Wheat Thousand-Grain Weight-Related SNP-C1216T and Its Application
By developing the SNP-C1216T site related to wheat 100 grain weight and its detection method, the problem of improving wheat 100 grain weight in the prior art is solved, efficient molecular marker assisted selection is achieved, and the efficiency and yield of wheat breeding are improved.
Patent Information
- Application Number
- CN202510171698.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-17
- Publication Date
- 2025-08-12
- Estimated Expiration
- 2045-02-17
AI Technical Summary
The prior art is difficult to effectively utilize QTL to improve wheat 100 grain weight, and these QTLs are poorly repetitive during different interannual and environments, making it difficult to apply to the genetic improvement of wheat.
The SNP-C1216T site related to wheat 100 grain weight and its detection methods were developed, and the genotype was determined through PCR amplification and enzyme cleavage analysis. The wheat genome was designed using SNP-C1216T site to type the wheat genome, and wheat materials with a height of 100 grain weight were screened.
It provides an efficient molecular marker-assisted selection method, which can accurately identify the weight of 100 grains in the early stage of breeding, improve wheat yield, and has important breeding application value.
Smart Images

Figure CN119799962B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular biotechnology, in particular to SNP-C1216T related to wheat thousand-grain weight and applications thereof. Background Art
[0002] Wheat (Triticum aestivum L.) is one of the most important grain crops in my country and around the world. Increasing wheat yield per unit area is a key approach to meeting the growing demand for food in recent years and a strategic goal for ensuring food security. Thousand-kernel weight is one of the three major components of wheat yield per plant. Therefore, identifying superior allelic variants regulating thousand-kernel weight and developing functional markers are of great application value in high-yield wheat breeding.
[0003] At present, researchers have located a large number of QTLs or genes that regulate 1000-grain weight. Zhang et al. used a doubled haploid population and two recombinant inbred line populations to locate two QTLs that contributed more than 10% to the 1000-grain weight phenotype: Qtkw1B and Qtkw3A-2 / Qtkw5B.1. Wang et al. used the F-line of Shijiazhuang 4185 and Shijiazhuang 8. 2:5 Several SSR markers closely associated with 1000-grain weight were identified on wheat chromosome 5DS. Using a 55k SNP microarray analysis of 216 recombinant inbred lines constructed from Heshangtou and Longchun 23, Zhang Zeyuan identified 51 QTLs associated with grain weight across four environments, including four that were stable across three or more environments, located on chromosomes 2D, 5A, 6B, and 7D. Using a recombinant inbred line population derived from the synthetic wheat line C615 and Yangmai 13, Hu Wenjing, combined with 90k SNP microarray analysis, identified a single QTL, QTGW.yaas-6AL, that was consistently associated with 1000-grain weight across all four environments. The contribution of this QTL to the 1000-grain weight phenotype ranged from 7.63% to 10.55%. Using targeted gene association analysis, Wang et al. identified a transcription factor, TabHLH123, associated with 1000-grain weight and developed a corresponding molecular marker.
[0004] Although a large number of QTLs associated with 1000-grain weight have been located, most of these QTLs have small phenotypic contributions and poor reproducibility across years and environments, making them difficult to apply to the genetic improvement of 1000-grain weight in wheat. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide SNP-C1216T related to wheat thousand-grain weight and application thereof.
[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.
[0007] A SNP site associated with wheat thousand-grain weight, the SNP site corresponding to the 1216th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is C / C homozygous, the corresponding genotype is A; when the site is T / T homozygous, the corresponding genotype is B; the thousand-grain weight is as follows: wheat homozygous for genotype A is greater than, or is potentially greater than, wheat homozygous for genotype B.
[0008] On the other hand, the present invention also includes a gene detection kit for the SNP site, which contains a PCR amplification specific primer combination and enzyme cutting component corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.
[0009] As a preferred technical solution of the present invention, the target DNA fragment amplified by PCR in the gene detection kit is designed to be 1197-1307 bp at the 5' end of SEQ ID NO.1.
[0010] As a preferred technical solution of the present invention, the PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.
[0011] As a preferred technical solution of the present invention, the enzyme cutting component is the restriction endonuclease KpnI.
[0012] On the other hand, the present invention also includes a method for identifying or assisting in the identification of wheat thousand-grain weight in the early stages of breeding. Based on the SNP site described in claim 1, in the early stages of molecular marker-assisted selection breeding, primers are designed to perform PCR amplification on any DNA fragment containing the SNP site in the wheat genomic DNA to be tested, the wheat genotype is identified by enzyme digestion of the PCR amplification product, and the wheat thousand-grain weight phenotype is identified or assisting in the identification based on the following correlation between genotype and phenotype: the thousand-grain weight of wheat homozygous for genotype A is greater than, or is potentially greater than, the thousand-grain weight of wheat homozygous for genotype B.
