MICA chimera mRNA or mRNA composition and application thereof

Abstract

The invention provides an MICA chimera mRNA or mRNA composition and application thereof, and belongs to the technical field of cell therapy. The MICA chimera mRNA provided by the invention is an MICA-costimulatory molecule signal chimera mRNA (Messenger Ribonucleic Acid). According to the MICA-costimulatory molecule signal chimera provided by the invention, the combination with NKG2D of T cells is increased through extracellular MICA, the activation of intracellular costimulatory molecules is promoted, the activation threshold of the T cells can be reduced, the proliferation and differentiation of neoantigen-specific T cells are increased, and the number and types of in-vivo neoantigen-specific T cells are increased, so that the in-vivo neoantigen-specific T cells can effectively kill tumors.

Description

Technical Field

[0001] The present invention belongs to the technical field of cell therapy, and in particular relates to a MICA chimeric mRNA or mRNA composition and application thereof. Background Art

[0002] In recent years, the number of global tumor immunotherapy projects has increased by 67%, the number of targets has increased by 50%, and the number of companies and institutions with clinical development projects has increased by 42%, that is, tumor immunotherapy is booming. The corresponding cancer vaccines mainly include cell vaccines, DNA vaccines, mRNA vaccines, peptide vaccines, etc. Among them, mRNA vaccine technology is the latest third-generation vaccine technology. After being injected into the body, it is translated in the cytoplasm without entering the nucleus, overcoming the difficulties of the DNA vaccine delivery system and there is no risk of integrated mutations. This technology can not only fully induce humoral and cellular immune responses, but also activate immune response adjuvants. It also has the advantages of fast research and development, high yield, low cost, and easier to achieve multi-link and multivalent design. It has become an important platform for cancer immunotherapy.

[0003] In the prior art, mRNA-encoded neoantigens lead the development of personalized vaccines. Personalized neoantigen vaccines are "advanced customized" vaccines based on gene sequencing, targeting different mutation sites of each patient, containing multiple sites and individualized. In order to improve the therapeutic effect of neoantigen mRNA vaccines, technicians focus on screening out highly specific neoantigens. For example, CN108351916A provides a method for analyzing and prioritizing neoantigens using multivariate operations based on genomic and protein information. The resulting neoantigens have a highly personalized effect in cancer immunotherapy. For example, the neoantigen identification method provided by CN113316818B can screen out tumor-specific somatic mutations that change the amino acid sequence on highly expressed genes, and predict tumor neoantigens for specific HLA typing.

[0004] However, the above-mentioned technologies for screening and optimizing tumor neoantigens focus on the neoantigens themselves. However, the tumor immune system is relatively complex, and the therapeutic effect obtained by optimizing the neoantigens alone is rather one-sided and single. Therefore, it is still necessary to improve tumor treatment methods from other angles to obtain better therapeutic products. Summary of the invention

[0005] In order to solve the problems existing in the above-mentioned prior art, the present invention provides a MICA chimeric mRNA or mRNA composition and its application. Since the neoantigen originates from autologous proteins and undergoes thymic negative screening, the affinity of the neoantigen is weaker than that of the viral antigen, and the threshold of specific T cell activation is high, resulting in a small number and type of neoantigen-specific T cells in the body. Based on this, the MICA chimeric mRNA provided in the present application can reduce the threshold of neoantigen-specific T cell activation, increase the proliferation and differentiation of neoantigen-specific T cells, and amplify the increase in the number and type of neoantigen-specific T cells in the body through the increase of extracellular MICA and NKG2D binding of T cells, and promote the activation of intracellular co-stimulatory molecule signals, so as to increase the proliferation and differentiation of neoantigen-specific T cells, and amplify the increase in the number and type of neoantigen-specific T cells in the body, so that they can effectively kill tumors. The specific contents are as follows:

[0006] In a first aspect, the present invention provides a MICA chimeric mRNA, wherein the MICA chimeric mRNA is a MICA-co-stimulatory molecule signal chimeric mRNA, wherein the extracellular signal is MICA, and the intracellular signal is a co-stimulatory molecule signal of an antigen presenting cell.

[0007] In some embodiments, the MICA-costimulatory molecule signal chimera mRNA is composed of a MICA sequence connected to the co-stimulatory molecule signal via a CD28 transmembrane structure.

[0008] In some embodiments, the co-stimulatory molecule signal includes at least one of a TNF family receptor and a CD28 / B7 family receptor.

[0009] The TNF family receptor is at least one of 41BBL, OX40L, CD40, ICOSL and CD27L, and the sequences are shown in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12, respectively;

[0010] The CD28 / B7 family receptor is at least one of CD80, CD83 and CD86.

[0011] In a second aspect, the present invention provides a method for preparing the chimeric mRNA described in the first aspect, wherein the method comprises: using a CD28 transmembrane structure to connect a MICA sequence and a co-stimulatory molecule sequence.

[0012] In a third aspect, the present invention provides an mRNA composition, wherein the mRNA composition comprises the MICA chimeric mRNA described in the first aspect.

[0013] In some embodiments, the mRNA composition also includes tumor neoantigen mRNA.

[0014] In some embodiments, the tumor neoantigen mRNA consists of one neoantigen mRNA, or consists of multiple neoantigen mRNAs in series; preferably, it consists of 2-20 neoantigen mRNAs in series.

[0015] In some embodiments, the original mutation sequence corresponding to the tumor neoantigen mRNA is one or more highly immunogenic mutation sequences obtained by sequentially predicting, sorting, and screening.

[0016] In some embodiments, the mRNA composition further comprises membrane-anchored IL-12 mRNA.

[0017] In some embodiments, the membrane-anchored IL-12 mRNA is composed of IL-12A and IL-12B sequences connected by a GS flexible linker, and the transmembrane region is the platelet-derived growth factor receptor β transmembrane region.

[0018] In some embodiments, the chimeric mRNA or the membrane-anchored IL-12 mRNA or the neoantigen mRNA comprises three parts: a protein coding sequence, a 5' untranslated region, and a 3' untranslated region.

[0019] In some embodiments, the mRNA sequence of the 3'UTR is as shown in SEQ ID NO:1.

[0020] In some embodiments, the mRNA sequence of the 5'UTR is as shown in SEQ ID NO:2.

[0021] In some embodiments, the mRNA sequence at the N-terminus of the protein coding sequence is shown as SEQ ID NO:3, and the mRNA sequence at the C-terminus of the protein coding sequence is shown as SEQ ID NO:4.

[0022] In some embodiments, the mRNA composition further comprises a pharmaceutically acceptable carrier.

[0023] In some embodiments, the carrier is any one of a dendritic cell, a macrophage, a B cell, or a nanoparticle.

[0024] In a fourth aspect, the present invention provides an mRNA vaccine, which comprises the chimeric mRNA described in the first aspect or the mRNA composition described in the third aspect.

[0025] In a fifth aspect, the present invention provides a DC vaccine, wherein the DC vaccine comprises the chimeric mRNA described in the first aspect or the mRNA composition described in the third aspect.

[0026] In a sixth aspect, the present invention provides a method for preparing the DC vaccine of the fifth aspect, wherein the chimeric mRNA of the first aspect or the mRNA composition of the third aspect is introduced into mature DCs by electroporation or LNP delivery system.

[0027] In the seventh aspect, the present invention provides a use of the chimeric mRNA described in the first aspect, the mRNA composition described in the third aspect, the mRNA vaccine described in the fourth aspect, or the DC vaccine described in the fifth aspect.

[0028] In some embodiments, the application includes: application in the preparation of specific T cells against cancer; or application in the preparation of TCR-T cells against cancer; or application in the preparation of reagents against cancer; or application in the treatment and / or prevention of cancer.

[0029] In some embodiments, the cancer is any one of breast cancer, ovarian cancer, gastric cancer, liver cancer, prostate cancer, lung cancer, and colon cancer.

[0030] During the application process, when the carrier is DC, the MICA-costimulatory molecule signal chimeric mRNA provided by the present invention can reprogram mature dendritic cells loaded with tumor neoantigen mRNA, achieve efficient antigen delivery, promote mature DC to stimulate T cell activation and proliferation, effector factor secretion and T cell memory conversion ability, solve the functional limitations of monocyte-derived dendritic cells (MoDC), the tumor suppression environment in the body, and the problems of poor DC maturation, antigen presentation and migration ability; when the carrier is LNP, the activation threshold of neoantigen-specific T cells can be reduced, and the number and type of neoantigen-specific T cells in the body can be increased, thereby achieving the purpose of improving tumor killing efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The characterization results of mature DC prepared in Example 1 of the present invention are shown;

[0032] Figure 2 The characterization data of the neoantigens in the reprogrammed dendritic cells prepared in Example 1 of the present invention are shown;

[0033] Figure 3 The results of the detection of the expression of the reprogrammed dendritic cell MICA chimera prepared in Example 1 of the present invention are shown;

[0034] Figure 4 The results of the detection of IL-12 expression on the surface of IL-12-anchored mature DC prepared in Example 1 of the present invention are shown;

[0035] Figure 5The results of in vitro functional evaluation of the chimeric reprogrammed DC products using only membrane-anchored IL-12 or MICA in Example 1 are shown;

[0036] Figure 6 The results of the in vitro functional evaluation of lung cancer in Example 1 for the combined use of membrane-anchored IL-12 and different MICA chimeric reprogrammed DC products are shown;

[0037] Figure 7 The results of the in vivo functional evaluation of lung cancer in Example 1 on the chimeric reprogrammed DC products using a combination of membrane-anchored IL-12 and MICA are shown;

[0038] Figure 8 The results of in vivo functional evaluation of liver cancer in Example 2 for the chimeric reprogrammed DC products using a combination of membrane-anchored IL-12 and MICA are shown;

[0039] Fig. 9 The results of in vivo functional evaluation of gastric cancer using the combination of membrane-anchored IL-12 and MICA chimeric reprogrammed DC products in Example 3 are shown;

[0040] Fig.10 The results of the in vivo functional evaluation of melanoma cells using a combination of membrane-anchored IL-12 and MICA chimeric reprogrammed DC products in Example 4 are shown;

[0041] Fig.11 The results of the in vitro functional evaluation of lung cancer in Example 5 using a combination of membrane-anchored IL-12 and different MICA chimeras to reprogram macrophages are shown. DETAILED DESCRIPTION

[0042] In order to make the above-mentioned purposes, features and advantages of the present invention more obvious and easy to understand, the present invention is further described in detail below in conjunction with the accompanying drawings and specific implementation methods. The embodiments of the present invention are described in detail below. This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and a specific operation process are given, but the protection scope of the present invention is not limited to the following embodiments.

