Primer probe group and kit for simultaneously detecting H5, H7 and H9 subtype and universal avian influenza viruses and application of primer probe group and kit

Abstract

The invention discloses a primer probe group for simultaneously detecting H5, H7 and H9 subtype and universal avian influenza viruses. The kit comprises a probe of the H5 subtype avian influenza virus, an upstream primer of the H5 subtype avian influenza virus, a downstream primer of the H5 subtype avian influenza virus, a probe of the H7 subtype avian influenza virus, an upstream primer of the H7 subtype avian influenza virus, a downstream primer of the H7 subtype avian influenza virus, a probe of the H9 subtype avian influenza virus and an upstream primer of the H9 subtype avian influenza virus. The kit comprises an upstream primer of the H9 subtype avian influenza virus, a downstream primer of the H9 subtype avian influenza virus, a probe of the universal avian influenza virus, an upstream primer of the universal avian influenza virus and a downstream primer of the universal avian influenza virus. The invention also discloses a kit containing the primer probe group. The kit has the advantages of being simple and convenient to operate, high in sensitivity, good in specificity, capable of detecting samples anytime and anywhere, low in cross contamination rate, rapid in result obtaining and the like, suspicious samples can be found and diagnosed in time, and the rapid detection capacity of the avian influenza virus is improved.

Description

Technical Field

[0001] The invention belongs to the field of molecular biological detection, and particularly relates to a primer probe set, a kit and applications thereof for simultaneously detecting H5, H7, H9 subtypes and universal avian influenza viruses. Background Art

[0002] Avian influenza virus (AIV) belongs to influenza A virus (IVA), and its hosts include poultry such as chickens, ducks, and geese, as well as wild birds such as waterfowl and wild birds. Humans and lower mammals can also be infected. Avian influenza virus H5 (H5N1) is a highly pathogenic avian influenza virus that can infect humans, but is not easily transmitted between people. The main route of human infection is direct contact with infected animals or contaminated environments, such as live poultry markets. The H5N1 virus causes severe disease and high mortality in poultry and is called highly pathogenic avian influenza. Avian influenza virus H7 (H7N9) is a subtype of avian influenza and belongs to influenza A virus. The H7N9 virus can cause highly pathogenic avian influenza in poultry. For humans, although there are fewer cases of infection, once infected, the disease may be more serious. Avian influenza virus H9 (H9N2) is an avian influenza virus that has been isolated from ducks and chickens in recent years. Studies have shown that the H9N2 virus has infected some pigs. H9N2 is rarely found in humans and is a mild disease. Although H9N2 is less toxic than H5N1, the World Health Organization warns that H9N2 has caused human deaths and may also be the culprit for a new round of global influenza waves, and it also needs to be closely monitored. Universal avian influenza virus refers to all types of avian influenza caused by influenza virus type A strains that usually only infect wild birds and poultry. Recently, such virus strains have been found to infect humans. Avian influenza virus strains may acquire the ability to spread more easily between people through direct mutation or recombination of genome subunits with human virus strains during replication in human, animal or avian hosts. Therefore, H5, H7 and H9 subtypes and universal avian influenza viruses pose a serious threat to livestock and poultry farming and human health, and rapid and early subtyping and identification of them is of great significance.

[0003] Currently, the commonly used methods for detecting avian influenza viruses mainly include the following: (1) virus isolation and identification, which is a traditional laboratory detection method with high sensitivity, but it is time-consuming (7 to 10 days) and requires high laboratory conditions; (2) serological tests, including hemagglutination inhibition test (HI test), etc., which are used to detect hemagglutinin antibodies of H5 or H7 subtype avian influenza viruses in serum. If the HI antibody level is ≥24, the result is judged as positive, but it takes a long time to prepare specific serum antibodies; (3) immunological methods, including enzyme-linked immunosorbent assay (ELISA), which is an enzyme-labeled antigen (4) Immunofluorescence technology (IF), i.e., fluorescent antibody technology, is used to identify and locate specific antigens in influenza virus-infected cells. It is rapid, simple, and sensitive, but the operation process is complex and requires high instrument and sample quality. (5) Viral nucleic acid detection, including reverse transcription polymerase chain reaction (RT-PCR) and real-time fluorescence quantitative RT-PCR. These methods are widely recommended for clinical testing due to their high sensitivity and rapidity.

[0004] There are many different fluorescent quantitative PCR detection reagents available on the market that can diagnose avian influenza, but its detection requires a special laboratory and professional operators. The entire detection process includes nucleic acid extraction, detection reagent configuration, amplification, and report issuance, which takes a relatively long time and often faces problems such as cross contamination during application. In addition, since many of the existing multiple fluorescent quantitative RT-PCR detection reagents on the market do not have internal references, it is difficult to judge whether the negative results in the detection process are true negative or other reasons. At the same time, the multiple fluorescent quantitative RT-PCR detection reagents involve multiple reaction systems that react successively or simultaneously in the same reaction pool. Different components in the system may interfere with each other, such as non-specific binding between different primers and probes, resulting in low detection specificity. In terms of detection sensitivity, multiple fluorescent quantitative PCR generally cannot reach the level of single fluorescent quantitative PCR. In addition to the primer sequence, the primer concentration, probe concentration and annealing temperature in the system are important factors affecting the reaction sensitivity. Because multiple amplification reactions are carried out simultaneously in the same system, the optimization of the multiple fluorescent quantitative PCR reaction system and reaction procedure must take into account the optimal conditions of multiple reactions at the same time, which requires the establishment of a comprehensive mathematical model for evaluation. This makes the optimization of the reaction system and reaction procedure a technical difficulty. And comprehensive optimization is obviously difficult to make a specific single reaction reach the sensitivity of its single-plex fluorescence quantitative PCR reaction. Summary of the invention

[0005] In view of the above technical problems to be solved, an object of the present invention is to provide a fluorescent RT-PCR detection primer and probe for rapid detection of H5, H7, H9 subtypes and universal avian influenza virus with high sensitivity and high specificity.

[0006] Another object of the present invention is to provide a kit comprising the primers and probes.

[0007] Another object of the present invention is to provide applications of the primers, probes and kits.

