A recyclable biological chip stationary phase, its preparation method and application

The biochip stationary phase is prepared by combining plasma treatment and silane coupling agent, and recycling is achieved through reducing agent treatment, which solves the problem of difficult recycling of biochip stationary phase, reduces costs and improves resource utilization.

CN119838653BActive Publication Date: 2025-08-05TIANJIN ZHONGHE GENE TECH CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510307304.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-17
Publication Date
2025-08-05
Estimated Expiration
2045-03-17

AI Technical Summary

Technical Problem

The existing biochip stationary phase is disposable consumables, resulting in waste of resources and high costs, making it difficult to recycle.

Method used

The slides were treated with plasma and combined with silane coupling agent to prepare functionally modified biochips, and then combined with 5' end modified single-chain oligo to form a recyclable biochip stationary phase, and the recycling was achieved through reducing agent treatment.

Benefits of technology

It realizes the recycling of biochip stationary phases, reduces costs, improves resource utilization, reduces pollution, has good physical and chemical properties and stability, and adapts to complex environments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119838653B_ABST
    Figure CN119838653B_ABST
Patent Text Reader

Abstract

The present invention discloses a recyclable biochip stationary phase, its preparation method, and application, and belongs to the field of biochips. The preparation method of the biochip stationary phase of the present invention comprises the following steps: (1) using plasma to activate a glass slide, then placing the glass slide in a silane coupling agent solution for reaction, so that the silane coupling agent and the glass slide are covalently bonded to obtain a functionalized biochip; (2) combining a 5'-end modified single-stranded oligo with the functionalized biochip to obtain the biochip stationary phase. The biochip stationary phase of the present invention has low cost, excellent physical and chemical properties, good stability and tolerance, and can adapt to complex environments; more importantly, it can be recycled, improving resource utilization and reducing pollution, and shows great application potential in cutting-edge technologies such as enzymatic DNA synthesis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biochips, and in particular to a recyclable biochip stationary phase and a preparation method and application thereof. Background Art

[0002] In recent years, genetic engineering technology has developed rapidly, and the position of DNA synthesis in the field of bioengineering has become increasingly critical, becoming a core link in promoting many research and application breakthroughs. As a cutting-edge third-generation DNA synthesis technology, bioenzymatic DNA synthesis, with its outstanding characteristics such as high efficiency, high accuracy and environmental protection, is like a key, bringing hope to solving the many problems faced by traditional DNA synthesis, and is expected to break the current bottleneck of chemical synthesis. DNA synthesis technology can use biological enzymes to catalyze the addition of single bases to the end of the DNA chain and carry out multiple rounds of reactions to synthesize the target DNA chain. In this process, the DNA chain needs to be fixed on a solid surface for subsequent reactions.

[0003] In this technology system, biochips, as the stationary phase for DNA synthesis, play key roles such as supporting the reaction and fixing the reaction substrate. DNA immobilization technology is an important foundation for the functioning of biochips, mainly fixing the probes on the support through covalent or non-covalent means. The non-covalent immobilization method cleverly utilizes the hydrophobic and electrostatic interactions between molecules to achieve probe fixation under relatively mild conditions. This method is relatively simple to operate and has little effect on the structure of the probe. The covalent immobilization method uses chemical reactions between functional groups to form stable covalent bonds. Although the reaction conditions are relatively complex, it can provide a stronger fixation effect, ensuring that the probe remains stable in a complex reaction environment, providing a solid guarantee for accurate DNA synthesis. However, the chip stationary phase carriers currently on the market are all disposable consumables that are difficult to recycle, resulting in high costs and a large waste of resources. Summary of the Invention

[0004] The purpose of the present invention is to provide a recyclable biochip stationary phase and its preparation method and application.

[0005] The present invention first provides a method for preparing a biochip stationary phase, comprising the following steps:

[0006] (1) treating a glass slide with plasma, and then placing the glass slide in a silane coupling agent solution for reaction, so that the silane coupling agent is covalently bonded to the glass slide to obtain a functionally modified biochip;

[0007] (2) Combining the 5'-end modified single-stranded oligo with the functionally modified biochip to obtain the biochip stationary phase.