[0043] Various aspects of the present invention are described in detail in the following embodiments. The purpose of the embodiments is not to limit the present invention. Each embodiment can be applied to any aspect of the present invention. In this application, unless otherwise stated, the use of "or" means "and / or".

[0044] Interleukin 12 (IL-12) has emerged as one of the most effective anti-tumor immunotherapeutic agents. However, the potentially lethal toxicity associated with systemic administration of IL-12 precludes its clinical application (Pengju Wang et al, 2017). Tumor-induced immunosuppression is considered an important mechanism by which tumors evade immune-mediated detection and destruction. Many strategies have been evaluated to overcome this suppression, but local IL-12 expression has always appeared to be one of the most effective ways to achieve this goal because of its central role in T-cell and NK-cell-mediated inflammatory responses. Unfortunately, the clinical application of IL-12-based therapies remains problematic due to the potential for rapid development of a lethal inflammatory syndrome. The development of strategies to overcome IL-12-mediated toxicity is currently a subject of intensive research.

[0045] Natural killer cell group 2 member D (NKG2D) is a type II transmembrane receptor. NKG2D is expressed on NK cells and CD8 T cells. NKG2D ligands include two families: MICA and MICB and HCMV UL16 binding protein (ULBP1-6) (Kushal Prajapati et al, 2018). In NK cells, NKG2D signaling is sufficient to release a killing response. In CD8 T cells, the binding of NKG2D leads to TCR activation and enhanced function (S Bauer, et al. 2017; Amanda MJamieson et al. 2002; A Diefenbach et al. 2002). Therefore, the NKG2D receptor is defined as a co-stimulatory molecule in CD8 T cells. Both CD28 and NKG2D are expressed in CD8 T cells. NKG2D is expressed in all CD8 T cells, and CD28 is expressed in approximately 50% of CD8 T cells. CD28 ligands CD80 / CD86 are only expressed on antigen presenting cells (mainly DC cells), and NKG2D receptor ligands are rarely expressed on the surface of normal cells, but are expressed in pathogen-infected cells or tumor cells. In the tumor suppression environment, CTLA-4 inhibits T cell activation by competing with CD28 ligands CD80 and CD86 on DC cells. NKG2D and CD28 have a common downstream signaling pathway and similar co-stimulatory effects, which can relieve CTLA-4 inhibition of T cell activation (Kushal Prajapati et al, 2018). Therefore. The inventor of this patent believes that enhancing the effect of NKG2D and NKG2D ligands can become a new way to transform DC cell function.

[0046] Here, the inventors of this patent designed two types of mRNA, one is a membrane-anchored IL-12 mRNA, which eliminates the toxic effects of systemic administration of IL-12 and retains its anti-tumor efficacy; the second is a MICA-co-stimulatory molecule signal chimeric mRNA to increase the activation of CD8 by DC and other vectors. + T ability, relieve tumor suppression. The specific content of the embodiment of the present invention is as follows:

[0047] In a first aspect, the present invention provides a MICA chimeric mRNA, which is a MICA-co-stimulatory molecule signal chimeric mRNA, wherein the extracellular signal is MICA, and the intracellular signal is a co-stimulatory molecule signal of antigen presenting cells.

[0048] In some embodiments, the composition of the MICA-costimulatory molecule signal chimera mRNA is that the MICA sequence is connected to the co-stimulatory molecule signal through the CD28 transmembrane structure.

[0049] In some embodiments, the co-stimulatory molecule signal comprises at least one of a TNF family receptor and a CD28 / B7 family receptor.

[0050] In some embodiments, the reference sequence NCBI Gene ID of MICA is 100507436.

[0051] The TNF family receptor is at least one of 41BBL, OX40L, CD40, ICOSL and CD27L. The reference sequence NCBI Gene ID of 41BBL is 8744; the reference sequence NCBI Gene ID of OX40L is 7292; the reference sequence NCBI Gene ID of CD40 is 958; the reference sequence NCBI Gene ID of ICOSL is 23308; and the reference sequence NCBI Gene ID of CD27L is 970.

[0052] The CD28 / B7 family receptor is at least one of CD80, CD83 and CD86. The reference sequence NCBI Gene ID of CD80 is 941; the reference sequence NCBI Gene ID of CD83 is 9308; and the reference sequence NCBI Gene ID of CD86 is 942.

[0053] In a second aspect, an embodiment of the present invention provides a method for preparing the chimeric mRNA described in the first aspect, comprising: using a CD28 transmembrane structure to connect a MICA sequence and a costimulatory molecule sequence.

[0054] In a third aspect, an embodiment of the present invention provides an mRNA composition, which includes the MICA chimeric mRNA described in the first aspect.

[0055] In some embodiments, the mRNA composition also includes tumor neoantigen mRNA.

[0056] In some embodiments, the tumor neoantigen mRNA consists of one neoantigen mRNA, or consists of multiple neoantigen mRNAs in series; preferably, it consists of 2-20 neoantigen mRNAs in series.

[0057] In some embodiments, the original mutation sequence corresponding to the neoantigen mRNA is one or more highly immunogenic mutation sequences that are predicted, sorted, and screened in sequence.

[0058] In this embodiment, the inventors collected tumor tissues from patients for exon and transcriptome sequencing, and the sequencing data obtained the top 20 mutation points through seven steps: (1) sequencing data filtering; (2) data comparison; (3) mutation detection; (4) HLA identification; (5) gene expression analysis; (6) gene fusion detection; (7) neoantigen prediction, sorting and screening. The neoantigen sorting and screening conditions are as follows: transcriptome sequencing data has mutant sequence support, TPM expression>10, affinity<500nM, mutation frequency>0.2, non-homologous peptides. The mutant sequence is transcribed in vitro according to the optimized sequence to prepare mRNA with ≤20 neoantigens in series, and after preparation, it is transferred to a liquid nitrogen tank for storage.

[0059] In this embodiment, the tumor neoantigen mRNA obtained by concatenating multiple neoantigens increases the ability to stimulate the diverse neoantigen CD8 T cell library by increasing the number of antigen presentations.

[0060] In some embodiments, the mRNA composition further comprises membrane-anchored IL-12 mRNA.

[0061] In some embodiments, the composition of membrane-anchored IL-12 mRNA is: IL-12A and IL-12B sequences are connected by a GS flexible linker, and the transmembrane region is the platelet-derived growth factor receptor β (Pdgfrb) transmembrane region.

[0062] In some embodiments, the reference sequence NCBI Gene ID of IL-12A is 3592, and the reference sequence NCBI Gene ID of IL-12B is 3593.

[0063] In some embodiments, the mRNA structure of the chimeric mRNA, the membrane-anchored IL-12 mRNA, or the neoantigen mRNA is composed of five structural elements, including 5'-Cap, 3'poly (A), protein coding sequence, 5' untranslated region, and 3' untranslated region.

[0064] The sequences of these elements regulate the translation initiation, translation termination and post-transcriptional modification of mRNA molecules, and sequence optimization of these elements can improve in vivo translation. In this example, in order to increase the stability of neoantigens, protein expression and antigen processing and presentation, pseudouracil was used to modify mRNA, reduce the natural immune response triggered by mRNA, and increase the stability of mRNA and protein expression efficiency.

[0065] Among them, when it is a chimeric mRNA, the protein coding sequence encodes the MICA-co-stimulatory molecule signal chimera; when it is a membrane-anchored IL-12 mRNA, the protein coding sequence encodes the membrane-anchored IL-12; when it is a neoantigen mRNA, the protein coding sequence encodes the neoantigen.

[0066] The various protein coding sequences mentioned above were obtained through pseudouracil modification and N / C terminal sequence optimization.

[0067] Specifically, in all embodiments, the optimized 3'UTR mRNA sequence is shown as SEQ ID NO: 1, the optimized 5'UTR mRNA sequence is shown as SEQ ID NO: 2, the optimized N-terminal mRNA sequence is shown as SEQ ID NO: 3, and the optimized C-terminal mRNA sequence is shown as SEQ ID NO: 4.

[0068] In this example, the optimized 3'UTR nucleotide sequence (SEQ ID NO: 1) is as follows:

[0069] AAAGCAAAACTAACATGAAACAAGGCTAGAAGTCAGGTCGGATTAAGCCATAGTACGGAAAAAACTATGCTACCTGTGAGCCCCGTCCAAGGACGTTAAAAGAAGTCAGGCCATCATAAATGCCATAGCTTGAGTAAACTATGCAGCCTGTAGCTCCACCTGAGAAGGTGTAAAAAATCCGGGAGGCCACAAACCATGGAAGCTGTACGCATGGCGTAGTGGACTAGCGGTTAGAGGAGACCCCTCCCTTACAAATCGCAGCAACAATGGGGGCCCAAGGCGAGATGAAGCTGTAGTCTCGCTGGAAGGACTAGAGGTTAGAGGAGACCCCCCCGAAACAAAAAACAGCATATTGACGCTGGGAAAGACCAGAGATCCTGCTGTCTCCTCAGCATCATTCCAGGCACAGAACGCCAGAAAATGGAATGGTGCTGTTGAATCAACAGGTTCT

[0070] In this embodiment, the optimized 5'UTR nucleotide sequence (SEQ ID NO: 2) is as follows:

[0071] ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC

[0072] Optimized N-terminal sequence (SEQ ID NO: 3):

[0073] ATGAGAGTGACCGCCCCTAGAACACTGATCCTGCTGCTGAGCGGCGCCCTGGCCCTCACCGAGACATGGGCCGGAAGC

[0074] Optimized C-terminal sequence (SEQ ID NO: 4):

[0075] ATCGTGGGCATCGTGGCCGGCCTGGCCGTGCTGGCTGTGGTGGTCATCGGCGCTGTTGTGGCCACCGTGATGTGCAGACGGAAGTCCAGCGGAGGCAAGGGCGGCAGCTACAGCCAGGCCGCTTCTAGCGACAGCGCCCAGGGCTCTGATGTGTCCCTGACCGCC

[0076] In a specific embodiment, the inventors performed in vitro transcription according to the above-mentioned optimized sequences to prepare tumor neoantigen mRNA, membrane-anchored IL-12 mRNA, MICA-TNF family receptor chimera mRNA and MICA-CD28 / B7 family receptor chimera mRNA, respectively, and after preparation, they were transferred to liquid nitrogen tanks for storage.

