the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof of the second aspect of the present invention, or the recombinant protein of the third aspect of the present invention;

[0105] and a coupling portion, wherein the coupling portion comprises at least one of a detectable label, a drug, a toxin, a cytokine, a radionuclide, and an enzyme.

[0106] Preferably, the detectable marker is selected from a radioactive isotope, a fluorescent substance, a chemiluminescent substance, a colored substance, or any combination thereof.

[0107] Preferably, the conjugate is selected from: fluorescent substances, chemiluminescent markers, colored substances, radioactive isotopes, MRI (magnetic resonance imaging) or CT (computer tomography) contrast agents, or enzymes capable of producing detectable products, radionuclides, biotoxins, cytokines (such as IL-2, etc.), antibodies, antibody Fc fragments, antibody scFv fragments, gold nanoparticles / nanorods, viral particles, liposomes, nanomagnetic particles, prodrug-activated enzymes, chemotherapeutic agents (e.g., cisplatin) or any form of nanoparticles, etc.

[0108] The sixth aspect of the present invention provides the use of the monoclonal antibody or antigen-binding fragment thereof described in the first aspect of the present invention, the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof described in the second aspect, the recombinant protein-related biomaterial described in the third aspect, or the conjugate described in the fourth aspect of the present invention in the preparation of a product.

[0109] Preferably, the product comprises at least one of a drug, a reagent, a test plate, a test kit, and a test chip.

[0110] Preferably, the drug has the function of treating tumors.

[0111] Preferably, the tumor comprises at least one of a solid tumor and a hematological tumor; and further comprises a solid tumor.

[0112] Preferably, the solid tumor comprises liver cancer, colorectal cancer, bladder cancer, breast cancer, cervical cancer, prostate cancer, glioma, melanoma, pancreatic cancer, nasopharyngeal cancer, lung cancer, gastric cancer, adrenocortical carcinoma, pararenal cortical carcinoma, anal cancer, appendix cancer, astrocytoma, atypical teratoma, rhabdoid tumor, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain tumor, bronchial tumor, Burkitt's lymphoma, carcinoid tumor, heart tumor, bile duct epithelial carcinoma, chordoma, colorectal cancer, craniopharyngioma, ductal carcinoma in situ, embryonic tumor, endometrial cancer, ependymoma, esophageal cancer, olfactory neuroblastoma, intracranial germ cell tumor, extragonadal germ cell tumor, eye cancer, fallopian tube cancer, gallbladder cancer, head and neck cancer, hypopharyngeal cancer, Kaposi's sarcoma, renal cancer, Langerhans cell tissue cell At least one of: leukocyte proliferation, laryngeal cancer, lip cancer, oral cancer, Merkel cell carcinoma, malignant mesothelioma, multiple endocrine neoplasia syndrome, mycosis fungoides, sinonasal cancer, neuroblastoma, non-small cell lung cancer, ovarian cancer, pancreatic neuroendocrine tumors, islet cell tumors, papillomatosis, paraganglioma, sinonasal cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pituitary tumor, pleuropulmonary blastoma, primary peritoneal cancer, retinoblastoma, salivary gland tumor, sarcoma, Sezary syndrome, skin cancer, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, testicular cancer, thymoma and thymic cancer, thyroid cancer, urethral cancer, uterine cancer, endometrial and uterine sarcoma, vaginal cancer, vascular tumor, vulvar cancer and single myeloma.

[0113] Preferably, the blood tumor is selected from at least one of B-cell acute lymphoid leukemia (BALL), T-cell acute lymphoid leukemia (TALL), acute lymphoid leukemia (ALL), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell tumor, Burkitt's lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell-follicular lymphoma, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, non-Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell tumor, Waldenstrom macroglobulinemia and preleukemia.

[0114] In some embodiments of the present invention, the tumor is colon cancer.

[0115] Preferably, the reagent, detection plate, kit, detection chip has the function of detecting the presence or level of TNFR2 protein in a sample.

[0116] In some embodiments of the present invention, M010, M087, M048, M0102, M0119, M0321, M0400, and M0338 cannot block the binding of TNF to Jurkat-R2 cells, but still maintain extremely high affinity. Such antibodies do not affect downstream signaling pathways, but can specifically bind to TNFR2. Therefore, such antibodies can be used to develop diagnostic drugs or detection reagents based on targeting TNFR2.