[0008] In the above-mentioned preparation method, in step (1), the plasma treatment time is 1-500 s, specifically 180 s;

[0009] The power of the plasma treatment is 30-160 W; specifically 130 W;

[0010] The working gas for the plasma treatment is selected from any one of nitrogen, oxygen, argon and air;

[0011] The flow rate of the working gas for the plasma treatment is 10 to 100 mL / h; specifically, it can be 10 mL / h;

[0012] The silane coupling agent contains a mercapto group;

[0013] The silane coupling agent can be specifically selected from at least one of (3-mercaptopropyl)triethoxysilane, mercaptopropylmethyldimethoxysilane and (3-mercaptopropyl)trimethoxysilane;

[0014] The volume percentage concentration of the silane coupling agent solution is 1%-20%, specifically 1%;

[0015] The solvent of the silane coupling agent solution is acetonitrile;

[0016] The reaction time is 2 h-24 h; specifically 24 h;

[0017] The reaction temperature is 20°C-60°C, specifically 20°C-35°C; the reaction is carried out in the dark.

[0018] In the above preparation method, the modified group at the 5' end of the single-chain oligo is a disulfide bond;

[0019] The 5'-end modified single-stranded oligo is a 5'-end modified single-stranded DNA;

[0020] Specifically, the nucleotide sequence of the single-stranded oligo is as follows:

[0021] 5'-TTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3';

[0022] The 5'-end modified single-stranded oligo is combined with the functionally modified biochip by spotting;

[0023] The spotting concentration of the 5'-end modified single-stranded oligo is 1-10 μmol / L, specifically 2.5 μmol / L;

[0024] The spotting volume of the 5'-end modified single-stranded oligo is 1-5 μL, specifically 1 μL;

[0025] The time for the 5'-end modified single-stranded oligo to combine with the functionally modified biochip is 6 h-24 h, specifically 15 h;

[0026] The temperature for combining the 5'-end modified single-stranded oligo with the functionally modified biochip is 20° C.-60° C. (specifically 25° C.), and the ambient humidity is 70%-80%.

[0027] Specifically, the step of combining the 5'-end modified single-chain oligo with the functionally modified biochip in step (2) includes the following steps: dropping the 5'-end modified disulfide bond single-chain oligo solution on the functionally modified biochip in a spotting manner, then placing it in an environment with a humidity of 70%-80% at 25°C for 15 hours, rinsing with water and then drying with nitrogen.

[0028] The above preparation method further comprises the step of cleaning the glass slide before treating the glass slide with plasma;

[0029] The cleaning step comprises the following steps: placing the glass slide in an organic solvent for cleaning, then soaking the glass slide in a glass cleaning agent for ultrasonic treatment, and drying.

[0030] Specifically, the organic solvent is at least one of acetone, chloroform, ethyl chloride and xylene;

[0031] The ultrasonic cleaning time is 1-30 min.

[0032] The number of times of ultrasonic cleaning is 2 times;

[0033] The drying temperature is 25-80°C.

[0034] In the above preparation method, the size of the slide is 75 mm×25 mm, 76 mm×26 mm or 50 mm×75 mm.

[0035] The present invention further provides a biochip stationary phase prepared by the above preparation method.

[0036] The application of the above-mentioned biochip stationary phase in DNA synthesis also falls within the scope of protection of the present invention;

[0037] Specifically, the biochip fixed phase is used in enzymatic DNA synthesis.

[0038] The present invention also provides a method for synthesizing DNA, comprising the following steps: synthesizing DNA by enzymatic method using the above-mentioned biochip fixed phase.

[0039] Finally, the present invention provides a method for recycling the above-mentioned biochip stationary phase, comprising the following steps:

[0040] The used biochip stationary phase is immersed in a reducing agent for reaction, and then the 5'-end modified single-chain oligo is combined with the biochip stationary phase treated with the reducing agent to achieve the recycling of the biochip stationary phase.

[0041] In the above recycling method, the reducing agent is at least one of tris(2-carboxyethyl)phosphine (TCEP), dithiothreitol (DTT), mercaptoethanol (BME) and dithioerythritol (DTE);

[0042] The solution concentration of the reducing agent is 10 mM-2 M, specifically 1 M;

[0043] The reaction temperature is 20° C.-80° C., and the reaction time is 0.5 h-6 h, specifically, the reaction can be carried out at 60° C. for 1 h.

[0044] In the above recycling method, the 5'-end modification group of the single-chain oligo is a disulfide bond;

[0045] The nucleotide sequence of the single-stranded oligo is as follows:

[0046] 5'-TTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3';

[0047] The 5'-end modified single-stranded oligo is combined with the functionally modified biochip by spotting;

[0048] The spotting concentration of the 5'-end modified single-stranded oligo is 1-10 μmol / L, specifically 2.5 μmol / L;

[0049] The spotting volume of the 5'-end modified single-stranded oligo is 1-5 μL, specifically 1 μL;

[0050] The time for the 5'-end modified single-stranded oligo to combine with the functionally modified biochip is 6-24 hours, specifically 15 hours;

[0051] The temperature for combining the 5'-end modified single-stranded oligo with the functionally modified biochip is 20° C.-60° C. (specifically 25° C.), and the ambient humidity is 70%-80%.