[0008] In order to achieve the above invention objectives, the present invention provides a primer probe set for simultaneously detecting H5, H7, H9 subtypes and universal avian influenza virus, the primer probe set comprising the following primers and probes:

[0009] The probe H5-P2 of H5 subtype avian influenza virus has the nucleotide sequence shown in SEQ ID NO.4;

[0010] The upstream primer H5-F2 of H5 subtype avian influenza virus has the nucleotide sequence shown in SEQ ID NO.5;

[0011] A downstream primer H5-R2 of H5 subtype avian influenza virus having a nucleotide sequence as shown in SEQ ID NO.6;

[0012] The probe H7-P1 of H7 subtype avian influenza virus has the nucleotide sequence shown in SEQ ID NO.10;

[0013] The upstream primer H7-F1 of H7 subtype avian influenza virus has a nucleotide sequence as shown in SEQ ID NO.11;

[0014] A downstream primer H7-R1 of H7 subtype avian influenza virus, which has a nucleotide sequence as shown in SEQ ID NO.12;

[0015] The probe H9-P1 of H9 subtype avian influenza virus has the nucleotide sequence shown in SEQ ID NO.19;

[0016] The upstream primer H9-F1 of H9 subtype avian influenza virus has the nucleotide sequence shown in SEQ ID NO.20;

[0017] A downstream primer H9-R1 of H9 subtype avian influenza virus, which has a nucleotide sequence as shown in SEQ ID NO.21;

[0018] A universal avian influenza virus probe M-P1 having a nucleotide sequence as shown in SEQ ID NO.28;

[0019] The upstream primer M-F1 of universal avian influenza virus has the nucleotide sequence shown in SEQ ID NO.29;

[0020] The downstream primer M-R1 of universal avian influenza virus has a nucleotide sequence as shown in SEQ ID NO.30.

[0021] Preferably, the primer probe set further includes a primer probe for an 18s rRNA avian internal reference gene, and the primer probe for the 18s rRNA avian internal reference gene is as follows:

[0022] The probe 18S-P1 of the 18S rRNA avian internal reference gene has the nucleotide sequence shown in SEQ ID NO.37;

[0023] The upstream primer 18S-F1 of the 18s rRNA avian internal reference gene has a nucleotide sequence as shown in SEQ ID NO.38;

[0024] The downstream primer 18S-R1 of the 18s rRNA avian internal reference gene has a nucleotide sequence as shown in SEQ ID NO.39.

[0025] Preferably, the probe H5-P2 of the H5 subtype avian influenza virus, the probe H7-P1 of the H7 subtype avian influenza virus, the probe H9-P1 of the H9 subtype avian influenza virus and the probe M-P1 of the universal avian influenza virus carry a FAM fluorescent reporter group and a BHQ1 fluorescent quencher group at their 5' end and 3' end, respectively, and the specific probe of the avian 18s rRNA internal reference gene carries a VIC fluorescent reporter group and a BHQ1 fluorescent quencher group at their 5' end and 3' end, respectively.

[0026] On the other hand, the present invention further provides a fluorescent RT-PCR detection kit, which comprises the primer probe set according to the present invention.

[0027] Preferably, the fluorescent RT-PCR detection kit further comprises RT-PCR reaction solution and DEPC water.

[0028] More preferably, the fluorescent RT-PCR detection kit further comprises paraffin.

[0029] On the other hand, the present invention also provides the use of the primer probe set in preparing a kit for simultaneously detecting H5, H7 and H9 subtypes and universal avian influenza virus.

[0030] Preferably, the reaction procedure of the detection is as follows: reverse transcription reaction at 50°C for 30 min; pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing and extension at 61°C for 30 s, for a total of 45 cycles.

[0031] Preferably, the reaction system of the detection is as follows: 5 μL of RT-PCR reaction solution, 10 μL of template RNA, 0.6 μL of primers H5-F2, H5-R2, H7-F1, H7-R1, H9-F1, H9-R1, M-F1, and M-R1 at a concentration of 10 μM, 0.3 μL of 18S-F1 and 18S-R1 at a concentration of 10 μM, 0.5 μL of probes H5-P2, H7-P1, H9-P1, and M-P1 at a concentration of 10 μM, 0.2 μL of probe 18S-P1 at a concentration of 10 μM, and 25 μL of DEPC water.

[0032] According to the application of the present invention, preferably, the kit is a fluorescent RT-PCR detection kit.

[0033] According to the application of the present invention, preferably, the avian influenza virus subtype is determined according to the amplification result, wherein:

[0034] If the reference gene Ct value is ≤32, the target gene Ct value is ≤38, and the amplification curve is a typical S-type, it is judged as positive;

[0035] If the reference gene Ct≤32 and the target gene Ct value is 38<Ct≤40, retest. If the retest result Ct value is <40, it is judged as positive, otherwise it is judged as negative;

[0036] If the reference gene Ct is ≤32, the target gene has no Ct value displayed, there is no typical S-shaped amplification curve or the Ct value is ≥40, it is judged as negative;

[0037] If the internal reference gene Ct>32 or there is no amplification curve, the test is invalid and needs to be retested.

[0038] Compared with the prior art, the present invention has the following beneficial technical effects:

[0039] (1) The fluorescent RT-PCR detection primer probe set and kit for simultaneously detecting H5, H7, H9 subtypes and universal avian influenza virus provided by the present invention can quickly, accurately and sensitively perform quantitative identification of H5, H7 and H9 subtypes of avian influenza virus in a sample in a short time, and can be used for emergency treatment of sudden infectious diseases and on-site rapid detection of inspection and quarantine, and has good application potential and application value in clinical laboratory diagnosis and epidemiological investigation of avian influenza virus.

[0040] (2) The fluorescent RT-PCR detection kit provided by the present invention uses an internal reference gene as a quality control. The internal reference gene is amplified simultaneously with H5, H7, H9 subtypes and universal avian influenza virus, which reduces the cost of the kit and avoids false negatives caused by reagent problems or other reasons during the detection process. The kit of the present invention can be based on a microfluidic nucleic acid analyzer detection platform. The reagents of each quadruple PCR tube in the kit are sealed with paraffin, which can effectively prevent PCR cross contamination. The entire detection reagent is in the form of a card box. After the sample is added, it is in a completely closed operation, which further reduces pollution. The sample can be tested as soon as it arrives, without the need to configure reagents, and the operation is simple. The test report can be obtained after the test is completed, which greatly shortens the test cycle and significantly improves the detection efficiency.