[0077] In some embodiments, the mRNA composition further comprises a pharmaceutically acceptable carrier.

[0078] In some embodiments, the carrier is any one of a dendritic cell, a macrophage, a B cell, or a nanoparticle.

[0079] In a specific implementation, MICA-co-stimulatory molecule signal chimera mRNA and / or membrane-anchored IL-12 mRNA are introduced into mature dendritic cells loaded with tumor neoantigen mRNA to achieve reprogramming of mature DCs.

[0080] The embodiment of the present invention directly uses mature dendritic cells to solve the problem of poor DC maturation, antigen presentation and migration ability caused by the tumor suppression environment in the body, and overcomes the functional limitations of MoDC.

[0081] The embodiments of the present invention utilize any one or more of membrane-anchored IL-12, MICA-TNF family receptor chimera, and MICA-CD28 / B7 family receptor chimera to reprogram mature dendritic cells, which can promote the ability of DC cells to stimulate T cell activation and proliferation, effector factor secretion, and T cell memory conversion, thereby reducing tumor-mediated immunosuppression.

[0082] In addition, the membrane-anchored IL-12 provided in the embodiments of the present invention can also achieve local expression of IL-12 in tumor tissues, reduce the systemic toxicity of IL-12, and reduce the side effects during tumor suppression.

[0083] During the specific implementation process, the carrier can also be replaced with macrophages, B cells or nanoparticles according to actual treatment needs.

[0084] In a fourth aspect, the present invention provides an mRNA vaccine, which comprises the chimeric mRNA described in the first aspect or the mRNA composition described in the third aspect.

[0085] In a fifth aspect, the present invention provides a DC vaccine, wherein the DC vaccine comprises the chimeric mRNA described in the first aspect or the mRNA composition described in the third aspect.

[0086] In a sixth aspect, the present invention provides a method for preparing the DC vaccine of the fifth aspect, wherein the chimeric mRNA of the first aspect or the mRNA composition of the third aspect is introduced into mature DCs by electroporation or LNP delivery system.

[0087] In the seventh aspect, the present invention provides a use of the chimeric mRNA described in the first aspect, the mRNA composition described in the third aspect, the mRNA vaccine described in the fourth aspect, or the DC vaccine described in the fifth aspect.

[0088] In some embodiments, the application includes: application in the preparation of specific T cells against cancer; or application in the preparation of TCR-T cells against cancer; or application in the preparation of reagents against cancer; or application in the treatment and / or prevention of cancer.

[0089] In some embodiments, the cancer is any one of breast cancer, ovarian cancer, gastric cancer, liver cancer, prostate cancer, lung cancer, and colon cancer.

[0090] In order to enable those skilled in the art to better understand the MICA chimeric mRNA provided in the embodiments of the present invention, the following is a detailed description through specific examples. The reagents and instruments used, unless otherwise specified, are existing commercial products and can be purchased directly.

[0091] Example 1

[0092] Step 1. Preparation of lung cancer neoantigen mRNA

[0093] We collected lung cancer tissues from patients for exon and transcriptome sequencing. The sequencing data was used to obtain the top 20 mutation points through seven steps: (1) sequencing data filtering; (2) data alignment; (3) mutation detection; (4) HLA identification (the typing used in the present invention is HLA-A*11:01); (5) gene expression analysis; (6) gene fusion detection; (7) neoantigen prediction, sorting and screening. The neoantigen sorting and screening conditions are as follows: transcriptome sequencing data has mutation sequence support, TPM expression >10, affinity <500nM, mutation frequency >0.2, non-homologous peptides. The mutant sequence was transcribed in vitro according to the optimized sequence, and prepared into mRNA (i.e. lung cancer neoantigen mRNA) with 20 neoantigens in series through GS flexible linker connection. After preparation, it was transferred to a liquid nitrogen tank for storage.

[0094] The optimized 3'UTR mRNA sequence is shown in SEQ ID NO: 1, the optimized 5'UTR mRNA sequence is shown in SEQ ID NO: 2, the optimized N-terminal mRNA sequence of the protein coding sequence is shown in SEQ ID NO: 3, and the optimized C-terminal mRNA sequence of the protein coding sequence is shown in SEQ ID NO: 4. Subsequent mRNAs are optimized using the optimization conditions.

[0095] The sequences of 20 neoantigen peptides contained in lung cancer neoantigen mRNA are shown in SEQ ID NO: 5, and the gene names and mutant peptide sequences are shown in Table 1.

[0096] Step 2. Preparation of MICA-TNF family receptor or CD28 / B7 family receptor chimeric mRNA

[0097] Two chimeric mRNAs were prepared by in vitro transcription according to the optimized sequence, and after preparation, they were transferred to liquid nitrogen tanks for storage. The MICA-TNF family receptor chimeric mRNA or MICA-CD28 / B7 family receptor chimeric mRNA, each composed of: the extracellular MICA sequence connected to the CD28 transmembrane structure, and the intracellular TNF family receptor or CD28 / B7 family receptor intracellular signal region. The NCBI Gene ID of the MICA sequence is 100507436. The TNF family receptors are 41BBL, OX40L, CD40, ICOSL and CD27L, and the NCBI Gene IDs are 8744, 7292, 958, 23308 and 970, respectively; the CD28 / B7 family receptors are CD80, CD83 and CD86, and the NCBI Gene IDs are 941, 9308 and 942, respectively.

[0098] Step 3. Preparation of membrane-anchored IL-12 mRNA

[0099] The optimized sequence was used for in vitro transcription to prepare membrane-anchored IL-12 mRNA, which was then transferred to a liquid nitrogen tank for storage. The membrane-anchored IL-12 mRNA consists of IL-12A and IL-12B sequences connected by a GS flexible linker, and the transmembrane region is the transmembrane region of platelet-derived growth factor receptor β (Pdgfrb).

[0100] The NCBI Gene ID of the IL-12A sequence is 3592, and the NCBI Gene ID of the IL-12B sequence is 3593.

[0101] Step 4. Collect PBMCs

[0102] Before collection, patients are given a routine physical examination, including viral tests for hepatitis B, hepatitis C, HIV, syphilis, and the new coronavirus. The collection can only be carried out if the patient's physical condition is assessed by the doctor to be able to withstand the damage of collection and the virus test is negative. Collection is carried out in clinical institutions using a blood cell separator, and disposable sealable sterile bags are used for collection. After collection, PBMCs are stored at 2-8°C and transported to the production site.

[0103] Step 5. Isolation of monocytes and induction of mature DCs

[0104] Mononuclear cells were collected using a countercurrent elutriation device or magnetic bead separation. Cells were plated at 1 × 10 6 The concentration of 10 / mL (in actual operation, the concentration can be 1 to 5×10 6 / mL) were transferred into a serum-free medium containing GM-CSF and IL-4 with a final concentration of 25ng / ml, cultured for 5 days (in actual operation, the number of culture days can be 5 to 6 days), and an IFN-r / TNF-a / PGE2 cytokine mixture was added to stimulate cell maturation for 1 day (in actual operation, the number of stimulation days can be 1 to 2 days).

[0105] Figure 1 The characterization results of mature DC prepared in Example 1 of the present invention are shown. Figure 1 A is the purity percentage of monocytes before separation. Figure 1 B is the purity percentage of monocytes after separation. Figure 1 C is the detection result of dendritic cell activity. Figure 1 D is the detection result of dendritic cell induction rate, Figure 1 E is the test result of the number of cells produced by dendritic cells. Figure 1 F is the detection result of high expression DC marker CD209, Figure 1 G is the detection result of high expression of DC maturation marker CD80, Figure 1 H is the detection result of high expression of DC maturation marker CD83, Figure 1 I is the detection result of high expression of DC maturation marker CD86, Figure 1 J is the detection result of HLA-DR, a high-expression DC maturation marker. Figure 1 K is the detection result of HLA-ABC, a high-expression DC maturation marker. Figure 1 L is the detection result of the highly expressed DC migration marker CCR7.

[0106] Depend on Figure 1 The test results show that high-purity monocytes can be isolated using a centrifugal countercurrent elutriation system or CD14 magnetic beads. The average value before separation is 19.1%, ranging from 13.8 to 26.5 ( Figure 1A), the average value after separation was 75.5%, ranging from 63.2 to 89.3 ( Figure 1 B); the average viability of dendritic cells was 93.8%, ranging from 83.0-98.0% ( Figure 1 C); the average induction rate was 54.0%, ranging from 45.9 to 71.4% ( Figure 1 D); capable of producing more than 10 8 Dendritic cells, average value was 8.2×10 8 cells, ranging from 1.37 to 12.8×10 8 cell( Figure 1 E); high expression of DC marker CD209, the average value was 96.6%, ranging from 93.0 to 100.0% ( Figure 1 F), high expression of DC maturation markers CD80, CD83, CD86, HLA-DR and HLA-ABC, with an average CD80 value of 99.0% and a range of 94.0-100% ( Figure 1 G), the average CD83 value was 99.0%, ranging from 96.8-100% ( Figure 1 H), CD86 average value was 99.8%, ranging from 99.0-100% ( Figure 1 I), the average HLA-DR value was 100.0%, ranging from 100.0 to 100% ( Figure 1 J), the average HLA-ABC value is 100.0%, and the range is 100.0~100% ( Figure 1 K); high expression of DC migration marker CCR7, the average value was 89.2%, ranging from 85.0 to 97.0% ( Figure 1 L).