[0013] As a preferred technical solution of the present invention, the DNA fragment amplified by PCR is 1197-1307bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; and the restriction endonuclease KpnI is used for the enzyme digestion.
[0014] As a preferred technical solution of the present invention, the enzyme digestion includes the following steps: using wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 100 times, using it as a template and primers 2F and 2R as a primer pair to amplify to obtain a PCR product; using the restriction endonuclease KpnI to digest the PCR product; if the PCR product can be cleaved, the nucleotide polymorphic site is C / C and the genotype is A; if the PCR product cannot be cleaved, the nucleotide polymorphic site is T / T and the genotype is B; the thousand-grain weight of wheat homozygous for genotype A is greater than, or is potentially greater than, that of wheat homozygous for genotype B.
[0015] In yet another aspect, the present invention also includes the use of the above-mentioned wheat SNP site, which is to screen or assist in screening the wheat thousand-grain weight phenotype in the early stage of molecular marker-assisted selection breeding.
[0016] Finally, the present invention also includes a primer combination, including primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; this primer combination is used to detect the SNP site described in claim 1.
[0017] The beneficial effect of adopting the above technical solution is that: the scientific research and development team of the present invention discovered a SNP through genetic variation analysis of the genes of the natural variation population of wheat, corresponding to the 1216th position from the 5' end of Sequence Table 1, and this SNP has two genotypes: genotype A (C) and genotype B (T). Association analysis proved that in the homozygous types of these two genotypes, the thousand-grain weight is as follows: wheat homozygous for genotype A > wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with a higher thousand-grain weight can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in breeding high-yield wheat varieties or research. The SNP site developed by the present invention not only expands the genetic resource tools of wheat, but also has good and wide application potential as verified by our scientific research experiments and data statistics. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 This is a schematic diagram of the TaHIS-A gene structure and variation of the present invention;
[0019] Figure 2 This is the electrophoresis detection result of the SNP development dCAPS labeling enzyme digestion product of the present invention; wherein, lane C is a band cut by KpnI, and lane T is a band that cannot be cut by KpnI.
[0020] Figure 3This is a schematic diagram of the association analysis results between gene polymorphism sites in natural populations and 1000-grain weight;
[0021] Figure 4 This is a photo of the autumn planting site in 2022 in Example 2;
[0022] Figure 5 This is a photo of the wheat harvest in June 2023 in Example 2;
[0023] Figure 6 These are on-site photos of the wheat thousand-grain weight survey in July 2023 in Example 2. DETAILED DESCRIPTION
[0024] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are all conventional commercial products and can be directly obtained through commercial purchase. The materials, reagents, etc. used in the following examples. Unless otherwise specified, they can be obtained from commercial channels. It should be understood that when used in this specification and the appended claims, the term "comprising" indicates the presence of the described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or their collections. It should also be understood that the term "and / or" used in this specification and the appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.
[0025] As used in this specification and the appended claims, the term "if" can be interpreted as "when..." or "upon..." or "in response to determining..." or "in response to detecting," depending on the context. Similarly, the phrases "if it is determined" or "if [the described condition or event] is detected" can be interpreted as meaning "upon determination," "in response to determining," or "upon detecting [the described condition or event]," or "in response to detecting [the described condition or event]," depending on the context. In addition, in the description of this specification and the appended claims, the terms "first," "second," "third," etc. are used solely to distinguish descriptions and are not to be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" in this specification mean that a particular feature, structure, or characteristic described in connection with that embodiment is included in one or more embodiments of the present application. Thus, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in other embodiments," etc., appearing at different locations in this specification, do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms "include", "comprising", "having" and variations thereof mean "including but not limited to", unless specifically emphasized otherwise.
[0026] TaHIS is a histone-encoding gene that has not yet been reported in wheat. There are three copies of TaHIS-A, TaHIS-B, and TaHIS-D in the wheat genome. Figure 1 The present invention develops and designs a primer and related molecular markers for identifying wheat thousand-grain weight based on the coding region of TaHIS-A.