[0041] (3) The fluorescent RT-PCR detection method provided by the present invention is a real-time fluorescent RT-PCR method. The method directly uses the homogenate sample as a template for detection, eliminating the in vitro extraction process, and the reverse transcription and PCR amplification processes are completed in the same system. No other operations are required in the middle, which saves time and avoids experimental errors and sample cross-contamination caused by multiple steps. The method is fast and accurate. It can ensure the high detection efficiency and high sensitivity of multiple tests in one sample quadruple tube. At the same time, it has the characteristics of anti-pollution, simple operation, high specificity, high stability, on-site detection, no need for professional personnel, no need for professional laboratories, and rapid detection. It provides an effective technical means for the screening of avian influenza viruses and the rapid subtyping and identification of H5, H7 and H9 subtypes of avian influenza viruses.

[0042] (4) The present invention provides a series of primers and probes optimized for fluorescent RT-PCR of avian influenza virus H5, H7, H9 subtypes and universal avian influenza virus, an optimal reaction system and a reaction procedure. The present invention designs and optimizes primer and probe sequences, improves the conservatism of its target fragments, and improves its compatibility with the internal reference combination. Furthermore, the present invention establishes the optimal combination of three variables, namely primer concentration, probe concentration and annealing temperature, through experimental design and analysis, and then screens out the combination with the minimum interference between primers and probes, similar amplification conditions and the highest amplification efficiency, as well as the optimal annealing temperature matched therewith. Under the premise of ensuring multiple detection and low cost, the detection specificity and sensitivity are maximized. The sensitivity of the fluorescent RT-PCR detection method of the present invention to the number of nucleic acid copies of H5, H7, H9 subtypes and universal avian influenza virus in samples can reach 10 copies / reaction. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 The experimental results of the primer probe screening of H5 subtype avian influenza virus according to the embodiment of the present invention are shown.

[0044] Figure 2The experimental results of the screening of primer probes for H5 subtype avian influenza virus with the addition of 18s rRNA avian internal reference gene primer probes according to an embodiment of the present invention are shown.

[0045] Figure 3 The experimental results of primer probe screening of H7 subtype avian influenza virus according to an embodiment of the present invention are shown.

[0046] Figure 4 The experimental results of the screening of primer probes for H7 subtype avian influenza virus with the addition of 18s rRNA avian internal reference gene primer probes according to an embodiment of the present invention are shown.

[0047] Figure 5 The experimental results of primer probe screening of H9 subtype avian influenza virus according to an embodiment of the present invention are shown.

[0048] Figure 6 The experimental results of the screening of primer probes for H9 subtype avian influenza virus with the addition of 18s rRNA avian internal reference gene primer probes according to an embodiment of the present invention are shown.

[0049] Figure 7 The figure shows the experimental results of universal avian influenza virus primer probe screening according to an embodiment of the present invention.

[0050] Figure 8 The experimental results of screening a universal avian influenza virus primer probe with the addition of 18s rRNA avian internal reference gene primer probe according to an embodiment of the present invention are shown.

[0051] Fig. 9 The specific detection results of fluorescent RT-PCR of H5, H7, H9 subtypes and universal avian influenza viruses and internal reference gene probe primers on mixed samples of avian influenza viruses according to the embodiments of the present invention are shown.

[0052] Fig.10 The specific detection results of fluorescent RT-PCR of H5, H7, H9 subtypes and universal avian influenza viruses and internal reference gene probe primers on non-avian influenza virus samples according to the embodiments of the present invention are shown. DETAILED DESCRIPTION

[0053] In order to more clearly illustrate the technical solution of the present invention and make the above-mentioned purposes, features and advantages of the embodiments of the present invention more obvious and understandable, the following will be described in conjunction with specific embodiments and drawings. It should be understood that the following embodiments are only used to illustrate the present invention, and are not used to limit the scope of the present invention.

[0054] Unless otherwise specified, the materials, reagents, instruments and methods used in the following examples are conventional materials, reagents, instruments and methods in the art and can be obtained through commercial channels.

[0055] Example 1

[0056] Design of primers and probes for detecting H5, H7, H9 subtypes, universal avian influenza viruses and poultry internal reference genes

[0057] Reference was made to the hemagglutinin gene-related sequences of H5 (H5N1), H7 (H7N9), H9 (H9N2) subtype avian influenza viruses and universal avian influenza virus and avian 18s rRNA gene sequences published in the GenBank database. Their accession numbers in the GenBank database are: PP755470.1 for H5, KM879365.1 for H7, MK600814.1 for H9, OR949455.1 for universal type, and DQ018752.1 for avian internal reference gene.

[0058] DNAMAN software was used to perform gene homology comparison analysis and determine its conserved nucleic acid sequence region as the specific target fragment.

[0059] The specific target fragments for H5 subtype avian influenza virus are:

[0060] CCCCAAATACGTGAAATCAAACAAGTTGGTCCTTGCGACTGGGCTCAGAAATAGTC CTCTAAGAGAAAAGAGAAGAAAAAGAGGTCTGTTTGGGGCGATAGCAGGGTTTTATAGA GGGAGGA.

[0061] The specific target fragments for H7 subtype avian influenza virus are:

[0062] ATTGCGATCATTCCAACAAATGCAGACAAAATCTGCCTCGGACATCATGCCGTGTCA AACGGAACCAAAGTAAACACATTAACTGAAAGAGGAGTGGAAGTC.

[0063] The specific target fragments for H9 subtype avian influenza virus are:

[0064] ACTAACAGAAAACAATGTCCCTGTGACACATGCCAAAGAACTGCTCCACACAGAG CATAATGGGATGCTGTGTGCAACAAGCTTGGGACAACCTCTTATTTTAGACACCTGCACC ATTGAAGGGCTAAT.