[0117] A seventh aspect of the present invention provides a product, comprising any one of (1) to (5);

[0118] (1) the monoclonal antibody or antigen-binding fragment thereof according to the first aspect of the present invention;

[0119] (2) the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof according to the second aspect of the present invention;

[0120] (3) the recombinant protein described in the third aspect of the present invention;

[0121] (4) The biomaterial according to the fourth aspect of the present invention;

[0122] (5) The conjugate according to the fifth aspect of the present invention.

[0123] Preferably, the product comprises at least one of a drug, a reagent, a test plate, a test kit, and a test chip;

[0124] Preferably, the medicament comprises pharmaceutically acceptable excipients.

[0125] Preferably, the pharmaceutically acceptable excipients include at least one of solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, adhesives, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, glidants, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesives, integrities, penetration enhancers, pH regulators, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, inclusion agents, humectants, absorbents, diluents, flocculants and deflocculating agents, filter aids, release retardants, and carriers.

[0126] The above-mentioned pharmaceutically acceptable excipients are generally recognized for this purpose and as inactive ingredients of medicaments. A compilation of pharmaceutically acceptable excipients can be found in reference books such as Handbook of Pharmaceutical Excipients (2nd edition, edited by A. Wade and PJ Weller; published by American Pharmaceutical Association, Washington and The Pharmaceutical 6Gess, London, 1994); Pharmacopoeia of the People's Republic of China - Catalogue of Pharmaceutical Excipients.

[0127] The eighth aspect of the present invention provides an antibody library, comprising any two or more of M0001, M0006, M0010, M0026, M0038, M0048, M0078, M0084, M0087, M0101, M0102, M0119, M0121, M0134, M0165, M0315, M0321, M0333, M0338, M0340, M0357, M0367, M0386, M0399, M0400, M0419, M0434, M0455, M0457, and M0465 described in the first aspect of the present invention.

[0128] A ninth aspect of the present invention provides a method for screening a TNFR2 monoclonal antibody or an antigen-binding fragment thereof, comprising the following steps:

[0129] After animals are immunized with antigens, single immune cells are isolated and subjected to high-throughput sequencing.

[0130] In some embodiments of the invention, the antigen is a TNFR2 antibody.

[0131] In some embodiments of the present invention, the animal comprises one of a mouse, a rat, a rabbit, a goat, and a monkey.

[0132] In some embodiments of the present invention, the immune cells are B cells.

[0133] The beneficial effects of the present invention are:

[0134] The present invention adopts single B cell screening technology, and obtains a total of 30 antibody sequences by high-throughput sequencing of each immunized B cell, which has the following advantages:

[0135] 1. Optimizing antibody specificity and affinity: Screening based on large-scale antibody sequences can systematically identify antibodies with optimal specificity and affinity. This method avoids the randomness and blindness of traditional screening techniques, ensuring that the selected antibodies achieve the best target binding effect, thereby improving the quality of antibodies and their clinical application potential.

[0136] 2. Accelerate the R&D process: The combination of single B cell screening technology and high-throughput sequencing can complete the discovery and optimization of antibodies in a relatively short period of time. This method greatly shortens the development cycle and can push new antibodies to clinical trials faster than traditional technologies, thereby improving R&D efficiency.

[0137] 3. It is conducive to obtaining antibodies that simultaneously target human and mouse TNFR2: By performing high-throughput sequencing on single B cells, the present invention can obtain antibody sequences targeting human and mouse TNFR2. This method can screen out antibodies that can simultaneously recognize and bind to TNFR2 of these two species, thereby simplifying the species adaptation problem in the development process. Since the needs of humans and mice can be met at the same time, the success rate of antibody development is improved and the product conversion process is accelerated. This method reduces the research and development bottleneck caused by species adaptation problems and helps to quickly advance the clinical trials and commercialization of antibodies. BRIEF DESCRIPTION OF THE DRAWINGS

[0138] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0139] Figure 1 The affinity results of the antibodies screened for the present invention include 8 results in total, including M0006, M0001, M0048, M0078, M0038, M0087, M0121, and M0026.

[0140] Figure 2 The affinity results of the antibodies screened for the present invention include 8 results in total, including M0084, M0400, M0165, M0419, M0134, M0101, M0119, and M0102.