[0027] Example 1. Detection of SNPs Related to Wheat Thousand-Kernel Weight and Their PCR-Enzyme Digestion Polymorphisms
[0028] 1. Specific primers for amplifying the genomic fragment containing the wheat SNP and sequence analysis
[0029] A single nucleotide polymorphism (SNP) was found in the coding region of the TaHIS gene in the wheat genome, corresponding to position 1216 from the 5' end of Sequence Listing 1. Two genotypes exist at this site in the natural variation population of wheat:
[0030] Genotype A: C
[0031] Genotype B: T
[0032] Based on the sequence differences of different wheat genomes, specific primers were designed to PCR amplify DNA fragments containing the SNP sites:
[0033] F1: TCTGCCTTTGATACCTACGGG (SEQ ID NO. 2);
[0034] R1: CAGTTGGAAACATAGTTCAAGCAG (SEQ ID NO.3);
[0035] F2: TCATCCGCGACGCCGGTAC (SEQ ID NO.4);
[0036] R2: CGCCGAATCCGTAGAGGGT (SEQ ID NO.5);
[0037] The target sequence amplified by PCR using primers F1 and R1 is shown in the sequence listing as 664-1944 positions, and the target sequence amplified by PCR using primers F2 and R2 is shown in the sequence listing as 1197-1307 positions. Enzyme digestion analysis showed that the polymorphisms were recognized by KpnI.
[0038] 2. Establishment of PCR-enzyme digestion polymorphism detection and genotyping methods
[0039] 1) Extracting genomic DNA from the wheat to be tested;
[0040] 2) Using the genomic DNA from step 1) as a template, PCR amplification was performed with primers F1 and R1. The PCR amplification system (20 μL) was as follows: 7 μL ddH2O, 1 μL each of primers F1 (5 μmol / L) and R1 (5 μmol / L), 10 μL 2× Taq mix, and 1 μL template (20 ng / μL).
[0041] The PCR amplification conditions were 94°C for 4 min; 94°C for 30 s, 60°C for 30 s, 72°C for 1 min, 32 cycles; 72°C for 10 min, and storage at 12°C.
[0042] 3) The PCR product from step 2) was diluted 20-fold and used as a template for PCR amplification using primers F2 and R2. The PCR amplification system (20 μL) was as follows: 7 μL of ddH2O, 1 μL each of primers F2 (5 μmol / L) and R2 (5 μmol / L), 10 μL of 2× Taqmix, and 1 μL of template (20 ng / μL).
[0043] The PCR amplification conditions were as follows: 94°C for 4 min; 94°C for 30 s, 60°C for 30 s, 72°C for 10 s, 34 cycles; 72°C for 10 min, and storage at 12°C.
[0044] 4) The PCR product obtained in step 3) was digested with KpnI to obtain a digestion product, which was detected by 4% agarose gel electrophoresis. It was recorded whether the PCR product was digested by KpnI, and the status of the wheat to be tested at the site was determined and recorded according to the following method:
[0045] If the PCR product can be digested by KpnI, the wheat to be tested is C / C homozygous (expressed as C / C) at the site ( Figure 2 Lane C in
[0046] If the PCR product cannot be digested by KpnI, the wheat to be tested is T homozygous (expressed as T / T) at the site ( Figure 2 Lane T in the figure).
[0047] According to the results of step 4), the wheat is divided into two types, I and II, as follows:
[0048] I: C / C (i.e., homozygous for genotype A);
[0049] II: T / T (i.e., homozygous for genotype B);
[0050] The " / " before the " / " refers to the situation on one homologous chromosome, and the " / " after the " / " refers to the situation on the other homologous chromosome.
[0051] 3. Use dCAPs markers to genotype natural populations and conduct association analysis with 1000-grain weight traits
[0052] Each wheat in a natural population of 286 hexaploid wheats was used as the test wheat, and typing was performed according to the method in step 2. The amplified products of some wheats were randomly sequenced and verified. The results are shown in Table 1.
[0053] Table 1 The situation of the polymorphic sites in natural wheat populations
[0054]
[0055]
[0056]
[0057]
[0058] Example 2: Association analysis between gene polymorphisms and 1000-grain weight in natural populations
[0059] A natural population of 286 hexaploid wheat accessions was sown at the Luancheng Agricultural Ecosystem Experimental Station of the Chinese Academy of Sciences in mid-October 2022 and mid-October 2023. Two irrigation treatments were set up each year: normal irrigation and no irrigation. Normal irrigation was carried out once at the jointing stage and once at the flowering stage, with an irrigation volume of 50m3 each time. 3 Each year, four blocks were set up for each irrigation method. Sowing was done manually, with one row of each variety planted within each block, with a row spacing of 20 cm, a row width of 1.5 m, and a plant spacing of 7.5 cm. Aside from the irrigation method, all other farmland management practices were identical. Thousand-grain weight was measured after wheat harvest, with the thousand-grain weight of each variety within a block considered a replicate. The thousand-grain weights for each variety and each irrigation method are shown in Tables 2 and 3. Figure 4 Photos of the 2022 autumn sowing site. Figure 5 These are photos of the wheat harvest in June 2023. Figure 6 These are on-site photos of the wheat thousand-grain weight survey in July 2023.