[0065] The specific target fragments of the universal avian influenza virus are:

[0066] ACGCTTTGTCCAAAATGCTCTAAATGGAAATGGAGACCCAAACAACATGGACAGG GCAGTTAAACTGTACAGGAAATTGAAGAGAGAGATAACATTCCATGGGGCTAAAGAA GTTGCA.

[0067] The specific target fragments of the avian 18s rRNA internal reference gene are:

[0068] ATGTCTGCCCTATCAACTTTCGATGGTACTGTCTGTGCCTACCATGGTGACCACGG GTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACAT CCAAG.

[0069] Oligo7 software was used to design specific primers and fluorescent probes for specific target fragments. Three pairs of primers and probes were designed for each type of avian influenza virus. The primers and probes that met the amplification requirements were screened out through verification of real diseased samples (pathological samples of each avian influenza subtype (H5, H7, H9) were donated by Shenzhen Customs) and comparison of amplification curves.

[0070] The nucleotide sequences of the primer probes for H5, H7, H9 subtype avian influenza viruses and universal avian influenza virus and avian 18s RNA internal reference gene are shown in Table 1 below.

[0071] Table 1: Primer probe sequences

[0072]

[0073]

[0074] The fluorescent reporter groups are preferably FAM and VIC, which respectively label different avian influenza virus probes and 18s rRNA internal reference gene probes. The fluorescent quencher group is preferably BHQ1.

[0075] Preferably, the specific probe of the HA gene of the H5 subtype avian influenza virus carries a FAM fluorescent reporter group and a BHQ1 fluorescent quencher group at its 5' end and 3' end, respectively.

[0076] The specific probe of the HA gene of the H7 subtype avian influenza virus carries a FAM fluorescent reporter group and a BHQ1 fluorescent quencher group at its 5' end and 3' end, respectively.

[0077] The specific probe of the HA gene of the H9 subtype avian influenza virus carries a FAM fluorescent reporter group and a BHQ1 fluorescent quencher group at its 5' end and 3' end, respectively.

[0078] The specific probe of the universal avian influenza virus HA gene carries a FAM fluorescent reporter group and a BHQ1 fluorescent quencher group at its 5' end and 3' end, respectively.

[0079] The specific probe of the avian 18s rRNA internal reference gene carries a VIC fluorescent reporter group and a BHQ1 fluorescent quencher group at its 5' end and 3' end, respectively.

[0080] The above primer and probe sequences were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0081] The above-mentioned avian influenza subtype (H5, H7, H9) diseased materials are poultry tissue RNA samples containing the corresponding avian influenza subtype virus extracted. The diseased materials are detected using the primer probes designed in the above Table 1 to verify whether H5, H7, H9 subtype avian influenza viruses and universal avian influenza viruses can be specifically detected.

[0082] Each type of primer probe is configured with two different PCR mixed systems. The first type contains primer probes corresponding to the type of avian influenza virus; the second type contains primer probes corresponding to the type of avian influenza virus and primer probes of the preferred 18s rRNA internal reference gene in Table 1 (i.e., the 18s rRNA internal reference gene primer probes 18S-P1, 18S-F1, 18S-R1 with the best PCR amplification effect, SEQ ID NO: 37-39). The detection is performed using a Hongshi SLAN-48P fluorescent quantitative PCR instrument. Each detection is repeated twice.

[0083] The PCR reaction system (without the primer probe of the 18s rRNA internal reference gene) is shown in Tables 2 to 5 below.

[0084] Table 2: H5 avian influenza virus PCR reaction system without internal reference

[0085] Components Reactant volume U+One Step RT-qPCR Probe 5×Master Mix 5μL H5 upstream primer (10 μM) 0.6μL H5 downstream primer (10 μM) 0.6μL H5 probe (10 μM) 0.5μL Template RNA 10μL DEPC water 8.3μL Total volume 25μL

[0086] Table 3: H7 avian influenza virus PCR reaction system without internal reference

[0087] Components Reactant volume U+One Step RT-qPCR Probe 5×Master Mix 5μL H7 upstream primer (10 μM) 0.6μL H7 downstream primer (10 μM) 0.6μL H7 probe (10 μM) 0.5μL Template RNA 10μL DEPC water 8.3μL Total volume 25μL

[0088] Table 4: H9 avian influenza virus PCR reaction system without internal reference

[0089]

[0090]

[0091] Table 5: Universal avian influenza virus PCR reaction system without internal reference

[0092] Components Reactant volume U+One Step RT-qPCR Probe 5×Master Mix 5μL Universal upstream primer (10 μM) 0.6μL Universal downstream primer (10 μM) 0.6μL Universal probe (10μM) 0.5μL Template RNA 10μL DEPC water 8.3μL Total volume 25μL

[0093] The PCR reaction system (containing primers and probes of the 18s rRNA internal reference gene) is shown in Tables 6 to 9 below.

[0094] Table 6: H5 avian influenza virus PCR reaction system containing internal reference

[0095] Components Reactant volume U+One Step RT-qPCR Probe 5×Master Mix 5μL H5 upstream primer (10 μM) 0.6μL H5 downstream primer (10 μM) 0.6μL H5 probe (10 μM) 0.5μL 18S-F1(10μM) 0.3μL 18S-R1(10μM) 0.3μL 18S-P1(10μM) 0.2μL Template RNA 10μL DEPC water 7.5μL Total volume 25μL

[0096] Table 7: H7 avian influenza virus PCR reaction system containing internal reference

[0097] Components Reactant volume U+One Step RT-qPCR Probe 5×Master Mix 5μL H7 upstream primer (10 μM) 0.6μL H7 downstream primer (10 μM) 0.6μL H7 probe (10 μM) 0.5μL 18S-F1(10μM) 0.3μL 18S-R1(10μM) 0.3μL 18S-P1(10μM) 0.2μL Template RNA 10μL DEPC water 7.5μL Total volume 25μL

[0098] Table 8: H9 avian influenza virus PCR reaction system containing internal reference

[0099]

[0100]

[0101] Table 9: Universal avian influenza virus PCR reaction system containing internal reference

[0102] Components Reactant volume U+One Step RT-qPCR Probe 5×Master Mix 5μL Universal upstream primer (10 μM) 0.6μL Universal downstream primer (10 μM) 0.6μL Universal probe (10μM) 0.5μL 18S-F1(10μM) 0.3μL 18S-R1(10μM) 0.3μL 18S-P1(10μM) 0.2μL Template RNA 10μL DEPC water 7.5μL Total volume 25μL

[0103] The PCR reaction program is shown in Table 10 below.