[0141] Figure 3 The affinity results of the antibodies screened for the present invention include 8 results in total, including M0315, M0321, M0338, M0357, M0010, M0386, M0455, and M0457.

[0142] Figure 4 The affinity results of the antibodies screened for the present invention include 6 results in total: M0434, M0465, M0399, M0340, M0333, and M0367.

[0143] Figure 5 For antibody sequence polymorphism analysis.

[0144] Figure 6 These are the results of in vitro cell line-based antibody screening.

[0145] Figure 7 In vitro functional validation results based on mouse primary lymphocytes

[0146] Figure 8 These are the in vitro functional validation results of human primary lymphocytes.

[0147] Fig. 9 The in vivo anti-tumor results of mouse TNFR2 antibody.

[0148] Fig.10 Analysis of immune cells in draining lymph nodes for murine TNFR2 antibodies.

[0149] Fig.11 This is the affinity test result of the humanized mouse TNFR2 antibody. DETAILED DESCRIPTION

[0150] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0151] Example 1 Construction of a monoclonal antibody library specifically targeting TNFR2 based on single B cell screening technology

[0152] 1. Mouse immunization

[0153] BALB / C mice were immunized with human TNFR2 protein (purchased from Sino Biological).

[0154] Human TNFR2 protein was emulsified with adjuvant (purchased from Bio-Tech Biotech Co., Ltd.; Complete Freund's Adjuvant Catalog No.: P2036-50ml; Incomplete Freund's Adjuvant Catalog No.: P2031-50ml) and injected into four locations on the back of the mouse. The specific process is as follows: For the first subcutaneous injection (sc), the diluted 50 μg protein antigen was emulsified with an equal volume of incomplete Freund's adjuvant (IFA). In the subsequent subcutaneous injection, 25 μg antigen protein was emulsified with an equal volume of complete Freund's adjuvant (CFA). At least four injections were performed, with at least 14 days between each two injections. Seven days after the third injection or booster immunization, serum was collected and the antibody titer of the serum was tested by ELISA (TNFR2 protein was coated on an ELISA plate, and the secondary antibody used HRP-labeled rabbit anti-mouse IgG). The established qualified serum titer standard is: when the immunogen is coated at 5 μg / mL, the serum is diluted 1:16000, and OD-Blank>1.0. If the serum titer is unqualified, booster immunization will be performed until the serum titer is qualified.

[0155] 2. Beacon-based single B cell sorting

[0156] 10-50 μg of biotin-labeled human TNFR2 protein (purchased from Sino Biological Yi Qiao Shenzhou Biotechnology Co., Ltd.) was used to prepare antigen microspheres after incubation of the protein with microspheres (Streptavidin Magnetic Beads; purchased from Thermo Fisher; product number: 88817), and the antigen microspheres were quality controlled by positive antibodies specifically targeting TNFR2 (purchased from Sino Biological Yi Qiao Shenzhou Biotechnology Co., Ltd.). Next, single-cell suspensions were extracted from the spleens of mice with qualified titers, and plasma cells were enriched by magnetic bead sorting. Subsequently, plasma cells were introduced into the Beacon system (using BD company instruments) using a 14K chip, which contained 14,000 chambers. Next, antigen microspheres and fluorescently labeled secondary antibodies were introduced into the chip, and the formation of fluorescence was observed to determine whether plasma cells secreted specific antibodies. Finally, the target cells were selected and exported to a well plate containing cell lysate.

[0157] 3. Beacon-derived single plasma cell variable region amplification and vector construction

[0158] The RNA in the cell lysate was reverse transcribed to obtain the cDNA of each B cell. Then, the variable regions of the heavy and light chains of the antibody were amplified by nested PCR using the cDNA as a template (specific primer information is: FAGGGAGACCCAAGCTGGCTAGCGCCGCCACCATGGCTCCAGTGGCT, SEQ ID NO: 274; R AAACGGGCCCTCTAGACTCGAGTCAGTGGTGGTGGTGATGGTGGTCTCC, SEQ ID NO: 275;). Next, the amplified variable regions of the heavy and light chains of the antibody were inserted into the expression vector PCDNA3.1 with a signal peptide and a constant region, clones were selected for identification, and the clones with correct identification were sent for sequencing. Finally, the clones with correct sequencing were shaken overnight to extract the plasmid, and the plasmid was sequenced again before expression to confirm its correctness. A TNFR2 antibody library was constructed.