[0052] In the present invention, the binding of the single-stranded oligo with a modified disulfide bond at the 5' end to the functionally modified biochip can be examined by hybridizing it with a complementary fluorescent DNA chain modified with a fluorescent group at the 3' end.

[0053] In the DNA complementary fluorescent chain modified with a fluorescent group at the 3' end, the fluorescent group is selected from at least one of CY5, CY3 and FITC.

[0054] The nucleotide sequence of the fluorescent complementary chain is as follows:

[0055] 5'-TCAAGTCGCGTAGGAGTCTCTAGCC-3';

[0056] The biochip stationary phase can be recycled 1-10 times.

[0057] Oligonucleotides synthesized using the stationary phase of the present invention can be used in the following scenarios:

[0058] (1) As a PCR primer, a primer chain with a cleavage site is inoculated, and then the target sequence is synthesized. After the reaction is completed, the cleavable nucleotide is dissociated from the solid phase by cleavage means, thereby successfully releasing the oligonucleotide;

[0059] (2) As the synthesis of short-chain nucleotide units of genes: The corresponding primer chain is inoculated according to the synthesis requirements of the short-chain nucleotide units of a certain gene to complete the synthesis of the gene segmented short-chain sequence. In this scenario, there is no need to perform dissociation operation, and the synthesized short-chain sequence is directly used in the gene splicing process.

[0060] The present invention introduces a recyclable stationary phase based on a silicon-based chip, which has low cost, excellent physical and chemical properties, good stability and tolerance, and can adapt to complex environments. The biochip stationary phase of the present invention also has the advantage of being functionalized and can be modified as needed. More importantly, it can be recycled, improve resource utilization, reduce pollution, and provide strong support for the sustainable development of biochip technology. It shows great application potential in cutting-edge technology fields such as enzymatic DNA synthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 Functional modification process for recyclable biochips;

[0062] Figure 2 This is the fluorescence image after coupling the initiation chain in Example 2;

[0063] Figure 3 This is the fluorescence image after hybridization of the fluorescent complementary chain in Example 2;

[0064] Figure 4 This is the fluorescence image of the first cycle in Example 3;

[0065] Figure 5 This is the fluorescence image of the second cycle in Example 3. DETAILED DESCRIPTION

[0066] The present invention will be further described in detail below in conjunction with specific embodiments. The examples given are only for illustrating the present invention, not for limiting the scope of the present invention.

[0067] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0068] The quantitative tests in the following examples were performed in triplicate unless otherwise specified, and the results were averaged.

[0069] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0070] The embodiments described below are some embodiments of the present invention, rather than all embodiments, and they should not be understood as limiting the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without making creative efforts are within the scope of protection of the present invention. In the description of the present invention, it should be understood that the terms used are for descriptive purposes only and should not be understood as indicating or implying relative importance.

[0071] Example 1: Preparation of a recyclable biochip

[0072] (1) Slide preparation: Select a clean 75 mm × 25 mm slide for subsequent experimental operations.

[0073] (2) Surface cleaning: First, clean the slide in acetone to remove surface oil and impurities. Then, soak the slide in a cleaning agent (1 g Alnocox dissolved in 100 mL water) and ultrasonicate for 5 min. Repeat this step twice to ensure thorough cleaning. After cleaning, dry the slide at 80 °C for 1 h to remove residual moisture.

[0074] (3) Plasma cleaning: Turn on the gas cylinder and the power of the equipment in sequence, and place the prepared slide in the plasma cleaning machine (Nan Technology-NE-PE05F). Turn on the radio frequency and vacuum system, and perform plasma treatment on the slide. Set the power to 130 W, the nitrogen flow rate to 10 mL / h, and the treatment time to 180 s to further clean the slide surface and improve its activity.

[0075] (4) Functional modification: Prepare a 1% (3-mercaptopropyl) triethoxysilane acetonitrile solution by volume, immerse the glass slide treated above in it, and react in the dark at room temperature (25°C) for 24 h to obtain a functionally modified biochip (the functional modification process is as follows Figure 1 shown).

[0076] Example 2: Preparation of a recyclable biochip stationary phase

[0077] (1) Coupling initiator chain: The functionalized modified biochip prepared in Example 1 was manually cut into 4 mm × 4 mm pieces. Then, a single-chain oligo (1 μL, 2.5 μmol / L) with a disulfide bond modified at the 5' end was dropped onto the biochip (4 mm × 4 mm) in a spotting manner. The biochip was placed in a humidified chamber (humidity 70%-80%) and reacted at 25°C for 15 h. After the reaction, the biochip was rinsed twice with water and then dried with nitrogen to obtain a recyclable biochip stationary phase. The biochip was placed under a fluorescence microscope for observation. Figure 2 This is the fluorescence image after coupling the initiator chain.