[0104] Table 10: PCR reaction program

[0105]

[0106] PCR test results Figures 1 to 8 During the primer screening process, when analyzing the results, the amplification curve of the first group of primer probes is set to green, the amplification curve of the second group of primer probes is set to red, and the amplification curve of the third group of primer probes is set to purple.

[0107] like Figure 1 and Figure 2 As shown, when three groups of H5 primer probes were used to detect H5 diseased materials, the first and second groups of primer probes had S-shaped amplification curves and the amplification effect of the second group of primer probes was better. The third group of primer probes had no amplification curve. After adding the 18s rRNA internal reference primer probe, the same detection phenomenon occurred and the Ct value of the target remained almost unchanged. There was no amplification when detecting H7 and H9 diseased materials (not shown in the figure).

[0108] like Figure 3 and Figure 4As shown, when three sets of H7 primer probes were used to detect H7 diseased materials, all three sets of H7 primer probes had S-shaped amplification curves. After adding 18s rRNA internal reference primer probe, the same detection phenomenon occurred and the Ct value of the target remained almost unchanged. Only the fluorescence value of the third set of primer probes decreased. There was no amplification when detecting H5 and H9 diseased materials (not shown in the figure).

[0109] like Figure 5 and Figure 6 As shown, when three sets of H9 primer probes were used to detect H9 diseased materials, all three sets of H9 primer probes had S-shaped amplification curves. After adding 18s rRNA internal reference primer probe, the same detection phenomenon occurred and the Ct value of the target remained almost unchanged. Only the fluorescence value of the third set of primer probes decreased. There was no amplification when detecting H5 and H7 diseased materials (not shown in the figure).

[0110] like Figure 7 and Figure 8 As shown in the figure, when three sets of universal primer probes were used to detect H5, H7 and H9 mixed samples, all three sets of universal primer probes had S-shaped amplification curves. After adding 18s rRNA internal reference primer probe, the same detection phenomenon occurred and the Ct value of the target remained almost unchanged. Only the fluorescence value of the second set of primer probes decreased.

[0111] Through the above experiments, according to the PCR amplification results, the H5 second group of primer probes (SEQ ID NOs.4-6), H7 first group of primer probes (SEQ ID NOs.10-12), H9 first group of primer probes (SEQ ID NOs.19-21), universal first group of primer probes (SEQ ID NOs.28-30) and 18s rRNA internal reference gene specific primer probes (SEQ ID NOs.37-39) were preferably selected.

[0112] Example 2

[0113] Four-item Fluorescence RT-PCR Detection Kit for Avian Influenza Virus

[0114] The fluorescent RT-PCR detection kit according to the present invention may include the preferred primer probe combination as described in Example 1 above (specific primer probes for H5 avian influenza virus (SEQ ID NOs. 4-6), specific primer probes for H7 avian influenza virus (SEQ ID NOs. 10-12), specific primer probes for H9 avian influenza virus (SEQ ID NOs. 19-21), specific primer probes for universal avian influenza virus (SEQ ID NOs. 28-30) and specific primer probes for 18s rRNA avian internal reference gene (SEQ ID NOs. 37-39)). The kit may have a quadruple tube pre-installed with RT-PCR detection reagents, each quadruple tube consisting of 4 connected PCR reaction tubes, respectively as follows:

[0115] Reaction tube No. 1 contains: specific primer probe for H5 avian influenza virus + specific primer probe for 18s rRNA avian internal reference gene;

[0116] Reaction tube No. 2 contains: specific primer probe for H7 avian influenza virus + specific primer probe for 18s rRNA avian internal reference gene;

[0117] Reaction tube No. 3 contains: specific primer probe for H9 avian influenza virus + specific primer probe for 18s rRNA avian internal reference gene;

[0118] Reaction tube No. 4 contains: specific primer probe for universal avian influenza virus + specific primer probe for 18s rRNA avian internal reference gene.

[0119] The total volume of the optimal reaction system of the four-item fluorescent RT-PCR detection kit for avian influenza virus described in the present invention is 25 μL. The reaction system for RT-PCR detection of H5 avian influenza virus is as follows: 5 μL of RT-PCR reaction solution, 10 μL of template RNA, 0.6 μL of 10 μM upstream primer H5-F2, 0.6 μL of 10 μM downstream primer H5-R2, 0.5 μL of 10 μM probe H5-P2, and 25 μL of DEPC water.

[0120] The reaction system for RT-PCR detection of H7 avian influenza virus is as follows: 5 μL of RT-PCR reaction solution, 10 μL of template RNA, 0.6 μL of 10 μM upstream primer H7-F1, 0.6 μL of 10 μM downstream primer H7-R1, 0.5 μL of 10 μM probe H7-P1, and 25 μL of DEPC water.

[0121] The reaction system for RT-PCR detection of H9 avian influenza virus is as follows: 5 μL of RT-PCR reaction solution, 10 μL of template RNA, 0.6 μL of 10 μM upstream primer H9-F1, 0.6 μL of 10 μM downstream primer H9-R1, 0.5 μL of 10 μM probe H9-P1, and 25 μL of DEPC water.

[0122] The reaction system for universal avian influenza virus RT-PCR detection is as follows: 5 μL of RT-PCR reaction solution, 10 μL of template RNA, 0.6 μL of 10 μM upstream primer M-F1, 0.6 μL of 10 μM downstream primer M-R1, 0.5 μL of 10 μM probe M-P1, and 25 μL of DEPC water.

[0123] The reaction system for 18s rRNA avian internal reference gene detection was as follows: 5 μL of RT-PCR reaction solution, 10 μL of template RNA, 0.3 μL of 10 μM upstream primer 18S-F1, 0.3 μL of 10 μM downstream primer 18S-R1, 0.2 μL of 10 μM probe 18S-P1, and 25 μL of DEPC water.