[0159] 4. Affinity screening

[0160] The antibody light and heavy chain expression vectors were transiently transfected into HEK293 cells for recombinant expression, and relevant functional verification was performed, including Elisa and BLI. After screening, the thirty mouse antibodies with the highest affinity were selected. The specific sequence information is as follows.

[0161] Table 1 Antibody light chain CDR sequence information

[0162]

[0163]

[0164]

[0165] Table 2 Antibody heavy chain CDR sequence information

[0166]

[0167]

[0168] Table 3 Antibody backbone sequence information

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176] Figure 1 , 2 The affinity analysis results of these screened antibodies were displayed, confirming that all screened antibodies had nanomolar affinity, which shows that these antibodies have excellent binding ability to target TNFR2.

[0177] Figure 3 Further antibody sequence analysis was presented, and the results showed that these thirty antibody sequences had good diversity, ensuring the broad coverage and potential application value of the antibody library.

[0178] Example 2 Cell line-based antibody in vitro screening

[0179] The applicant's research group used a lentiviral vector overexpressing TNFR2 (the viral vector was purchased from GeneCare Gene Technology Co., Ltd.) to transduce Jurkat cells to establish a Jurkat cell line (Jurkat-R2) that stably overexpresses TNFR2. Thirty antibodies were mixed at a concentration of 6 nM with 2.5×10 5 Jurkat-R2 cells (cell concentration was 2.5×10 6 / mL, 0.1mL) were co-incubated so that the antibody could bind to TNFR2. Subsequently, 10ng / mL of Biotin labeled TNF protein (purchased from ACROBiosystem Biosystems) was added, and the binding degree of TNF to cell surface TNFR2 was analyzed by flow cytometry using Streptivin-APC flow antibody (purchased by BD). By comparing the binding of Biotin-TNF in the presence and absence of antibodies, the blocking efficiency of each antibody on the binding of TNF to TNFR2 was evaluated.

[0180] Figure 4The results of screening thirty candidate antibodies of the present invention using a Jurkat cell line overexpressing TNFR2 and a binding detection system of Biotin-labeled TNF are shown. The screening results showed that among the thirty candidate antibodies, 8 antibodies (M010, M087, M048, M0102, M0119, M0321, M0400, M0338) could not block the binding of TNF to Jurkat-R2 cells, 12 antibodies (M001, M006, M026, M078, M084, M0134, M0165, M0315, M0333, M0340, M0357, M0386) partially blocked the binding of TNF to Jurkat-R2 cells, and 10 antibodies (M038, M0101, M0121, M0367, M0386, M0434, M0455, M0457, M0419, M0465) could significantly reduce the binding of Biotin-TNF, with an inhibition rate of 100%. This suggests that these antibodies have high efficiency in blocking TNF binding to TNFR2 and may serve as strong candidates for further research and development.

[0181] Example 3 In vitro screening based on mouse and human primary lymphocytes

[0182] Lymphocytes were collected from spleen, axillary lymph nodes, inguinal lymph nodes, and mesenteric lymph nodes of C57BL / 6 mice. CD4 (L3T4) microbeads (purchased from Miltenyi Biotec, 130–097–145) and MS columns (purchased from Miltenyi Biotec) were used to separate CD4 from lymphocytes. + T cells. MACS-purified CD4 + T cells were labeled with Cell trace violet dye (purchased from Thermo Fisher Scientific; Introvigen), and cells (1×10 5 Cells / well) were cultured in 96-well plates and then stimulated with IL-2 (10 ng / mL) plus TNF (10 ng / mL) for 3 days in the presence or absence of ten antibodies that had been screened for significant blocking effects (antibody concentration was 5 nM). The proliferation of Treg cells was evaluated by CTV dilution method, and Foxp3 was analyzed by fluorescence activated cell sorting (FACS). + CD4 + The proportion of subpopulations and the expression of TNFR2 on Tregs. During the screening process, the functionality of the antibody was evaluated by testing its blocking effect on TNF-induced cell proliferation. Figure 5As shown, the results showed that three of the antibodies (M038, M0101, and M0121) could effectively block TNF-induced mouse Treg cell proliferation and exhibited significant biological activity, suggesting that these three antibodies bind to mouse TNFR2.