[0107] The above results indicate that we can obtain a large number of highly mature dendritic cells in vitro.

[0108] Step 6. Preparation of reprogrammed mature dendritic cells

[0109] The mature DCs prepared in step 5 were collected in a biosafety cabinet, and the three related mRNAs prepared above (i.e., MICA-TNF family receptor chimera mRNA, MICA-CD28 / B7 family receptor chimera mRNA, and membrane-anchored IL-12 mRNA) were introduced into the corresponding grouped mature DCs loaded with lung cancer neoantigen mRNA using the LNP delivery system. The cells were allowed to rest for 4 hours (the resting time can be 4 to 8 hours in actual operation), and the cells were collected and frozen.

[0110] The reprogrammed mature DC products prepared in this example include: different MICA chimeric mature DC products (i.e., Figure 3 The membrane-anchored IL-12 mature DC products (i.e., the MICA-41BBL group, MICA-OX40L group, MICA-ICOSL group, MICA-CD40 group, MICA-CD27L group, MICA-CD80 group, and MICA-CD86 group) were obtained by reprogramming mature DC loaded with lung cancer neoantigen mRNA using membrane-anchored IL-12 mRNA. Figure 3 The membrane-anchored IL-12 group shown in the figure) was used to reprogram mature DCs loaded with lung cancer neoantigen mRNA by combining MICA-TNF family receptor chimeric mRNA or MICA-CD28 / B7 family receptor chimeric mRNA with membrane-anchored IL-12 mRNA to obtain different MICA chimera + membrane-anchored IL-12 mature DC products (i.e. Figure 6 MICA-41BBL+membrane-anchored IL-12 group, MICA-OX40L+membrane-anchored IL-12 group, MICA-ICOSL+membrane-anchored IL-12 group, MICA-CD40+membrane-anchored IL-12 group, MICA-CD27L+membrane-anchored IL-12 group, MICA-CD80+membrane-anchored IL-12 group, MICA-CD86+membrane-anchored IL-12 group).

[0111] Take appropriate amount of cells of each of the above products to detect dendritic cell phenotype, neoantigen expression, neoantigen delivery efficiency, selection of the range of tandem neoantigen numbers, MICA expression of MICA-TNF family receptor chimera, MICA expression of CD28 / B7 family receptor chimera and IL-12 expression.

[0112] Dendritic cell phenotype, neoantigen expression, MICA expression of MICA-TNF family receptor chimera, and MICA expression of CD28 / B7 family receptor chimera were analyzed by flow cytometry; neoantigen delivery efficiency and the range of tandem neoantigen number selection were both determined by the combination of antigen-loaded DCs and neoantigen-specific CD8 + T cells were incubated for 24 hours and the supernatant was collected and used for BD TM Cytometric Bead Array (CBA) Human IFN-γFlex Set Kit was used to detect IFN-r secretion; IL-12 expression was detected using BD TMCytometric Bead Array (CBA) Human IL-12Flex Set Kit was used to detect IL-12 secretion.

[0113] Neoantigen expression and delivery efficiency detection

[0114] Figure 2 The characterization data of the neoantigens in the reprogrammed dendritic cells prepared in Example 1 of the present invention are shown. Among them, Figure 2 A is one of the test results representing neoantigen expression. Figure 2 B is one of the test results representing the efficiency of neoantigen delivery. Figure 2 In A, the unoptimized mRNA refers to the neoantigen mRNA obtained by not optimizing the neoantigen mRNA using the optimization method of the present application; the optimized mRNA refers to the neoantigen mRNA obtained by optimizing the neoantigen mRNA using the optimization method provided above.

[0115] Depend on Figure 2 The characterization data of A show that the average expression of the unoptimized neoantigen mRNA is 69.2%, ranging from 57.8-81.9%, while the average expression of the optimized neoantigen mRNA is 83.5%, ranging from 75.2-91.9%. The data show that the optimized neoantigen expression rate is higher, which is more beneficial to stimulate the killing ability of antigen-specific T cells.

[0116] In this example, the inventors used the ability of antigen-stimulated antigen-specific T cells to secrete IFN-r to detect differences in antigen delivery efficiency.

[0117] from Figure 2From the experimental results of B, it can be seen that for the unoptimized neoantigen mRNA, when the ratio of DC to T cells was 1:1000, the average DC antigen delivery efficiency was 18.4pg / ml, ranging from 11.2-28.2pg / ml; when the ratio of DC to T cells was 1:100, the average DC antigen delivery efficiency was 186.4pg / ml, ranging from 132-262pg / ml; when the ratio of DC to T cells was 1:10, the average DC antigen delivery efficiency was 1610.8pg / ml, ranging from 1230-2144.9pg / ml. When the ratio of DC to T cells was 1:1000, the average DC antigen delivery efficiency was 24.9pg / ml, ranging from 19.6-30.8pg / ml; when the ratio of DC to T cells was 1:100, the average DC antigen delivery efficiency was 515.4pg / ml, ranging from 480.8-567.2pg / ml; when the ratio of DC to T cells was 1:10, the average DC antigen delivery efficiency was 4898.6pg / ml, ranging from 4483.3-5120.0pg / ml. From these data, it can be seen that the DC antigen delivery efficiency increases with the ratio of DC to T cells. In addition, when the ratio of DC to T cells was 1:1000, 1:100 and 1:10, the DC presentation efficiency of the optimized antigen mRNA was increased by 1.4, 2.8 and 3.0 times, respectively, compared with the DC loaded with unoptimized antigen mRNA.

[0118] In this example, the inventors used the ability of antigen-specific T cells to secrete IFN-r by stimulating antigens to detect the effect of the number range of loaded antigens on the antigen delivery efficiency. Figure 2 C is the test result of the ability of antigen-stimulated antigen-specific T cells to secrete IFN-r. Figure 2 C experimental results show that the number of loaded antigens is in the range of 1-20, which has no effect on the antigen presentation efficiency. It can be seen that the present invention uses a tandem form for the neoantigen mRNA, which can load up to 20 neoantigens and increase the number of antigen presentations to increase the stimulation of the diversity of neoantigens CD8 + Capacity of the T cell repertoire.

[0119] Detection of MICA-TNF family receptor and MICA-CD28 / B7 family receptor chimera expression

[0120] In this example, flow cytometry was used to analyze the expression of MICA on the surface of different MICA chimera DC cells and the expression of MICA chimera in MICA chimera groups. Figure 3 The results of the detection of MICA chimera expression on the surface of mature DCs prepared in Example 1 of the present invention are shown. Figure 3 A shows the results of MICA expression on the surface of DCs in the MICA chimera group and the non-reprogrammed group. Figure 3 B is the detection result of the expression of TNF family receptors and CD28 / B7 family receptors on the surface of mature DCs of MICA chimeras. Among them, the MICA chimera group is an experimental group in which MICA-TNF family receptors or MICA-CD28 / B7 family receptor chimeras are introduced into mature DCs to achieve reprogramming of mature DCs. In the non-reprogramming group, MICA-TNF family receptors or MICA-CD28 / B7 family receptor chimeras were not introduced into mature DCs.

[0121] Depend on Figure 3 From the data results of A, it can be seen that the MICA chimera was successfully expressed on the surface of DC in the MICA chimera group, while there was no expression of MICA chimera on the surface of DC in the non-reprogramming group.

[0122] Depend on Figure 3 The data results of B show that the average expression of MICA-41BBL is 81.3%, ranging from 62.0 to 95.3%; the average expression of MICA-OX40L is 73.0%, ranging from 52.0 to 96.5%; the average expression of MICA-ICOSL is 86.4%, ranging from 75.3 to 96.5%; the average expression of MICA-CD40 is 76.5%, ranging from 58.0 to 85.3%, the average expression of MICA-CD27L is 76.5%, ranging from 57.8 to 93.5%. The average expression of MICA-CD80 is 74.7%, ranging from 55.5 to 90.8%, and the average expression of MICA-CD86 is 76.7%, ranging from 59.3 to 98.8%.

[0123] Above Figure 3 The experimental results showed that in mature DC cells reprogrammed by MICA chimeras, MICA chimeras could be overexpressed at a high ratio on the DC cell surface.

[0124] Membrane-anchored IL-12 expression detection

[0125] In this example, flow cytometry was used to analyze the expression of membrane-anchored IL-12 on the surface of DCs, and a CBA kit was used to detect the secretion amount of IL-12 secreted by DCs.

[0126] Figure 4 The results of the detection of IL-12 expression on the surface of IL-12-anchored mature DC prepared in Example 1 of the present invention are shown. Figure 4 A is the expression results of IL-12 on the surface of each DC in the membrane-anchored IL-12 group and the non-reprogrammed group. Figure 4 B is the detection result of surface IL-12 expression in the membrane-anchored IL-12 group. Figure 4 C is the result of the detection of IL-12 secretion by DC in the membrane-anchored IL-12 group. Figure 4In A, the membrane-anchored IL-12 group is an experimental group in which membrane-anchored IL-12 is introduced into mature DCs to achieve reprogramming of mature DCs. The non-reprogrammed group is a control group in which membrane-anchored IL-12 is not introduced into mature DCs.

[0127] Depend on Figure 4 The detection results of A show that in the membrane-anchored IL-12 group, membrane-anchored IL-12 is highly expressed on the surface of DCs, while the surface of DCs that have not been reprogrammed with membrane-anchored IL-12 hardly expresses IL-12. Figure 4 The test results of B show that the average expression of IL-12 on the surface of DC in the membrane-anchored IL-12 group is 85.6%, ranging from 78.6% to 89.3%, that is, the surface of DC in the membrane-anchored IL-12 group can highly express IL-12. Figure 4 The detection results of C showed that the average IL-12 secretion of DC in the membrane-anchored IL-12 group was 4009 pg / ml, ranging from 3000-5160 pg / ml.