[0124] In the mixed system, the reaction system of RT-PCR detection is as follows: 5 μL of RT-PCR reaction solution, 10 μL of template RNA, 0.6 μL of primers H5-F2, H5-R2, H7-F1, H7-R1, H9-F1, H9-R1, M-F1, and M-R1 at a concentration of 10 μM, 0.3 μL of 18S-F1 and 18S-R1 at a concentration of 10 μM, 0.5 μL of probes H5-P2, H7-P1, H9-P1, and M-P1 at a concentration of 10 μM, 0.2 μL of probe 18S-P1 at a concentration of 10 μM, and 25 μL of DEPC water.

[0125] The RT-PCR reaction system in each reaction tube includes RT-PCR reaction solution, primer probe, and sterile nuclease-free water. The RT-PCR reaction solution includes dNTP, Mg 2+ , PCR buffer, reverse transcriptase and Taq enzyme.

[0126] The RT-PCR reaction solution is preferably a one-step RT-PCR reaction solution, including but not limited to AccurSTART U+One Step RT-qPCR Super PreMix (ONE TUBE) (Vazyme#Q621) provided by Vazyme Biotech, wherein U + One Step RT-qPCR Probe 5×Master Mix was used as the reaction solution (containing all enzymes and various salt ions required for RT-PCR).

[0127] As a preferred solution, each reaction tube of the kit may also contain a paraffin component, so that the solid paraffin seals the reagent, the reagent is fixed to the bottom of the PCR tube, and at the same time, the sample is prevented from volatilizing, and cross-contamination of the amplification product is prevented during the amplification process. Each PCR reaction well may contain 25 μL of paraffin. The process of adding paraffin is as follows: first melt the solid paraffin at 65°C, and after it is completely melted, take 25 μL and drop it into the PCR tube, so that the paraffin completely covers the PCR reaction mixture (including all components except the template RNA).

[0128] The optimal reaction procedure of the fluorescent RT-PCR method of the present invention is: reverse transcription reaction at 50°C for 30 minutes; pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 15 seconds, annealing and extension at 61°C for 30 seconds, for a total of 45 cycles; and fluorescence detection at 61°C.

[0129] Multiplex fluorescence quantitative PCR amplification is preferably performed in a microfluidic nucleic acid analysis system fluorescence quantitative PCR instrument (for example, but not limited to, commercially available products from Guangzhou Zhongyu Biotechnology Co., Ltd.) Note that the detection instrument used should have FAM and VIC detection channels.

[0130] In the kit of this embodiment, each reaction tube uses two sets of independent oligonucleotide probes with different fluorescent labels to simultaneously detect different types of avian influenza specific genes and avian internal reference genes, which is more accurate and reliable than the current method of simply detecting pathogen fragments. This is because the avian 18s rRNA gene is simultaneously detected as an internal reference quality control, which can participate in the extraction of avian influenza virus nucleic acid and PCR reaction, monitor the experimental operation process and PCR reaction, avoid false negatives, and increase the credibility of the test results.

[0131] The four-item fluorescent RT-PCR detection method for avian influenza virus of the present invention requires the following samples: nucleic acid homogenized by a grinder from poultry nasal swabs, pharyngeal swabs, poultry cloacal swabs, tissue samples, etc. It is recommended that the swab sample be soaked and lysed with 0.5 mL of sample pretreatment solution (TIANGEN DNA / RNA AllPrep Kit, item number DP422). Take 0.1 g of tissue sample and add 1 mL of sample pretreatment solution (TIANGEN DNA / RNA AllPrep Kit, item number DP422) for homogenization and lysis. Take 100 μL of the sample lysed with the pretreatment solution and add it to the card box for immediate detection.

[0132] The kit of the present invention is preferably stored at 2-8°C.

[0133] The method of using the four-item fluorescent RT-PCR detection kit for avian influenza virus according to the present invention is as follows:

[0134] Pipette 100 μL of homogenized sample (no special extraction required) and add it to the sample well of the kit cartridge, cover it, and then put it into the microfluidic nucleic acid detection analyzer and select the detection program. Perform amplification reaction according to the set preferred reaction program: reverse transcription reaction at 50℃ for 30min; pre-denaturation at 95℃ for 5min; denaturation at 95℃ for 15s, annealing and extension at 61℃ for 30s, for a total of 45 cycles. Perform fluorescence detection at 61℃.

[0135] The actual concentrations of the primers and probes in the reaction system of the kit (excluding 10 μL template RNA) are the optimal solutions shown in Table 11.

[0136] Table 11: Amounts of primers and probes used in the reaction system of the kit

[0137]

[0138]

[0139] Optimization of amplification conditions for fluorescent RT-PCR reaction

[0140] The sample to be tested is placed on a microfluidic nucleic acid analyzer for PCR amplification testing. After multiple designs, tests, adjustments, and verifications, the optimal conditions for the fluorescent RT-PCR reaction of the present invention are determined as shown in Table 12.

[0141] Table 12: Optimal conditions for fluorescent RT-PCR reactions

[0142]

[0143] After the reaction is completed, the instrument automatically saves and analyzes the results. The qualitative identification of the avian influenza virus subtype can be determined based on the amplification results. The results are determined based on the following: the category of the avian influenza virus subtype is determined based on the fluorescence signal and signal intensity of the fluorescence curve of the corresponding well of the quadruple tube; the reagent performance and whether there is a false negative can be determined based on whether there is amplification of the internal reference gene in the amplification results of each well; the qualitative identification of the avian influenza virus subtype can be determined based on the amplification results.

[0144] The avian influenza virus subtype can be qualitatively determined based on the amplification results. The determination method is as follows:

[0145] (1) If the reference gene Ct value is ≤32, the target gene Ct value is ≤38, and the amplification curve is a typical S-type, it is judged as positive;

[0146] (2) If the reference gene Ct is ≤32 and the target gene Ct value is 38<Ct≤40, the test is repeated. If the retest result Ct value is <40, it is judged as positive, otherwise it is judged as negative;

[0147] (3) If the reference gene Ct is ≤32, the target gene has no Ct value, there is no typical S-shaped amplification curve or the Ct value is ≥40, it is judged as negative;

[0148] (4) If the reference gene Ct is greater than 32 or there is no amplification curve, the test is invalid and needs to be retested.

