MicroRNA electrochemical detection method based on functionalized porous membrane and DNA-RNA hybrid double-chain binding protein

Abstract

The invention discloses a microRNA electrochemical detection method based on a functionalized porous membrane and DNA-RNA hybrid double-chain binding protein, and belongs to the technical field of biomedical detection. The detection method comprises the following steps: designing and synthesizing a complementary DNA (Deoxyribose Nucleic Acid) probe aiming at a target miRNA to be detected; a DNA probe is connected to the inner wall of a pore channel of the porous membrane in a gathering mode; after the target miRNA is combined with the DNA probe, adding protein which can specifically recognize and be combined with a DNA-RNA compound, blocking a porous channel of the porous membrane, and amplifying a signal; washing to remove uncombined protein; the current impedance change on the two sides of the porous membrane is detected through an electrochemical workstation, so that the target miRNA is detected. The detection method provided by the invention has the advantages of simplicity and convenience in operation, easiness in obtaining raw materials, low cost, obvious current impedance change, high sensitivity and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedical detection, and specifically relates to a microRNA electrochemical detection method based on a functionalized porous membrane and a DNA-RNA hybrid double-stranded binding protein. Background Art

[0002] miRNA (Micro RNA) is a type of non-coding RNA widely found in eukaryotes. It is about 22 nucleotides in length and plays an important role in regulating gene expression in eukaryotic cells. miRNA was first discovered in C.elegans in 1993. With the in-depth research and the development of high-throughput sequencing technology, more and more types of miRNA have been found in animal and plant cells. To date, more than 2,000 miRNAs have been reported to be involved in regulating human gene expression, and about one-third of the genes in the human genome are regulated by different miRNAs.

[0003] miRNA participates in regulating a variety of physiological and pathological processes in the human body. The occurrence and development of a variety of diseases are accompanied by the dysregulation of miRNA expression, including aging, cardiovascular disease, metabolic disease and tumors. Among them, miRNA plays an important role in the occurrence and development of many types of human tumors and is an ideal biomarker for early diagnosis and prognosis assessment of tumors.

[0004] At present, the main means of detecting miRNA include Nothern Blot, cDNA microarray, real-time quantitative PCR (qRT-PCR), fluorescence resonance energy transfer (FRET), RNA magnetic bead adsorption method, etc. These methods have low sensitivity, take a long time, and the samples need to go through amplification, labeling and other steps. The operation is cumbersome and prone to false positive results. It is of great significance to develop new methods and products for the rapid detection of miRNA with high sensitivity and clinical application. Summary of the invention

[0005] The content of this method is to provide a microRNA electrochemical detection method based on a functional porous membrane and a DNA-RNA hybrid double-stranded binding protein.

[0006] The technical solution of this method is summarized as follows:

[0007] S1. Synthesize a completely complementary DNA probe according to the sequence of the target miRNA to be detected, wherein the 5' end of the DNA probe is modified with an amino group (-NH2). In a specific embodiment, the target miRNA is miR-21.

[0008] S2, the chemically etched porous membrane was immersed in an aqueous solution of 1-ethyl-(3-dimethylaminopropyl) carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for 2 hours to make the free carboxyl groups (COO - ) is fully activated, washed, dried, and then immersed in a solution of amino-modified DNA probes. The amino groups react with the carboxyl groups on the inner wall of the pores to allow the probes to bind to the pores.

[0009] S3. The target to be detected is incubated with a porous membrane functionalized with a DNA probe, and the target miRNA undergoes molecular hybridization with the DNA probe on the inner wall of the pores of the porous membrane through complementary base pairing.

[0010] S4, incubate the porous membrane with the DNA-RNA hybrid double-stranded binding protein. In the pores of the porous membrane, the DNA-RNA hybrid double-stranded binding protein recognizes and binds to the DNA probe-miRNA hybrid double-stranded, is trapped in the pores, and blocks the pores. Preferably, the DNA-RNA hybrid double-stranded binding protein used should be the S9.6 monoclonal antibody. Further preferably, the DNA-RNA hybrid double-stranded binding protein used is the RNaseH1 D210N mutant, or deletes all or part of the amino acids in the catalytic active domain of RNaseH1 (amino acid sequence number 136-282).

[0011] S5. Use an electrochemical workstation to detect the current changes on both sides of the porous membrane. The effective diameter of the pores becomes smaller, which increases the current impedance on both sides of the porous membrane, achieving the effect of signal amplification and possible quantitative analysis.