[0128] Above Figure 4 The test results showed that in the membrane-anchored IL-12 group, the DC surface could overexpress membrane-anchored IL-12 at a high ratio, achieving local high expression of IL-12.

[0129] Step 7. In vitro functional assessment of reprogrammed DCs

[0130] In order to evaluate the immune effects of the reprogrammed DC products prepared in step 6 above, we compared the reprogrammed DC products with autologous CD8 + T cells were co-cultured in vitro at a ratio of 1:10 for 2 weeks (in actual operation, the culture time can be 2 to 4 weeks). + The multifunctionality of each group of reprogrammed DC products was evaluated by indicators such as T cells (pMHC tetramer staining), their intracellular cytokines (IFN-r / TNF-α) and lung cancer killing function, and the immune response characteristics of each group of reprogrammed DC products were comprehensively evaluated.

[0131] According to the instructions of MBL Quant Tetramer Kit, the corresponding peptide segment-Tetramer was synthesized and CD8 + T cells were stained with corresponding peptide pMHC tetramers and flow cytometry was used to assess antigen-specific CD8 + T cell percentage.

[0132] After 2 weeks of in vitro stimulation, CD8 + T cells were stimulated with DC cells for 4 hours, and then stained with corresponding flow cytometry antibodies, and specific CD8 +The percentage of intracellular IFN-γ and TNF-a in T cells.

[0133] Calculation of killing efficiency of lung cancer cells: CD8 + T cells and lung cancer cell lines loaded with corresponding neoantigen peptides were incubated at a ratio of 10:1. After 24 hours of culture, the surviving tumor cells were counted and analyzed by flow cytometry to detect antigen-specific CD8 + The killing ability of T cells on lung cancer cells.

[0134] The formula for calculating the efficiency of killing lung cancer cells is: killing efficiency = (1-the number of surviving tumor cells in the DC product group / the number of surviving tumor cells in the empty DC group) × 100.

[0135] In vitro functional assessment of chimeric reprogrammed DCs using membrane-anchored IL-12 or MICA alone

[0136] In this example, the MICA chimeric mature DC products and IL-12 anchored mature DC products prepared above were evaluated for in vitro function. The specific evaluation results are as follows: Figure 5 shown. Figure 5 The results of in vitro functional evaluation of the chimeric reprogrammed DC products using only membrane-anchored IL-12 or MICA in Example 1 are shown, wherein the control group is mature DCs loaded with only lung cancer neoantigen mRNA.

[0137] Figure 5 A is the test result of the change in the specific T cell fold after DC products stimulated specific T cells. Figure 5 The data results of A show that compared with the DC control group loaded with lung cancer neoantigen mRNA, the average change of specific T cells in the membrane-anchored IL-12 group was 3.5, ranging from 1.9 to 5.1; the average change of specific T cells in the MICA-41BBL group was 2.8, ranging from 1.5 to 4.2; the average change of specific T cells in the MICA-OX40L group was 2.8, ranging from 1.9 to 4.0; the average change of specific T cells in the MICA-ICOSL group was 3.3, ranging from 1.9 to 4.8; the average change of specific T cells in the MICA-CD80 group was 3.6, ranging from 2.1 to 5.4; the average change of specific T cells in the MICA-CD86 group was 2.8, ranging from 2.1 to 3.4; the average change of specific T cells in the MICA-CD40 group was 4.2, ranging from 2.8 to 5.4; the average expression of specific T cells in the MICA-CD27L group was 3.1, ranging from 1.9 to 5.1.

[0138] Figure 5 B is the test result of the change in the secretion of IFN-r by T cells after DC products stimulated specific T cells. Figure 5The data results of B show that compared with the DC control group loaded with lung cancer neoantigen mRNA, the average change of IFN-r in the membrane-anchored IL-12 group was 13.5, ranging from 11.9 to 15.1; the average change of IFN-r in the MICA-41BBL group was 6.8, ranging from 5.5 to 8.2; the average change of IFN-r in the MICA-OX40L group was 6.8, ranging from 5.9 to 8.0; the average change of IFN-r in the MICA-ICOSL group was The mean value was 7.3, ranging from 5.9 to 8.8; the mean value of IFN-r change in the MICA-CD80 group was 7.6, ranging from 6.1 to 9.4; the mean value of IFN-r change in the MICA-CD86 group was 6.5, ranging from 4.6 to 7.4; the mean value of IFN-r change in the MICA-CD40 group was 8.2, ranging from 6.8 to 9.4; the mean value of IFN-r change in the MICA-CD27L group was 7.1, ranging from 5.9 to 9.1.

[0139] Figure 5 C is the test result of the change in the secretion of TNF-a by T cells after DC products stimulated specific T cells. Figure 5 From the data results of C, it can be seen that compared with the DC control group loaded with lung cancer neoantigen mRNA, the average change of TNF-a in the membrane-anchored IL-12 group was 11.5, ranging from 9.9 to 13.1; the average change of TNF-a in the MICA-41BBL group was 4.8, ranging from 3.5 to 6.2; the average change of TNF-a in the MICA-OX40L group was 4.8, ranging from 3.9 to 6.0; the average change of TNF-a in the MICA-ICOSL group was 5.3, ranging from 3.9 to 6.8; the average change of TNF-a in the MICA-CD80 group was 5.6, ranging from 4.1 to 7.4; the average change of TNF-a in the MICA-CD86 group was 4.5, ranging from 2.6 to 5.4; the average change of TNF-a in the MICA-CD40 group was 6.2, ranging from 4.8 to 7.4; the average expression of TNF-a in the MICA-CD27L group was 5.1, ranging from 3.9 to 7.1.

[0140] Figure 5 D is the test result of the killing rate of lung cancer cell lines in vitro by T cells after DC products stimulated specific T cells. Figure 5The data of D showed that the average killing rate of the DC control group loaded with lung cancer neoantigen mRNA was 10.8%, ranging from 9.5 to 12.2%; the average killing rate of the membrane-anchored IL-12 group was 46.0%, ranging from 39.6 to 52.4%; the average killing rate of the MICA-41BBL group was 20.4%, ranging from 16.5 to 24.6%; the average killing rate of the MICA-OX40L group was 23.6%, ranging from 20.7 to 28.0%; the killing rate of the MICA-ICOSL group was 23.6%, ranging from 21.8 to 28.0%; the killing rate of the MICA-OX40L group was 23.6%, ranging from 21.8 to 28.0%; the killing rate of the MICA-ICOSL group was 23.6%, ranging from 21.8 to 28.0%. The average killing rate of the MICA-CD80 group was 22.9%, ranging from 18.3% to 28.2%; the average killing rate of the MICA-CD86 group was 19.4%, ranging from 13.8% to 22.2%; the average killing rate of the MICA-CD40 group was 24.5%, ranging from 20.4% to 28.2%; the average killing rate of the MICA-CD27L group was 21.3%, ranging from 17.7% to 27.3%.

[0141] Above Figure 5 The results showed that after MICA chimera mRNA was applied to mature DC, compared with the control group, DC cells stimulated specific T cell proliferation, effector factor secretion, and lung cancer killing ability. This shows that the MICA chimera provided by the present application increases the binding of extracellular MICA to NKG2D of T cells, promotes the activation of intracellular co-stimulatory molecules, reduces the T cell activation threshold, increases the proliferation and differentiation of neoantigen-specific T cells, and expands the number and types of neoantigen-specific T cells in the body.

[0142] Moreover, membrane-anchored IL-12 mRNA applied to mature DCs can also increase the ability of DC cells to stimulate specific T cell proliferation, secrete effector factors, and kill lung cancer.

[0143] In vitro functional evaluation of chimeric reprogrammed DC cells using combined membrane-anchored IL-12 and MICA

[0144] In this example, the reprogrammed DC products obtained by membrane-anchored IL-12 and different MICA chimeras were evaluated for in vitro function. The specific evaluation results are as follows: Figure 6 shown. Figure 6 The results of the in vitro functional evaluation of lung cancer in the DC products reprogrammed with membrane-anchored IL-12 and different MICA chimeric cells in Example 1 are shown, wherein the control group is mature DCs loaded with only lung cancer neoantigen mRNA.

[0145] Figure 6 A is the result of the detection of the change in the number of specific T cells after the DC products reprogrammed by membrane-anchored IL-12 and different MICA chimera combinations stimulated specific T cells. Figure 6The data results of A show that compared with the DC control group loaded with lung cancer neoantigen mRNA, the average change of specific T cells in the MICA-41BBL+membrane-anchored IL-12 group was 16.8, ranging from 9.0 to 25.2; the average change of specific T cells in the MICA-OX40L+membrane-anchored IL-12 group was 16.6, ranging from 11.4 to 24.0; the average change of specific T cells in the MICA-ICOSL+membrane-anchored IL-12 group was 19.7, ranging from 11.4 to 28.8; MICA-CD8 The average change of specific T cells in the MICA-CD86+ membrane-anchored IL-12 group was 16.7, ranging from 12.6 to 20.4; the average change of specific T cells in the MICA-CD40+ membrane-anchored IL-12 group was 25.0, ranging from 16.8 to 32.4; the average expression of specific T cells in the MICA-CD27L+ membrane-anchored IL-12 group was 18.6, ranging from 11.4 to 30.6.