[0149] Example 3

[0150] Sensitivity test

[0151] The detection kit provided in Table 11 of Example 2 of the present invention was used to perform fluorescent PCR detection on avian influenza virus. Plasmids of H5, H7, H9 and universal avian influenza virus were taken respectively. The plasmids were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and their concentrations were measured and their purity was analyzed by NanoDrop 2000 ultra-micro spectrophotometer. The copy numbers of the plasmids were calculated according to the standard copy number calculation formula, and then the starting copy numbers of the nucleic acids of H5, H7, H9 and universal avian influenza standard products were uniformly calibrated to 1×10 10 copies / μL.

[0152] The formula for calculating RNA copy number is as follows:

[0153]

[0154] The optimal reaction system in Table 11 of Example 2 and the reaction program in Table 12 were used to measure the H5, H7, H9 and universal avian influenza virus plasmid templates with calibrated initial nucleic acid copy numbers in a 10-fold gradient dilution to determine the limit sensitivity of the method. The initial nucleic acid copy numbers of the H5, H7, H9 and universal avian influenza virus plasmid templates were all calibrated to 1×10 10 copies / μL, and the corresponding plasmid copy number was determined using the above method.

[0155] The experimental results are shown in Table 13. The sensitivity of the four-item fluorescent RT-PCR detection method for avian influenza virus of the present invention to the number of copies of H5, H7, H9 and universal nucleic acids in the sample all reached 10 copies / reaction.

[0156] Table 13: Sensitivity of multiplex fluorescent RT-PCR

[0157]

[0158] Example 4

[0159] Specificity experiments

[0160] The detection method of the present invention is verified to have cross-reactivity for the molecular biological identification of each HA subtype of avian influenza virus and other important viral pathogens commonly found in poultry and birds.

[0161] The nucleic acids of the following viral pathogens were tested respectively: H5, H7, H9 subtype avian influenza viruses, infectious bronchitis virus, Newcastle disease virus, infectious bursal disease virus, fowl adenovirus, and goose parvovirus.

[0162] Mix the samples infected with H5, H7, and H9 subtype avian influenza viruses to form a mixed sample of avian influenza virus, and then test it. For other non-avian influenza viruses, test them separately. Use the following nucleic acid amplification reaction system and reaction procedure to perform fluorescent RT-PCR.

[0163] The total volume of the reaction system is 25 μL: 5 μL of RT-PCR reaction solution, 10 μL of template RNA, 0.6 μL of primers H5-F2, H5-R2, H7-F1, H7-R1, H9-F1, H9-R1, M-F1, and M-R1 at a concentration of 10 μM, 0.3 μL of primers 18S-F1 and 18S-R1 at a concentration of 10 μM, 0.5 μL of probes H5-P2, H7-P1, H9-P1, and M-P1 at a concentration of 10 μM, 0.2 μL of probe 18S-P1 at a concentration of 10 μM, and make up to 25 μL with DEPC water.

[0164] The reaction procedure was as follows: reverse transcription reaction at 50°C for 30 min; pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing and extension at 61°C for 30 s, a total of 45 cycles, and fluorescence detection at 61°C.

[0165] Fig. 9 The results of fluorescence RT-PCR specific detection of avian influenza virus mixed samples by using H5, H7, H9 subtypes and universal avian influenza viruses and internal reference gene probe primers according to the present invention are shown. Fig. 9 It can be seen that for mixed samples of avian influenza virus subtypes, the kit and detection method of the present invention can correctly distinguish H5, H7, and H9 subtypes of avian influenza, and there is no cross-reaction between the subtypes.

[0166] Fig.10 The results of fluorescence RT-PCR specific detection of non-avian influenza virus samples by using H5, H7, H9 subtypes and universal avian influenza viruses and internal reference gene probe primers according to the present invention are shown. Fig.10It can be seen that the above five non-avian influenza pathogen samples were tested separately, and the test results showed no PCR target amplification curve, and only the internal reference amplification detection curve appeared. It can be seen that the avian influenza virus fluorescent RT-PCR detection kit provided by the present invention can specifically detect H5, H7, and H9 subtype avian influenza viruses, but does not produce non-specific amplification for non-avian influenza viruses such as infectious bronchitis virus, Newcastle disease virus, infectious bursal disease virus, fowl adenovirus, and goose parvovirus. When testing pathogen-infected samples, other non-avian influenza viruses will not be detected, which shows that the kit and method of the present invention have good specificity.

[0167] Example 5

[0168] Testing of samples containing inhibitors / interfering substances

[0169] The test sample for the four-item fluorescent RT-PCR detection kit for avian influenza virus provided by the embodiment of the present invention can be a direct homogenized sample, without manual extraction. However, the homogenized sample may contain inhibitory components that inhibit the PCR reaction, such as common poultry feces, food residues, blood contained in tissues in cloacal swabs, etc., so the samples containing these inhibitors and the samples extracted using the viral RNA extraction kit are selected and fluorescent PCR is performed simultaneously to detect the anti-inhibition effect of the kit of the present invention on such inhibitors. Fluorescent RT-PCR was performed using the reaction system in Table 11 of Example 2 (adding 10 μL template RNA) and the reaction procedure in Table 12. The test results are shown in Table 14 below.

[0170] Table 14: Ct values ​​of samples containing inhibitors / interferors As can be seen from Table 14, when the detection kit of the present invention performs fluorescent PCR detection on biological samples containing inhibitory components such as poultry feces, food residues, and blood contained in tissues, it still has the same amplification Ct value as the nucleic acid extracted using the virus RNA extraction kit, and the consistency of the amplification curve is very good. This shows that adding the above-mentioned inhibitory components to the avian influenza virus four-item fluorescent RT-PCR detection kit provided in the embodiment of the present invention will not affect the detection effect of the specific primer probe combination and the kit of the present invention.

[0171] Example 6

[0172] Accuracy test

[0173] (1) Test kit and detection method

[0174] Test group: the four-item fluorescent RT-PCR detection kit for avian influenza virus of Example 2 of the present invention, using the reaction system of Table 11 and the reaction conditions of Table 12.