[0012] Compared with the existing technology, the detection method provided by this method has the following beneficial effects:

[0013] The method provides a microRNA electrochemical detection method based on a functional porous membrane and a DNA-RNA hybrid double-stranded binding protein. A DNA probe complementary to the target miRNA is connected to the inner wall of the porous membrane pore channel. The DNA probe combines with the target miRNA to be detected to form a DNA-RNA hybrid double-stranded protein, which is recognized by the DNA-RNA hybrid double-stranded binding protein. The protein is trapped in the pore channel, which reduces the effective diameter of the pore channel and increases the current impedance. The current change before and after the molecular hybridization is detected by an electrochemical workstation.

[0014] The detection method provided by this method is based on electrochemical detection. The sensitivity of the electrochemical detection method is very high. The electrochemical workstation can distinguish the current change of 0.3fA at the lowest, which will greatly improve the detection sensitivity of this method for the target miRNA and can detect extremely trace amounts of miRNA.

[0015] miRNA is composed of only about 22 ribonucleotides. After binding to the DNA probe, the charge change and steric hindrance of the pore are small, making it difficult to detect signals. The detection method provided by this method utilizes the characteristics of DNA-RNA hybrid double-stranded binding protein to amplify the hybridization signal of DNA-RNA molecules in the pore, solving the problem that miRNA is small and difficult to detect signals, and greatly improving the sensitivity and feasibility of detection.

[0016] Compared with immunochromatography, the antibodies or probes of immunochromatography require colloidal gold or fluorescent labeling, and the color changes are observed by naked eyes, which has low sensitivity and few application scenarios. It is not competent for detection in certain specific situations. For example, some miRNAs, such as miR-21, miR-141, miR-375, etc. can be used as biomarkers for early diagnosis of tumors. The concentration of the corresponding miRNA in the patient's serum is only 6000-12000 copies per microliter, which is about 10-20fM (Kanavarioti A, 2022). Therefore, it is difficult for immunochromatography to detect trace amounts of serum miRNA in the early stage of tumors. In the detection method provided by the present invention, neither the probe nor the hybrid double-stranded binding protein requires labeling, the preparation method is simple, the cost is low, the sensitivity is high, and it has high practicality. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Schematic diagram of the electrochemical detection method of microRNA based on functionalized porous membrane and DNA-RNA hybrid double-stranded binding protein

[0018] Figure 2 Schematic diagram of the detection device

[0019] Figure 3 Microcurrent change curve of miR-21 standard products with different concentrations detected by the detection method provided by the present invention

[0020] Figure 4 Linear regression analysis of the relative ion current change rate (I0-I1) / I0 and the logarithm of miR-21 concentration at a voltage of -2 V

[0021] Figure 5 Microcurrent change curves of single-base and double-base mismatch standards and completely non-complementary samples of miR-21 detected by the detection method provided by the present invention

[0022] Figure 6 The detection method provided by the present invention is used to detect the relative ion current change rate of single-base and double-base mismatch standards and completely non-complementary samples of miR-21

[0023] Figure 7 Utilize the precision of the detection method provided by the present invention. DETAILED DESCRIPTION Example 1

[0024] Establishment of porous membrane electrochemical biosensing detection method.

[0025] 1) Cutting of nuclear pore membrane and assembly of equipment: Take a nuclear pore membrane made of polyethylene terephthalate (PET), cut it into a square size of 2cm×2cm, and fix it in the center of the H-type electrolytic cell with a clamp. The positive and negative electrodes of the electrolytic cell are both Ag / AgCl electrodes. The PET nuclear pore membrane is made by our company, with a thickness of 10~50μm, a pore size (diameter) of 500nm, a pore size uniformity of >95%, and a pore density of 2×10 11 Pieces / cm 2 , hole density uniformity per cm 2 Greater than 90%. Schematic diagram of the experimental setup is shown in Figure 2 shown.

[0026] 2) Design and synthesis of DNA probes and positive standards: miR-21, which is associated with a variety of human tumors, was used as the target to be tested. A fully complementary DNA probe was synthesized, and the 5' end of the DNA probe was amino-modified. The sequence of the DNA probe and the positive standard of miR-21 were synthesized and designed according to the full-length sequence of miR-21-5p, and the sequence is shown in Table 1.

[0027] Table 1 Related sequences name sequence serial number miR-21-5p UAGCUUAUCAGACUGAUGUUGA SEQ ID NO.1 DNA probe <![CDATA[NH2-TCAACATCAGTCTGATAAGCTA]]> SEQ ID NO.2 Positive standard (miR-21 sequence) TAGCTTATAAGACTGCTGTTGA SEQ ID NO.3

[0028] 3) Preparation of functionalized nuclear pore membrane

[0029] The nucleopore membrane was immersed in an aqueous solution of 1-ethyl-(3-dimethylaminopropyl) carbodiimide (EDC, 10-15 mg / mL) and N-hydroxysuccinimide (NHS, 1-5 mg / mL) at room temperature for 2 hours to fully activate the carboxyl groups (COO - ). After washing and drying the nuclear pore membrane, immerse it in a solution of DNA probes with a probe concentration of 10 μmol / L. Allow to react overnight (12 to 16 hours) at room temperature to allow the DNA probes to be covalently linked to the pores by forming amide bonds.