[0146] Figure 6 B is the result of the detection of the fold change of IFN-r secretion by T cells after the DC products reprogrammed by membrane-anchored IL-12 and different MICA chimera combinations stimulated specific T cells. Figure 6 The data results of B show that compared with the DC control group loaded with lung cancer neoantigen mRNA, the average change of IFN-r secretion in the MICA-41BBL+membrane-anchored IL-12 group was 34.0, ranging from 27.5 to 41.0; the average change of IFN-r secretion in the MICA-OX40L+membrane-anchored IL-12 group was 33.8, ranging from 29.5 to 40.0; the average change of IFN-r secretion in the MICA-ICOSL+membrane-anchored IL-12 group was 36.4, ranging from 29.5 to 44.0; The average change in IFN-r secretion in the MICA-CD86+ membrane-anchored IL-12 group was 38.1, ranging from 30.5 to 47.0; the average change in IFN-r secretion in the MICA-CD86+ membrane-anchored IL-12 group was 32.3, ranging from 23.0 to 37.0; the average change in IFN-r secretion in the MICA-CD40+ membrane-anchored IL-12 group was 40.8, ranging from 34.0 to 47.0; the average expression of IFN-r secretion in the MICA-CD27L+ membrane-anchored IL-12 group was 35.5, ranging from 29.5 to 45.5.

[0147] Figure 6 C is the result of the detection of the fold change of TNF-a secretion by T cells after the DC products reprogrammed by membrane-anchored IL-12 and different MICA chimera combinations stimulated specific T cells. Figure 6The data results of C show that compared with the DC control group loaded with lung cancer neoantigen mRNA, the average change in TNF-a secretion in the MICA-41BBL+membrane-anchored IL-12 group was 28.8, ranging from 21.0 to 37.2; the average change in TNF-a secretion in the MICA-OX40L+membrane-anchored IL-12 group was 28.6, ranging from 23.4 to 36.0; the average change in TNF-a secretion in the MICA-ICOSL+membrane-anchored IL-12 group was 31.7, ranging from 23.4 to 40.8; The average change in TNF-a secretion in the MICA-CD86+ membrane-anchored IL-12 group was 33.7, ranging from 24.6 to 44.4; the average change in TNF-a secretion in the MICA-CD86+ membrane-anchored IL-12 group was 26.7, ranging from 15.6 to 32.4; the average change in TNF-a secretion in the MICA-CD40+ membrane-anchored IL-12 group was 37.0, ranging from 28.8 to 44.4; the average expression of TNF-a secretion in the MICA-CD27L+ membrane-anchored IL-12 group was 30.6, ranging from 23.4 to 42.6.

[0148] Figure 6 D is the result of the test of the killing rate of lung cancer cell lines in vitro by T cells after stimulating specific T cells with DC products reprogrammed by membrane-anchored IL-12 and different MICA chimera combinations. Figure 6 The data results of D show that the average killing rate of the DC control group loaded with lung cancer neoantigen mRNA was 10.0%, ranging from 5.5 to 14.2%; the average killing rate of the MICA-41BBL+membrane-anchored IL-12 group was 61.2%, ranging from 49.5 to 73.8%; the average killing rate of the MICA-OX40L+membrane-anchored IL-12 group was 71.1%, ranging from 62.0 to 84.0%; the average killing rate of the MICA-ICOSL+membrane-anchored IL-12 group was 65.6%, ranging from 53.1 to 7 9.2%; the average killing rate of MICA-CD80+membrane-anchored IL-12 group was 68.6%, ranging from 54.9% to 84.6%; the average killing rate of MICA-CD86+membrane-anchored IL-12 group was 58.1%, ranging from 41.4% to 66.6%; the average killing rate of MICA-CD40+membrane-anchored IL-12 group was 73.5%, ranging from 61.2% to 84.6%; the average killing rate of MICA-CD27L+membrane-anchored IL-12 group was 63.9%, ranging from 53.1% to 81.9%.

[0149] Above Figure 5 and Figure 6The results shown show that after reprogramming DC cells with membrane-anchored IL-12 combined with different MICA chimeras, the DC cells can further increase their ability to stimulate specific T cell proliferation, secrete effector factors, and kill lung cancer compared to using membrane-anchored IL-12 or different MICA chimeras alone.

[0150] Step 8. In vivo functional assessment of reprogrammed DC cells

[0151] Female NSG- mice were divided into 8 groups. Group 1 was tumor-bearing, humanized CD8 cells, and mature dendritic cells loaded with lung cancer neoantigen mRNA. Groups 2-8 were tumor-bearing, humanized CD8 cells, and reprogrammed mature dendritic cells loaded with membrane-anchored IL-12 and different MICA chimera combinations. Seven days after subcutaneous injection of lung cancer cells, CD8 + T cells were injected intravenously, and then the corresponding group of reprogrammed autologous dendritic cells were injected once every 7 days for 5 times. After 2 weeks of observation after 5 times of administration, all mice were euthanized and dissected. The size of lung cancer in different groups was detected by small animal in vivo imaging, and the tumor inhibition rate was calculated.

[0152] Figure 7 The results of the present invention on the in vivo functional evaluation of the chimeric reprogrammed DC products using membrane-anchored IL-12 and MICA in lung cancer are shown. Figure 7 The experimental results show that the average tumor inhibition rate of the DC control group loaded with lung cancer neoantigen mRNA was 20.0%, ranging from 11.0-28.4%; the average tumor inhibition rate of the MICA-41BBL+membrane-anchored IL-12 group was 71.2%, ranging from 59.5-83.8%; the average tumor inhibition rate of the MICA-OX40L+membrane-anchored IL-12 group was 81.1%, ranging from 71.9-94.0%; the average tumor inhibition rate of the MICA-ICOSL+membrane-anchored IL-12 group was 75.6%, ranging from 63.1- 89.2%; the average tumor inhibition rate of MICA-CD80+membrane-anchored IL-12 group was 75.6%, ranging from 63.1-89.2%; the average tumor inhibition rate of MICA-CD86+membrane-anchored IL-12 group was 68.1%, ranging from 51.4-76.6%; the average tumor inhibition rate of MICA-CD40+membrane-anchored IL-12 group was 83.5%, ranging from 71.2-94.6%; the average tumor inhibition rate of MICA-CD27L+membrane-anchored IL-12 group was 73.9%, ranging from 63.1-91.9%.

[0153] Above Figure 7 Experimental results showed that membrane-anchored IL-12 combined with different MICA chimeras to reprogram DC cells can effectively inhibit the growth of lung cancer in vivo.

[0154] Table 1. Lung cancer neoantigen gene names and mutant peptide sequences

[0155] serial number Gene name Mutant gene peptide 1 DOCK5 RVFLRAINR 2 ABCG2 GTLTVRENLK 3 SUSD1 TQITEPPLPK 4 PHYH AQVHLVMEK 5 LAMB3 LTDLTPTFNK 6 PDZD8 ASEGFRYIK 7 SPTBN1 ASNKEWLEK 8 RNF213 KSLSPQDEK 9 CCT5 RVAIVHLDK 10 DHX37 QVIMEAVAK 11 NEK2 KSYSLLKERK 12 AOX1 SLSAVGYFR 13 WWC1 STAQGCGLK 14 PAF1 RTMPTLMMR 15 PUM3 KSADHPTLD 16 TP53BP2 QMNNLFQK 17 TRUB1 AGMPSPAWTK 18 HSPG2 ATNMSVHFR 19 ZC3HAV1 RIADDADPK 20 SLC5A6 SLFPLSCQK

[0156] Example 2

[0157] This example explored the inhibitory effect of reprogrammed DC on different tumors, and was divided into 8 groups. The mRNA of tumor neoantigens used in Groups 1-8 was a series of 20 liver cancer neoantigens, whose gene names and mutant peptide sequences are shown in Table 2. The sequences of the 20 neoantigen peptides contained in the liver cancer neoantigen mRNA are shown in SEQ ID NO: 6.

[0158] Table 2. Hepatocellular carcinoma neoantigen gene names and mutant peptide sequences

[0159] serial number Gene name Mutant gene peptide 1 C3 VxDV 2 PTPA SLLPIHPVTL 3 SPRY2 SLSRSISTV 4 HSD17B12 YLIHALMGL 5 KATNIP LLGDILDEL 6 AUP1 LLLYAPVGL 7 TM7SF3 LLGQGVIYNV 8 PLCB3 ALLIYTEAL 9 BLTP3A FLLSIWACL 10 EEF1AKMT4 VLVPGGWFI 11 ETFB VMLEGDKLKV 12 LRRC45 KLLRDLSAV 13 ELP2 ALCPLIVSA 14 ZDHHC4 AMHGLLHYL 15 LRP4 ITMKNTIAV 16 GPR39 FVMGLLGNSV 17 TMED3 LLLLLLRRV 18 HSD17B7 KLLELEEHI 19 WDR18 LLAAQLGKNYV 20 GM2A SLPKSEFAV

[0160] The specific experimental operation of this example is similar to the experimental operation of the corresponding reprogrammed DC in the above Example 1, and the only difference is the tumor neoantigen mRNA. The same detection method is used to evaluate the in vivo function of the reprogrammed DC obtained in groups 1-8 of this example.

[0161] Figure 8 The results of the in vivo functional evaluation of liver cancer by combining membrane-anchored IL-12 and MICA chimeric reprogrammed DC products are shown in this embodiment. Figure 8 The experimental results show that the average tumor inhibition rate of the DC control group loaded with liver cancer neoantigen mRNA was 29.2%, ranging from 23.8-34.1%; the average tumor inhibition rate of the MICA-41BBL+membrane-anchored IL-12 group was 74.1%, ranging from 51.4-91.8%; the average tumor inhibition rate of the MICA-OX40L+membrane-anchored IL-12 group was 75.7%, ranging from 63.1-83.1%; the average tumor inhibition rate of the MICA-ICOSL+membrane-anchored IL-12 group was 77.3%, ranging from 59.5-9 0.1%; the average tumor inhibition rate of MICA-CD80+membrane-anchored IL-12 group was 71.3%, ranging from 64.9-83.5%; the average tumor inhibition rate of MICA-CD86+membrane-anchored IL-12 group was 79.0%, ranging from 63.1-94.6%; the average tumor inhibition rate of MICA-CD40+membrane-anchored IL-12 group was 82.8%, ranging from 71.2-96.0%; the average tumor inhibition rate of MICA-CD27L+membrane-anchored IL-12 group was 72.9%, ranging from 62.2-94.0%.

[0162] Above Figure 8 Experimental results showed that membrane-anchored IL-12 combined with different MICA chimeras to reprogram DC cells can effectively inhibit liver cancer growth in vivo.