[0078] The nucleotide sequence of the initiating chain (Sequence I) is as follows:

[0079] 5'-TTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3';

[0080] The single-chain oligo with a modified disulfide bond at the 5' end refers to a single-chain oligo with a modified disulfide bond at the 5' end.

[0081] (2) Hybridization of fluorescent complementary chains: Immerse the biochip stationary phase prepared in step (1) in eight consecutive centrifuge tubes containing fluorescent complementary chains (100 μL, 0.5 μmol / L) and perform hybridization experiments. After hybridization is completed, wash twice with 0.1 mol / L sodium chloride solution and blow dry with nitrogen gas, and observe under a fluorescence microscope. Figure 3 It is the fluorescence image after hybridization of fluorescent complementary chain.

[0082] The nucleotide sequence of the fluorescent complementary chain is as shown in Sequence II; the specific fluorescent complementary chain is as follows:

[0083] 5'-TCAAGTCGCGTAGGAGTCTCTAGCC-3'-CY3.

[0084] Example 3: Recyclable Application of Biochip Stationary Phase

[0085] (1) First cycle: Soak the biochip stationary phase hybridized in Example 2 above in 1 M TCEP reducing agent (Aladdin, Product No.: T107252) at 60°C for 1 h, then rinse twice with water and blow dry with nitrogen, and observe its fracture condition under a fluorescence microscope. Figure 4 (A) in the figure shows the fluorescence image after TCEP treatment.

[0086] (2) Hybridization verification: The biochip stationary phase treated with TCEP in step (1) was immersed in eight consecutive centrifuge tubes containing fluorescent complementary chains (100 μL, 0.5 μmol / L) and hybridized again. After hybridization was completed, the biochip was washed twice with 0.1 mol / L sodium chloride solution and dried with nitrogen, and then observed under a fluorescence microscope. Figure 4 (B) shows the fluorescence image after hybridization of the complementary fluorescent chain. The results indicate that the covalent bond on the stationary phase surface was successfully broken, and complementary hybridization could not be carried out on its surface.

[0087] (3) Secondary spotting: Repeat the operation of coupling the initiator chain in Example 2 on the biochip stationary phase treated with TCEP in step (1) above, and then observe it under a fluorescence microscope. Figure 4 (C) in the figure is the fluorescence image after secondary coupling and initiation of the chain.

[0088] (4) Secondary hybridization: Repeat the above step (2) with the biochip fixed phase of the second coupling initiator chain in step (3). Figure 4 (D) shows the fluorescence image after hybridization of the complementary fluorescent strand. This result indicates that the covalent bonds on the stationary phase surface have been successfully restored, and the stationary phase can be successfully recycled.

[0089] (5) Second cycle: Repeat the above step (1) on the biochip fixed phase of the second hybridization in step (4). Figure 5 (A) in the figure shows the fluorescence image after TCEP treatment.

[0090] (6) Hybridization verification: Repeat the above step (2) on the biochip stationary phase treated with TCEP in step (5), and then observe under a fluorescence microscope. Figure 5 (B) is the fluorescence image after hybridization of the fluorescent complementary chain. The results show that the covalent bond on the surface of the stationary phase is successfully broken and complementary hybridization cannot be carried out on its surface.

[0091] (7) Three-time spotting: Repeat the operation of coupling the initiator chain in Example 2 on the biochip stationary phase treated with TCEP in step (5) above, and then observe it under a fluorescence microscope. Figure 5 (C) in the figure shows the fluorescence image after three coupling initiation chains.

[0092] (8) Three-time hybridization: Repeat the above step (2) with the biochip fixed phase of the third coupling initiator chain in step (7). Figure 5 (D) shows the fluorescence image after hybridization of the complementary fluorescent strand. This result indicates that the covalent bonds on the stationary phase surface have been successfully restored, and the stationary phase can be successfully recycled.

[0093] The nucleotide sequence of the priming strand and the nucleotide sequence of the fluorescent complementary strand used in this example are the same as those in Example 2.