[0183] On this basis, this example further uses human peripheral blood mononuclear cells to screen out ten antibodies with significant blocking effects for detection (M038, M0101, M0121, M0367, M0386, M0434, M0455, M0457, M0419, M0465), and collects human peripheral blood mononuclear cells from human peripheral blood. Human CD4 microbeads (purchased from Miltenyi Biotec) and MS columns (purchased from Miltenyi Biotec) are used to separate CD4 from lymphocytes. + T cells. MACS-purified CD4 + T cells were labeled with Celltrace violet dye (purchased from Thermo Fisher Scientific; Introvigen), and cells (1×10 5 Cells / well) were cultured in 96-well plates and then stimulated with IL-2 (10 ng / ml) plus TNF (50 ng / mL) in the presence or absence of antibodies (5 nM) for 3 days. The proliferation of Treg cells was assessed by CTV dilution, and the proportion of Foxp3+ cells in the CD4+ subset and the expression of TNFR2 on Tregs were analyzed by flow cytometry (FACS).

[0184] The ten antibodies screened can inhibit the increase of Treg cell ratio induced by human TNF to varying degrees. Figure 6 As shown, M0101 and M0419 antibodies have the most significant inhibitory effects.

[0185] Example 4 Verification of Anti-tumor Function of Antibodies in Vivo

[0186] The antibody M0101, which showed significant effects in both human and mouse in vitro experiments, was randomly selected for in vivo verification.

[0187] The antibody M0101 obtained through in vitro screening was administered to a Balb / c mouse model in which CT26 mouse colon cancer cells (purchased from ATCC) were subcutaneously transplanted to evaluate its anti-tumor effect.

[0188] The method for constructing the mouse model is as follows: Select female Balb / c mice aged 6-8 weeks to ensure that the mice are healthy and disease-free before the experiment. Use CT26 mouse colon cancer cell line (or other suitable tumor cell lines) for the experiment. Before the experiment, culture CT26 cells in RPMI-1640 medium containing 10% FBS to the logarithmic growth phase. Resuspend CT26 cells in PBS and adjust to an appropriate concentration (5×10 5 Using a sterile syringe, 100 μL of CT26 cell suspension was subcutaneously inoculated into the right back of the mouse to establish a subcutaneous tumor model. After inoculation, the health status of the mice was monitored and the tumors were allowed to grow to a measurable size (usually 50-100 mm). 3 ). The mice were randomly divided into three groups, each containing 5 mice. Two of the groups were control groups, which were given 100 μL of PBS or an equal volume of IgG antibody as a control; the other group was an experimental group, which was given M0101 antibody (dose of 5 mg / kg). The antibody was administered by intraperitoneal injection every 2-3 days. The treatment cycle is usually 3 weeks, during which the tumor volume of the mice is measured regularly. The long diameter (L) and short diameter (W) of the subcutaneous tumor of the mice were measured with a vernier caliper every 2-3 days, and the tumor volume was calculated. The formula for calculating the tumor volume is: Volume = (L×W2) / 2. The changes in the tumor volume of each group of mice were recorded, and tumor growth curves were drawn to compare the tumor growth inhibition effects between different groups. At the end of the treatment cycle or when the tumor reached the specified endpoint volume (2000mm 3 ), the mice were killed and the draining lymph nodes and tumor tissues were collected.

[0189] The results are as follows Figure 7 The results showed that 80% of the mice treated with TNFR2 antibodies had complete tumor regression, demonstrating strong anti-tumor activity. In contrast, the tumors of the mice in the control group continued to grow. To explore the mechanism of action of the antibody, flow cytometry analysis was further performed on the immune cell subsets in the draining lymph nodes of the mice ( Figure 8 The results showed that CD8 + The proportion of T cells increased significantly, suggesting that antibody treatment may inhibit tumor growth by enhancing cytotoxic T cell responses in the tumor microenvironment. In addition, a decrease in the proportion of regulatory T cells (Tregs) was observed, further supporting the potential role of antibodies in immune regulation.