[0163] Example 3

[0164] This example explores the inhibitory effect of reprogrammed DC on different tumors, and is divided into 8 groups. The neoantigen mRNA used in Groups 1-8 is a series of 20 gastric cancer neoantigens, whose gene names and mutant peptide sequences are shown in Table 3. The sequences of the 20 neoantigen peptides contained in the gastric cancer neoantigen mRNA are shown in SEQ ID NO: 7.

[0165] Table 3. Gastric cancer neoantigen gene names and mutant peptide sequences

[0166] serial number Gene name Mutant gene peptide 1 DNAJB12 YVDJ 2 NADK AVHNGLGEK 3 TCOF1 AVATAAQAK 4 EXO1 FTDEESYSFK 5 FLNA SQFQVDTSK 6 FTO ATACETFLK 7 PKN3 SSLSTISPPK 8 HYAL2 AVAWAMELK 9 DGD KAMVHTLCK 10 ZC3HAV1 RIADDADPK 11 HBA1 SVSTVLTYK 12 TMPO KVIKKCGNK 13 PTPRS NTDLAPHHPK 14 SEC24D PVYMNCLFK 15 HIBADH VSSPADFAEK 16 VAV3 SLMGLVEYYK 17 PCYOX1 RTLLETLKK 18 BLTP3A VMEFQSNMEK 19 IQGAP2 ATARNSYLSR 20 CEP72 VTAELHHAHK

[0167] The specific experimental operation of this example is similar to the experimental operation of the corresponding reprogrammed DC in the above Example 1, and the only difference is the tumor neoantigen mRNA. The same detection method is used to evaluate the in vivo function of the reprogrammed DC obtained in groups 1-8 of this example.

[0168] Fig. 9 The results of the in vivo functional evaluation of gastric cancer by combining membrane-anchored IL-12 and MICA chimeric reprogrammed DC products are shown in this embodiment. Fig. 9 The experimental results show that the average tumor inhibition rate of the DC control group loaded with gastric cancer neoantigen mRNA was 24.5%, ranging from 18.4-29.1%; the average tumor inhibition rate of the MICA-41BBL+membrane-anchored IL-12 group was 80.3%, ranging from 65.8-96.0%; the average tumor inhibition rate of the MICA-OX40L+membrane-anchored IL-12 group was 75.7%, ranging from 63.1-83.8%; the average tumor inhibition rate of the MICA-ICOSL+membrane-anchored IL-12 group was 66.7%, ranging from 59.5-7. 8.3%; the average tumor inhibition rate of MICA-CD80+membrane-anchored IL-12 group was 71.2%, ranging from 62.2-84.5%; the average tumor inhibition rate of MICA-CD86+membrane-anchored IL-12 group was 80.5%, ranging from 73.0-90.1%; the average tumor inhibition rate of MICA-CD40+membrane-anchored IL-12 group was 77.6%, ranging from 71.9-91.9%; the average tumor inhibition rate of MICA-CD27L+membrane-anchored IL-12 group was 78.8%, ranging from 63.1-94.6%.

[0169] Above Fig. 9 Experimental results showed that membrane-anchored IL-12 combined with different MICA chimeras to reprogram DC cells can effectively inhibit gastric cancer growth in vivo.

[0170] Example 4

[0171] This example explores the inhibitory effect of reprogrammed DC on melanoma. The specific experimental operation of this example is similar to the experimental operation of the corresponding reprogrammed DC in Example 1 above, with the only difference being the tumor neoantigen mRNA. The same detection method was used to evaluate the in vivo function of the reprogrammed DC obtained in groups 1-8 of this example.

[0172] In this example, the in vivo function of the reprogrammed DCs obtained in groups 1-8 of this example was evaluated using the same detection method as in Example 1. The mRNA of the neoantigen used in groups 1-8 is a melanoma neoantigen, and its gene name and mutant peptide sequence are shown in Table 4. The sequence of a neoantigen peptide contained in the melanoma neoantigen mRNA is shown in SEQ ID NO: 8.

[0173] Table 4. Melanoma neoantigen gene names and mutant peptide sequences

[0174] serial number Gene name Mutant gene peptide 1 Melan-A / MART-1 EAAGIGILTV

[0175] Fig.10 The results of this embodiment show the in vivo functional evaluation of melanoma cells using a combination of membrane-anchored IL-12 and MICA chimeric reprogrammed DC products. Fig.10 The experimental results show that the average tumor inhibition rate of the DC control group loaded with mRNA encoding neoantigens was 54.5%, ranging from 39.1% to 88.7%; the average tumor inhibition rate of the MICA-41BBL+IL-12 group was 85.3%, ranging from 75.7% to 96.0%; the average tumor inhibition rate of the MICA-OX40L+IL-12 group was 85.0%, ranging from 75.8% to 94.9%; the average tumor inhibition rate of the MICA-ICOSL+IL-12 group was 84.5%, ranging from 71.2% to 96.0%. -94.9%; the average tumor inhibition rate of the MICA-CD80+IL-12 group was 85.5%, ranging from 73.0-94.8%; the average tumor inhibition rate of the MICA-CD86+IL-12 group was 79.3%, ranging from 72.0-91.9%; the average tumor inhibition rate of the MICA-CD40+IL-12 group was 88.5%, ranging from 83.5-93.1%; the average tumor inhibition rate of the MICA-CD27L+IL-12 group was 86.0%, ranging from 76.6-93.8%.

[0176] Above Fig.10 Experimental results showed that membrane-anchored IL-12 combined with different MICA chimeras to reprogram DC cells can effectively inhibit melanoma growth in vivo.

[0177] From the data results of the above Examples 1-4, it can be seen that when different types of tumor neoantigens are introduced into the reprogrammed DC cells using the combination of membrane-anchored IL-12 and MICA chimera, there is a certain tumor inhibition effect on the corresponding tumors; and the number of tumor neoantigens selected can be adjusted according to actual needs. In other words, based on the technical concept of the present invention, the neoantigens in the above embodiments are changed into neoantigens of the target cancers to be treated (such as ovarian cancer, gastric cancer, liver cancer, colon cancer, breast cancer, lung cancer, melanoma, etc.), and the corresponding reprogrammed DCs can be obtained, and after being made into DC vaccines, they can be used to inhibit tumors in target cancer patients.

[0178] Example 5

[0179] Step 5.1 Isolation of monocytes and induction of mature macrophages

[0180] Collect mononuclear cells using a countercurrent elutriation device or magnetic bead separation. Cells were plated at 1-5 × 10 6 The cells were transferred into a serum-free medium containing M-CSF at a final concentration of 1000 U / ml at a concentration of 1000 U / ml, cultured for 5-6 days, and an IFN-r / LPS cytokine mixture was added to stimulate cell maturation for 1-2 days to obtain mature macrophages.

[0181] Step 5.2 In vitro functional assessment of reprogrammed DC cells

[0182] Mature macrophages were collected in a biosafety cabinet, and the MICA-TNF family receptor chimera mRNA or MICA-CD28 / B7 family receptor chimera mRNA prepared in Example 1 was introduced into the corresponding group of macrophages loaded with lung cancer neoantigen mRNA using the LNP delivery system to achieve reprogramming of the MICA chimera + membrane-anchored IL-12 combination of macrophages. The macrophages were rested for 4-8 hours, and the cells were collected and frozen for subsequent cell function evaluation.

[0183] To evaluate the immune effects of reprogrammed macrophages, different reprogrammed macrophages were compared with autologous CD8 + T cells were co-cultured in vitro at a ratio of 1:5 for 2-4 weeks. + The multifunctionality of macrophages was evaluated by indicators such as T cells (pMHC tetramer staining), intracellular cytokines (IFN-r / TNF-α), and tumor killing function, and the immune response characteristics of reprogrammed macrophages were comprehensively evaluated.

[0184] Step 5.3pMHC Tetramer Staining

[0185] Refer to the instructions of the MBL Quant Tetramer Kit to synthesize the corresponding peptide-Tetramer and harvest CD8 + T cells were stained with corresponding peptide pMHC tetramers and flow cytometry was used to assess antigen-specific CD8 + T cell percentage.

[0186] Step 5.3 Intracellular cytokine secretion detection

[0187] Harvest CD8 cells after 2-4 weeks of in vitro stimulation + T cells were stimulated with macrophages for 4 hours, and then stained with corresponding flow cytometry antibodies, and specific CD8 + The percentage of intracellular IFN-γ and TNF-a in T cells.

[0188] Step 5.4 Tumor cell killing efficiency

[0189] After 2-4 weeks of in vitro stimulation, CD8 + T cells and ovarian cancer tumor cell lines loaded with corresponding neoantigen peptides were incubated at a ratio of 10:1. After 24 hours of culture, the surviving tumor cells were counted and analyzed by flow cytometry to detect antigen-specific CD8 + The killing ability of T cells on tumor cells. Calculation formula: Killing efficiency = (1-the number of surviving tumor cells in the reprogrammed macrophage group / the number of surviving tumor cells in the untreated group) x 100.

[0190] Fig.11 The results of the in vitro functional evaluation of lung cancer in macrophages reprogrammed with membrane-anchored IL-12 and different MICA chimeras in Example 5 are shown, wherein the control group is macrophages loaded with only lung cancer neoantigen mRNA.

[0191] Fig.11A shows the results of the fold change of specific T cells stimulated by different MICA chimeras and membrane-anchored IL-12 reprogrammed macrophages. Compared with the macrophage control group loaded with lung cancer neoantigen mRNA, the average change of specific T cells in the MICA-41BBL+membrane-anchored IL-12 group was 8.3, ranging from 5.2-11.4; the average change of specific T cells in the MICA-OX40L+membrane-anchored IL-12 group was 10.3, ranging from 6.2-13.0; the average change of specific T cells in the MICA-ICOSL+membrane-anchored IL-12 group was 13.9, ranging from 9.8-18.8; MICA-CD80+ The average change of specific T cells in the membrane-anchored IL-12 group was 11.9, ranging from 7.6-14.6; the average change of specific T cells in the MICA-CD86+membrane-anchored IL-12 group was 11.2, ranging from 5.6-14.0; the average change of specific T cells in the MICA-CD40+membrane-anchored IL-12 group was 12.3, ranging from 8.6-17.6; the average expression of specific T cells in the MICA-CD27L+membrane-anchored IL-12 group was 8.3, ranging from 4.1-13.1.