[0175] Control group: Use primers and probes for detecting the same type of avian influenza virus in the "Diagnostic Technology for Highly Pathogenic Avian Influenza" (GB / T 18936-2020) (Appendix F, Table F.1 Optional Primers and Probes for Real-time Fluorescence RT-PCR Test of Avian Influenza Virus).

[0176] (2) Test samples

[0177] 100 biological samples of avian influenza to be tested, including 50 chicken oral pharyngeal swabs and 50 chicken cloacal swabs.

[0178] (3) Test results

[0179] The test results of the test group were 70 cases of avian influenza virus positive group and 30 cases of negative group. The avian influenza virus positive consistency percentage between the test group and the control group was 98.57%, the negative consistency percentage was 96.77%, and the total consistency percentage was 98.00%. This shows that the avian influenza virus positive and type results detected by the evaluation method and the control method have good consistency.

[0180] The above-described embodiments of the present invention do not constitute a limitation on the protection scope of the present invention. Any modification, equivalent substitution, improvement and reverse complementation of sequences made within the spirit and principle of the present invention are included in the protection scope of the present invention.

Claims

1. A primer probe set for simultaneously detecting H5, H7, H9 subtypes and universal avian influenza virus, characterized in that: The primer-probe set includes the following primers and probes: The probe H5-P2 of H5 subtype avian influenza virus has the nucleotide sequence shown in SEQ ID NO.4; The upstream primer H5-F2 of H5 subtype avian influenza virus has the nucleotide sequence shown in SEQ ID NO.5; A downstream primer H5-R2 of H5 subtype avian influenza virus having a nucleotide sequence as shown in SEQ ID NO.6; The probe H7-P1 of H7 subtype avian influenza virus has the nucleotide sequence shown in SEQ ID NO.10; The upstream primer H7-F1 of H7 subtype avian influenza virus has a nucleotide sequence as shown in SEQ ID NO.11; A downstream primer H7-R1 of H7 subtype avian influenza virus, which has a nucleotide sequence as shown in SEQ ID NO.12; The probe H9-P1 of H9 subtype avian influenza virus has the nucleotide sequence shown in SEQ ID NO.19; The upstream primer H9-F1 of H9 subtype avian influenza virus has the nucleotide sequence shown in SEQ ID NO.20; A downstream primer H9-R1 of H9 subtype avian influenza virus, which has a nucleotide sequence as shown in SEQ ID NO.21; A universal avian influenza virus probe M-P1 having a nucleotide sequence as shown in SEQ ID NO.28; The upstream primer M-F1 of universal avian influenza virus has the nucleotide sequence shown in SEQ ID NO.29; The downstream primer M-R1 of universal avian influenza virus has a nucleotide sequence as shown in SEQ ID NO.

30.

2. The primer probe set according to claim 1, characterized in that: Also included are primer probes for 18s rRNA avian internal reference genes, wherein the primer probes for the 18s rRNA avian internal reference genes are as follows: The probe 18S-P1 of the 18S rRNA avian internal reference gene has the nucleotide sequence shown in SEQ ID NO.37; The upstream primer 18S-F1 of the 18s rRNA avian internal reference gene has a nucleotide sequence as shown in SEQ ID NO.38; The downstream primer 18S-R1 of the 18s rRNA avian internal reference gene has a nucleotide sequence as shown in SEQ ID NO.

39.

3. The primer probe set according to claim 2, characterized in that: The probe H5-P2 of the H5 subtype avian influenza virus, the probe H7-P1 of the H7 subtype avian influenza virus, the probe H9-P1 of the H9 subtype avian influenza virus and the probe M-P1 of the universal avian influenza virus carry a FAM fluorescent reporter group and a BHQ1 fluorescent quencher group at their 5' end and 3' end respectively, and the specific probe of the avian 18s rRNA internal reference gene carries a VIC fluorescent reporter group and a BHQ1 fluorescent quencher group at their 5' end and 3' end respectively. 4 . A fluorescent RT-PCR detection kit, comprising the primer probe set according to any one of claims 1 to 3 .

5. The fluorescent RT-PCR detection kit according to claim 4, characterized in that: The fluorescent RT-PCR detection kit also includes RT-PCR reaction solution and DEPC water.

6. The fluorescent RT-PCR detection kit according to claim 4, characterized in that: The fluorescent RT-PCR detection kit also includes paraffin.

7. Use of the primer probe set according to any one of claims 1 to 3 in the preparation of a kit for simultaneously detecting H5, H7 and H9 subtypes and universal avian influenza virus.

8. The use according to claim 7, characterized in that: The reaction procedure of the detection is as follows: reverse transcription reaction at 50°C for 30 minutes; pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 15 seconds, annealing and extension at 61°C for 30 seconds, for a total of 45 cycles.

9. The use according to claim 7, characterized in that: The reaction system of the detection is as follows: 5 μL of RT-PCR reaction solution, 10 μL of template RNA, 0.6 μL of primers H5-F2, H5-R2, H7-F1, H7-R1, H9-F1, H9-R1, M-F1, and M-R1 at a concentration of 10 μM, 0.3 μL of 18S-F1 and 18S-R1 at a concentration of 10 μM, 0.5 μL of probes H5-P2, H7-P1, H9-P1, and M-P1 at a concentration of 10 μM, 0.2 μL of probe 18S-P1 at a concentration of 10 μM, and 25 μL of DEPC water.

10. The use according to any one of claims 7 to 9, characterized in that The avian influenza virus subtype is determined based on the amplification results, including: If the reference gene Ct value is ≤32, the target gene Ct value is ≤38, and the amplification curve is a typical S-type, it is judged as positive; If the reference gene Ct≤32 and the target gene Ct value is 38<Ct≤40, retest. If the retest result Ct value is <40, it is judged as positive, otherwise it is judged as negative; If the reference gene Ct is ≤32, the target gene has no Ct value displayed, there is no typical S-shaped amplification curve or the Ct value is ≥40, it is judged as negative; If the internal reference gene Ct>32 or there is no amplification curve, the test is invalid and needs to be retested.

Images