[0060] The thousand-grain weight of each wheat variety under different planting environments was investigated, and the association analysis between the thousand-grain weight and the polymorphic loci was performed by variance analysis, with P < 0.05 as the significance level. The results are shown in Table 4 and Figure 3 shown.
[0061] Table 2 Thousand-grain weight of different wheat varieties under two irrigation methods in 2022
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068] Table 3 Thousand-grain weight of different wheat varieties under two irrigation methods in 2023
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076] Table 4 Association analysis results between gene polymorphisms and 1000-grain weight in natural populations
[0077]
[0078] The results of the association analysis in Table 4 indicate that the thousand-grain weight differences between the two types of wheat genotypes formed from the natural population of 286 hexaploid wheat accessions shown in Table 1 were significant (P < 0.05). Type I wheat had a higher thousand-grain weight than Type II wheat. Across several environments, Type I wheat accessions had thousand-grain weights 2.76, 2.97, 2.59, and 3.12 g higher than Type II wheat, respectively. Studies in natural populations indicate that Type I is an excellent genotype for increasing wheat thousand-grain weight.
[0079] In the above embodiments, the description of each embodiment has its own focus. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant description of other embodiments.
[0080] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. These modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention, and should all be included in the scope of protection of the present invention.
Claims
1. The use of a gene detection kit, characterized in that: The gene detection kit contains a PCR amplification specific primer combination and enzyme digestion component corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection; The SNP site corresponds to the 1216th base from the 5' end of the sequence shown in SEQ ID NO.
1. When the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for T / T, the corresponding genotype is B. The thousand-grain weight is as follows: wheat homozygous for genotype A is greater than, or is potentially greater than, wheat homozygous for genotype B. The target DNA fragment amplified by PCR in this gene detection kit is designed to be 1197-1307 bp at the 5' end of SEQ ID NO.1; The PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; The enzyme cutting component is the restriction endonuclease KpnI; The purpose is to identify or assist in identifying the thousand-grain weight of wheat in the early stage of breeding, identify the wheat genotype by enzyme digestion of PCR amplification products, and identify or assist in identifying the thousand-grain weight phenotype of wheat based on the following correlation between genotype and phenotype: the thousand-grain weight of wheat homozygous for genotype A is greater than or has the potential to be greater than that of wheat homozygous for genotype B.
2. A method for identifying or assisting in identifying wheat thousand-grain weight in the early stages of breeding, characterized by: Based on the SNP site, in the early stage of molecular marker-assisted selection breeding, primers are designed to perform PCR amplification on any DNA fragment containing the SNP site in the wheat genomic DNA to be tested, wherein the SNP site corresponds to the 1216th base from the 5' end of the sequence shown in SEQ ID NO.1, and when the site is C / C homozygous, the corresponding genotype is A; when the site is T / T homozygous, the corresponding genotype is B; the thousand-grain weight is as follows: the wheat homozygous for genotype A is greater than, or is candidate greater than, the wheat homozygous for genotype B; the wheat genotype is identified by enzyme digestion of the PCR amplification product, and the wheat thousand-grain weight phenotype is identified or assisted in identification based on the following correlation between genotype and phenotype: the thousand-grain weight of the wheat homozygous for genotype A is greater than, or is candidate greater than, the wheat homozygous for genotype B.
3. The method according to claim 2, wherein: The DNA fragment amplified by PCR is 1197-1307 bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; the restriction endonuclease KpnI is used for enzyme digestion.
4. The method according to claim 2, wherein: The enzyme digestion comprises the following steps: using wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 20 times, using the PCR product as a template and primers 2F and 2R as a primer pair to amplify to obtain a PCR product; using the restriction endonuclease KpnI to digest the PCR product; if the PCR product can be digested, the nucleotide polymorphic site is C / C and the genotype is A; if the PCR product cannot be digested, the nucleotide polymorphic site is T / T and the genotype is B; the thousand-grain weight of wheat homozygous for genotype A is greater than, or is potentially greater than, that of wheat homozygous for genotype B.
5. The use of the primer combination is characterized by: The primers include primer pair 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5; The use is to screen or assist in screening the thousand-grain weight phenotype of wheat in the early stage of molecular marker-assisted selection breeding, detect the SNP site described in claim 1 by this primer combination, identify the wheat genotype by enzyme digestion of the PCR amplification product of the primer combination, and identify or assist in identifying the thousand-grain weight phenotype of wheat based on the following correlation between genotype and phenotype: the thousand-grain weight of wheat homozygous for genotype A is greater than, or is potentially greater than, the thousand-grain weight of wheat homozygous for genotype B.