[0190] Example 5 Humanization of Antibodies

[0191] Based on the light chain and heavy chain amino acid sequences of the mouse-derived M0101 antibody. Using the antibody structure database and computer simulation technology, the complementary determining regions (CDRs) of the antibody were structurally analyzed and compared with the human antibody framework to determine the most suitable human antibody framework sequence. The CDRs of the antibody are retained and transplanted to the selected framework sequence that is closest to the human antibody. If necessary, a small number of amino acids in the framework region are adjusted to maintain the affinity and specificity of the antibody. The specific humanized antibody sequence is shown in Table 4. The humanized antibody gene sequence is synthesized and cloned into an expression vector (pcDNA3.1). The expression vector is transfected into mammalian cells (HEK293) for antibody expression. The expressed antibody is purified using protein A / G affinity chromatography, and then the antibody is further purified by ion exchange chromatography to ensure that a high-purity humanized antibody is obtained. The affinity of the humanized antibody for the human TNFR2 antigen is analyzed based on the BLI experiment. The results are as follows Fig. 9 As shown in Figure 2, after humanization, the M0101 antibody still maintains a high affinity for the antigen.

[0192] Table 4 Humanized M0101 antibody sequences

[0193]

[0194] Example 6 Druggability Analysis Based on SEC, HIC, CIC and DSF

[0195] First, gel filtration chromatography (SEC) is used to analyze the molecular weight distribution and polymerization state of the antibody. After the purified antibody sample is diluted, the SEC chromatographic column (purchased from Superdex 200) in the HPLC system is injected, with PBS or appropriate buffer as the mobile phase, and the flow rate is set to 0.5mL / min. The UV detection signal recorded at 280nm is used to evaluate the main peak of the antibody and the peak of its polymer or degradation product. Then, the hydrophobicity of the antibody is analyzed using hydrophobic interaction chromatography (HIC).

[0196] After filtering the antibody sample, inject it into the HIC column (Butyl column) in the HPLC system, use buffers containing different salt concentrations for gradient elution, and set the flow rate to 1 mL / min. Record the UV detection signal at 280 nm to evaluate the hydrophobicity and purification effect of the antibody.

[0197] Then, the charge isomers of the antibody are evaluated using ion exchange chromatography (CIC). The purified antibody sample is injected into a CIC column (such as an SP or HP column) and gradient eluted through buffers of different pH values ​​with a flow rate set to 1 mL / min. The UV detection signal is recorded at 280 nm to analyze the charge state and isoelectric point of the antibody.

[0198] Finally, differential scanning calorimetry (DSF) was used to evaluate the thermal stability of the antibody. The purified antibody sample was mixed with SYPRO Orange fluorescent dye and subjected to thermal scanning (20-90°C, heating rate of 1°C / min), and the changes in fluorescence intensity were detected in real time to determine the melting temperature (Tm value) of the antibody and evaluate its thermal stability. These data were combined to comprehensively evaluate the drugability of the antibody.

[0199] The results are shown in Table 5. The humanized M0101 antibody has good drugability characteristics, such as low immunogenicity, stable expression level and optimized pharmacokinetic properties, while maintaining the ability to efficiently recognize and block the binding of TNF to TNFR2. These characteristics indicate that the humanized antibody is expected to be further developed into a clinical therapeutic drug.

[0200] Table 5 Evaluation of drugability of M0101 antibody

[0201]

[0202] In summary, the present invention adopts single B cell screening technology, and obtains a total of 30 antibody sequences by high-throughput sequencing of each immunized B cell, all of which have a high affinity for TNFR2. In further mouse and human in vitro screening experiments, some antibodies can effectively block TNF-induced Treg cell proliferation and show significant biological activity. Among them, the M0101 antibody can bind to human and mouse TNFR2 at the same time, solving the research and development bottleneck caused by adaptation problems. Further, in in vivo tumor treatment experiments, the antibody M0101 not only showed significant anti-tumor effects in vivo, but also may promote anti-tumor immune responses by regulating the immune microenvironment. The humanized M0101 still maintains good species adaptability and drugability, and has good clinical application potential.