[0192] Fig.11 B shows the fold change of IFN-r secretion by specific T cells stimulated by different MICA chimeras and membrane-anchored IL-12 reprogrammed macrophages. Compared with the control group of macrophages loaded with neoantigens, the average change of IFN-r secretion in the MICA-41BBL+membrane-anchored IL-12 group was 13.8, ranging from 11.0-17.2; the average change of IFN-r secretion in the MICA-OX40L+membrane-anchored IL-12 group was 13.6, ranging from 10.0-17.0; the average change of IFN-r secretion in the MICA-ICOSL+membrane-anchored IL-12 group was 13.4, ranging from 10.6-19.4; the average change of IFN-r secretion in the MICA-CD80+membrane-anchored IL The average change in IFN-r secretion in the MICA-CD86+membrane-anchored IL-12 group was 15.4, ranging from 11.2 to 19.6; the average change in IFN-r secretion in the MICA-CD86+membrane-anchored IL-12 group was 16.7, ranging from 12.4 to 30.0; the average change in IFN-r secretion in the MICA-CD40+membrane-anchored IL-12 group was 23.7, ranging from 18.8 to 29.6; the average expression of IFN-r secretion in the MICA-CD27L+membrane-anchored IL-12 group was 14.0, ranging from 10.0 to 17.0.

[0193] Fig.11C shows the fold change of TNF-a secretion by specific T cells stimulated by different MICA chimeras and membrane-anchored IL-12 reprogrammed macrophages. Compared with the control group of macrophages loaded with neoantigens, the average change of TNF-a secretion in the MICA-41BBL+membrane-anchored IL-12 group was 28.8, ranging from 21.0-37.2; the average change of TNF-a secretion in the MICA-OX40L+membrane-anchored IL-12 group was 28.6, ranging from 23.4-36.0; the average change of TNF-a secretion in the MICA-ICOSL+membrane-anchored IL-12 group was 31.7, ranging from 23.4-40.8; the average change of TNF-a secretion in the MICA-CD80+membrane-anchored IL The average change in TNF-a secretion in the MICA-CD86+membrane-anchored IL-12 group was 33.7, ranging from 24.6 to 44.4; the average change in TNF-a secretion in the MICA-CD86+membrane-anchored IL-12 group was 26.7, ranging from 15.6 to 32.4; the average change in TNF-a secretion in the MICA-CD40+membrane-anchored IL-12 group was 37.0, ranging from 28.8 to 44.4; the average expression of TNF-a secretion in the MICA-CD27L+membrane-anchored IL-12 group was 30.6, ranging from 23.4 to 42.6.

[0194] Fig.11 D The results of different MICA chimeras and membrane-anchored IL-12 reprogrammed macrophages stimulating specific T cells to kill tumor cell lines in vitro are shown. The average killing rate of the control group of macrophages loaded with neoantigens was 10.1%, ranging from 7.5-12.8%, the average killing rate of the MICA-41BBL+membrane-anchored IL-12 group was 39.2%, ranging from 33.8-44.8%; the average killing rate of the MICA-OX40L+membrane-anchored IL-12 group was 38.6%, ranging from 32.0-47.6%; the average killing rate of the MICA-ICOSL+membrane-anchored IL-12 group was 37.2%, ranging from 33.1-42.1%; -The average killing rate of the CD80+membrane-anchored IL-12 group was 36.3%, ranging from 28.6-45.9%; the average killing rate of the MICA-CD86+membrane-anchored IL-12 group was 37.21%, ranging from 35.8-41.4%; the average killing rate of the MICA-CD40+membrane-anchored IL-12 group was 48.8%, ranging from 43.8-53.9%; the average killing rate of the MICA-CD27L+membrane-anchored IL-12 group was 34.3%, ranging from 27.0-45.9%.

[0195] The above results show that using LNP as a carrier, membrane-anchored IL-12 and different MICA chimeras to reprogram macrophages can also further increase the ability of macrophages to stimulate specific T cell proliferation, effector factor secretion and tumor killing.

[0196] According to the results described in Examples 1-5 above, the MICA chimera provided by the present invention can be directly delivered to tumor tissue or lymph nodes near the tumor. The specific situation may be:

[0197] 1. When delivering directly to tumor tissue, our main target cells are macrophages. By reprogramming macrophages in tumor tissue, we can stimulate and amplify specific T cells to effectively kill tumors.

[0198] 2. When delivered to lymph nodes near the tumor, our main target cells, dendritic cells, carry antigens to the lymph nodes and stimulate State-specific T cells expand the body's neoantigen-specific T cell pool and migrate to the tumor to effectively kill tumor cells.

[0199] For the method embodiments, for the sake of simplicity, they are all described as a series of action combinations, but those skilled in the art should know that the present invention is not limited by the order of the actions described, because according to the present invention, some steps can be performed in other orders or simultaneously. Secondly, those skilled in the art should also know that the embodiments described in the specification are all preferred embodiments, and the actions and components involved are not necessarily required by the present invention.

[0200] The above is a detailed introduction to the reprogrammed mature dendritic cells and their preparation methods and applications provided by the present invention. Specific examples are used herein to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method of the present invention and its core ideas. At the same time, for those skilled in the art, according to the ideas of the present invention, there will be changes in the specific implementation methods and application scopes. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. A MICA chimeric mRNA, characterized in that The MICA chimeric mRNA is a MICA-co-stimulatory molecule signal chimeric mRNA; wherein the extracellular signal is MICA, and the intracellular signal is a co-stimulatory molecule signal of an antigen presenting cell.

2. The chimeric mRNA according to claim 1, characterized in that The composition of the MICA-co-stimulatory molecule signal chimera mRNA is that the MICA sequence is connected to the co-stimulatory molecule signal through the CD28 transmembrane structure.

3. The chimeric mRNA according to claim 2, characterized in that The co-stimulatory molecule signal includes at least one of a TNF family receptor and a CD28 / B7 family receptor.

4. The chimeric mRNA according to claim 3, characterized in that The TNF family receptor is at least one of 41BBL, OX40L, CD40, ICOSL and CD27L.

5. The chimeric mRNA according to claim 3, characterized in that The CD28 / B7 family receptor is at least one of CD80, CD83 and CD86.

6. A method for preparing a chimeric mRNA according to any one of claims 1 to 5, characterized in that: The method comprises: using a CD28 transmembrane structure to connect a MICA sequence and a costimulatory molecule sequence.

7. An mRNA composition, characterized in that The mRNA composition comprises the MICA chimeric mRNA according to any one of claims 1 to 5.

8. The mRNA composition according to claim 7, characterized in that The mRNA composition also includes tumor neoantigen mRNA.

9. The mRNA composition according to claim 8, characterized in that The tumor neoantigen mRNA consists of one neoantigen mRNA, or consists of a plurality of neoantigen mRNAs connected in series; preferably, it consists of 2-20 neoantigen mRNAs connected in series.

10. The mRNA composition according to claim 8, characterized in that The original mutation sequence corresponding to the tumor neoantigen mRNA is one or more highly immunogenic mutation sequences obtained by sequentially predicting, sorting and screening.

11. The mRNA composition according to claim 7, characterized in that The mRNA composition also includes membrane-anchored IL-12 mRNA.

12. The mRNA composition according to claim 11, characterized in that The composition of the membrane-anchored IL-12 mRNA is as follows: IL-12A and IL-12B sequences are connected by a GS flexible linker, and the transmembrane region is the platelet-derived growth factor receptor beta transmembrane region.

13. The mRNA composition according to claim 11, characterized in that The chimeric mRNA, the membrane-anchored IL-12 mRNA, or the neoantigen mRNA comprises three parts: a protein coding sequence, a 5'UTR, and a 3'UTR.

14. The mRNA composition according to claim 13, characterized in that The mRNA sequence of the 3'UTR is shown in SEQ ID NO:

1.

15. The mRNA composition according to claim 13, characterized in that The mRNA sequence of the 5'UTR is shown in SEQ ID NO:

2.

16. The mRNA composition according to claim 13, characterized in that The N-terminal sequence of the protein coding sequence is shown in SEQ ID NO:

3.

17. The mRNA composition according to claim 13, characterized in that The C-terminal sequence of the protein coding sequence is shown in SEQ ID NO:

4.

18. The mRNA composition according to claims 7-17, characterized in that The mRNA composition also includes a pharmaceutically acceptable carrier.

19. The mRNA composition according to claim 18, characterized in that The carrier is any one of dendritic cells, macrophages, B cells and nanoparticles.

20. An mRNA vaccine, characterized in that The vaccine comprises the chimeric mRNA according to any one of claims 1 to 5 or the mRNA composition according to any one of claims 7 to 19.

21. A DC vaccine, characterized in that: The DC vaccine comprises the chimeric mRNA according to any one of claims 1 to 5 or the mRNA composition according to any one of claims 7 to 19.

22. A method for preparing the DC vaccine according to claim 21, characterized in that: The method uses electroporation or LNP delivery system to introduce the chimeric mRNA according to any one of claims 1 to 5 or the mRNA composition according to any one of claims 7 to 19 into mature DCs.

23. A use of the chimeric mRNA according to any one of claims 1 to 5, or the mRNA composition according to any one of claims 7 to 19, or the mRNA vaccine according to claim 20, or the DC vaccine according to claim 21, characterized in that: The application includes: application in preparing specific T cells against cancer; or Use in the preparation of TCR-T cells against cancer; or Application in the preparation of agents against cancer.

24. The use according to claim 23, characterized in that The cancer is any one of breast cancer, ovarian cancer, gastric cancer, liver cancer, lung cancer and colon cancer.

Images