[0030] 4) Detection of the target

[0031] See the detection method principle Figure 1 .

[0032] The miR-21 standard was dissolved in PBS buffer and diluted in a gradient to a standard solution with a concentration of 1 μmol / L to 100 amol / L.

[0033] The miR-21 standard solution with different concentrations was incubated with the DNA probe functionalized porous membrane at room temperature for 30 minutes, and the membrane was washed twice with PBS buffer.

[0034] The porous membrane was incubated with the S9.6 monoclonal antibody at room temperature for 45 minutes. The S9.6 antibody used in this example was AntibodySystem, RGK60001, which was diluted with PBST (PBS + 0.1% Tween 20) at a dilution ratio of 1:400. The membrane was washed twice with PBST buffer.

[0035] The electrochemical workstation detected the microcurrent changes of miR-21 standards at different concentrations. Figure 3 ), as the concentration of miR-21 gradually increased, the current impedance also increased further. Based on this, a linear relationship between the electrical signal data detected by the electrochemical workstation and the miRNA concentration can be established, y=0.05463x-0.03176, and the regression coefficient R 2 =0.98989, which indicates that the current impedance increases with the increase of concentration ( Figure 4 ). Example 2

[0036] In order to verify the specificity of the detection method for the target, positive standards (completely complementary), single base mismatches, and completely non-complementary references were used, and the detection method of the present method was used to perform the test according to the steps in Example 1. The sample sequences are shown in Table 2.

[0037] Table 2 Specific experimental sample sequences name sequence serial number Positive standard (miR-21 sequence) TAGCTTATCAGACTGATGTTGA SEQ ID NO.3 Single base mismatch TAGCTTATAAGACTGATGTTGA SEQ ID NO.4 Double base mismatch TAGCTTATAAGACTGCTGTTGA SEQ ID NO.5 Completely non-complementary (miR-26a sequence) TTCAAGTAATCCAGGATAGGCT SEQ ID NO.6

[0038] The results are as follows Figure 5 The microcurrent of the fully complementary miRNA sequence shown in the figure has the most significant change and the largest current impedance. At the same time, the relative ion current change rate ( Figure 6 ) also further confirmed that dDSN recognizes and binds to DNA-RNA hybrid double strands, blocking the nuclear pore and further increasing the current impedance of the nuclear pore membrane.

[0039] In the same electrochemical workstation, the nuclear pore membrane after incubation in the example was measured repeatedly, and the relative standard deviation of the current value was 1.55% ( Figure 7 Different batches of nuclear pore membranes were prepared in the same way, and the relative standard deviation of the current values ​​was 2.12% ( Figure 7 (b)).

[0040] The technical solutions, embodiments and related descriptions presented in the present invention are intended to clearly illustrate the typical implementation methods of the invention content and core technical solutions, and are not intended to limit the scope of the present invention. Adaptive adjustments and improvements made on the basis of following the basic concept and core principles of the present invention should all be covered within the protection scope of the present invention.

Claims

1. A method for electrochemical detection of miRNA, characterized in that: A DNA probe that is completely complementary to the target miRNA is connected to the pores of the porous membrane. After the target miRNA and the DNA probe are combined in the pores of the porous membrane, a protein that can specifically bind to the DNA-RNA hybrid double strand is added to block the pores of the porous membrane to achieve signal amplification. The changes in current impedance on both sides of the porous membrane are detected by an electrochemical workstation to achieve detection of the target miRNA.

2. The electrochemical detection method of miRNA according to claim 1, characterized in that: The porous membrane is made of polyethylene terephthalate, polycarbonate or polyimide; The thickness of the porous membrane is 10~50μm, the pore size is 0.05~10μm, and the pore density is 1×10 8 ~2×10 11 Pieces / cm 2 .

3. The electrochemical detection method of miRNA according to claim 1, characterized in that: The DNA probe is covalently connected to the porous membrane via an amide bond; or is connected to the porous membrane via electrostatic self-assembly of polyetherimide PEI.

4. The electrochemical detection method of miRNA according to claim 1, characterized in that: The DNA-RNA hybrid double-stranded binding protein is S9.6 antibody or catalytically inactivated RNaseH1; The RNaseH1 inactivation method includes but is not limited to: constructing an RNaseH1 D210N mutant; or deleting all or part of the amino acids in the catalytic activity domain of RNaseH1.

5. Use of the detection method according to claim 1 in the preparation of an in vitro diagnostic reagent for detecting miRNA.

Images