Claims

1. An anti-TNFR2 monoclonal antibody or an antigen-binding fragment thereof, characterized in that: The monoclonal antibody or antigen-binding fragment thereof comprises a heavy chain and a light chain; The light chain comprises: a light chain variable region comprising CDR-L1, CDR-L2 and CDR-L3 of said light chain variable region; The sequences of CDR-L1, CDR-L2 and CDR-L3 are selected from 3 of SEQ ID NOs: 1 to 54; The heavy chain comprises: a heavy chain variable region comprising CDR-H1, CDR-H2 and CDR-H3 of said heavy chain variable region; The CDR-H1, CDR-H2 and CDR-H3 are selected from three of SEQ ID NOs: 55-122.

2. The monoclonal antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The CDR-L1, CDR-L2 and CDR-L3 of the light chain variable region are shown in Table 1; The CDR-H1, CDR-H2 and CDR-H3 of the heavy chain variable region are shown in Table 2.

3. The monoclonal antibody or antigen-binding fragment thereof according to claim 1 or 2, characterized in that: The monoclonal antibody or antigen-binding fragment thereof comprises at least one of a full-length antibody, Fab, Fab', F(ab')2, Fv, scFv, a bispecific antibody, and a multispecific antibody.

4. A humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof, characterized in that: The sequences of CDR-L1, CDR-L2 and CDR-L3 of the light chain variable region of the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof are shown in SEQ ID NOs: 24, 11, 25; The sequences of CDR-H1, CDR-H2 and CDR-H3 of the heavy chain variable region of the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof are as shown in SEQ ID NOs: 78, 79, 65; Preferably, the VL and CL sequences of the light chain of the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof are as shown in SEQ ID NOs: 272 and 273, respectively; Preferably, the VL and CL sequences of the heavy chain of the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof are as shown in SEQ ID NOs: 270 and 271, respectively.

5. A recombinant protein comprising: the monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, or the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof according to claim 4; and an optional tag sequence for facilitating expression and / or purification.

6. A biomaterial related to the monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof according to claim 4, or the recombinant protein according to claim 5, wherein the biomaterial comprises at least one of a1) to a16): a1) a nucleic acid molecule encoding the monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, the humanized anti-TNAR2 monoclonal antibody or antigen-binding fragment thereof according to claim 4, or the recombinant protein according to claim 6; a2) an expression cassette comprising the nucleic acid molecule described in a1); a3) a vector comprising the nucleic acid molecule described in a1); a4) a vector comprising the expression cassette described in a2); a5) a transgenic cell line comprising the nucleic acid molecule described in a1); a6) a transgenic cell line comprising the expression cassette described in a2); a7) a transgenic cell line comprising the vector described in a3); a8) a transgenic cell line comprising the vector described in a4); a9) a microorganism comprising the nucleic acid molecule described in a1); a10) a microorganism comprising the expression cassette described in a2); a11) a microorganism comprising the vector described in a3); a12) a microorganism comprising the vector described in a4); a13) a virus comprising the nucleic acid molecule described in a1); a14) a virus comprising the expression cassette described in a2); a15) a virus comprising the vector described in a3); a16) A virus comprising the vector described in a4).

7. A conjugate comprising at least one of the monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof according to claim 4, or the recombinant protein according to claim 6; and a coupling portion, wherein the coupling portion comprises at least one of a detectable label, a drug, a toxin, a cytokine, a radionuclide, and an enzyme.

8. Use of at least one of (1) to (5) in the preparation of a product; (1) The monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 3; (2) the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof according to claim 4; (3) The recombinant protein according to claim 5; (4) The biomaterial according to claim 6; (5) The conjugate according to claim 7; The product comprises at least one of a drug, a reagent, a test plate, a test kit, and a test chip; Preferably, the drug has the function of treating tumors; Preferably, the reagent, detection plate, kit, detection chip has the function of detecting the presence or level of TNFR2 protein in a sample.

9. A product comprising any one of (1) to (5); (1) The monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 3; (2) the humanized anti-TNFR2 monoclonal antibody or antigen-binding fragment thereof according to claim 4; (3) The recombinant protein according to claim 5; (4) The biomaterial according to claim 6; (5) The conjugate according to claim 7; The product comprises at least one of a drug, a reagent, a test plate, a test kit, and a test chip; Preferably, the medicament comprises pharmaceutically acceptable excipients.

10. A method for screening a TNFR2 monoclonal antibody or an antigen-binding fragment thereof, comprising the following steps: After animals are immunized with antigens, single immune cells are isolated and subjected to high-throughput sequencing.

Images