[0094] Example 4: Recyclable biochip stationary phase for enzymatic DNA synthesis

[0095] DNA synthesis was performed on a DNA synthesizer using the biochip stationary phase prepared in step (1) of Example 2. The nucleotide sequence of the synthesized DNA (sequence III) was: TAGGTATATATGTGCCATGGTGGTTTGTTGCACCCATCAACCCTTCATCTACATTAGGTA. The specific steps involved using TdT enzyme and dNTPs with protected bases to perform an enzyme-catalyzed chain extension reaction at the end of the initiator chain, followed by elution of the protecting groups on the bases using a deprotection solution. Multiple cycles were performed to achieve enzymatic synthesis of the target DNA sequence. The synthesis steps were as follows:

[0096] Steps: (1) Enzymatic DNA synthesis is performed based on a biochip using TdT enzyme and dNTPs with protected bases. The enzyme reaction system is shown in Table 1.

[0097]

[0098] The enzyme reaction conditions are 30°C and the reaction time is 5-10 min.

[0099] (2) Use deprotection solution (0.3 M sodium nitrite solution) to elute the protected bases and perform multiple cycles to achieve enzymatic synthesis of the target DNA sequence.

[0100] (3) PCR amplification of the target DNA sequence synthesized based on the biochip is performed, and the PCR amplification product is subjected to agarose gel electrophoresis. The target electrophoresis band is recovered and sequenced and analyzed.

[0101] (4) The synthesized product was subjected to second-generation sequencing analysis. As shown in Table 2, the sequencing results of the first synthesis showed that the yield could reach 60% and the accuracy could reach 99.17%.

[0102] (5) The chip after the first synthesis was cut (step 1 of example 3) and inoculated (step 3 of example 3) according to the method of example 3, and then the second and third synthesized (same sequence) were performed. The sequencing results showed that the synthesis accuracy did not decrease significantly after multiple uses, proving the recyclable nature of the chip.

[0103] (Accuracy calculation formula: Accuracy = ).

[0104] .

Claims

1. An application of a biochip stationary phase in enzymatic DNA synthesis, characterized by: The enzyme is TdT enzyme; The method for preparing the biochip stationary phase comprises the following steps: (1) treating a glass slide with plasma, and then placing the glass slide in a silane coupling agent solution for reaction, so that the silane coupling agent is covalently bonded to the glass slide to obtain a functionally modified biochip; (2) combining the 5'-end modified single-stranded oligo with the functionally modified biochip to obtain the biochip stationary phase; The modified group at the 5' end of the single-chain oligo is a disulfide bond; The nucleotide sequence of the single-stranded oligo is as follows: 5'-TTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3'.

2. The use according to claim 1, wherein: In step (1), the plasma treatment time is 1-500 s; The power of the plasma treatment is 30-160 W; The working gas for the plasma treatment is selected from any one of nitrogen, oxygen, argon and air; The flow rate of the working gas for the plasma treatment is 10-100 mL / h; The silane coupling agent is selected from at least one of (3-mercaptopropyl)triethoxysilane, mercaptopropylmethyldimethoxysilane and (3-mercaptopropyl)trimethoxysilane; The volume percentage concentration of the silane coupling agent solution is 1%-20%; The reaction time is 2h-24h; The reaction temperature is 20°C-60°C.

3. The use according to claim 1, characterized in that: The 5'-end modified single-stranded oligo is combined with the functionally modified biochip by spotting; The spotting concentration of the 5'-end modified single-stranded oligo is 1-10 μmol / L; The spotting volume of the 5'-end modified single-stranded oligo is 1-5 μL; The time for the 5'-end modified single-stranded oligo to combine with the functionally modified biochip is 6 h to 24 h; The temperature for combining the 5'-end modified single-stranded oligo with the functionally modified biochip is 20° C.-60° C., and the ambient humidity is 70%-80%.

4. The use according to any one of claims 1 to 3, characterized in that: The preparation method further comprises the step of cleaning the glass slide before treating the glass slide with plasma; The cleaning step comprises the following steps: placing the glass slide in an organic solvent for cleaning, then soaking the glass slide in a glass cleaning agent for ultrasonic treatment, and drying.

5. A method for synthesizing DNA, comprising the following steps: synthesizing DNA using an enzymatic method using a biochip stationary phase; The enzyme is TdT enzyme; The method for preparing the biochip stationary phase comprises the following steps: (1) treating a glass slide with plasma, and then placing the glass slide in a silane coupling agent solution for reaction, so that the silane coupling agent is covalently bonded to the glass slide to obtain a functionally modified biochip; (2) combining the 5'-end modified single-stranded oligo with the functionally modified biochip to obtain the biochip stationary phase; The modified group at the 5' end of the single-chain oligo is a disulfide bond; The nucleotide sequence of the single-stranded oligo is as follows: 5'-TTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3'.

6. The method according to claim 5, wherein: In step (1), the plasma treatment time is 1-500 s; The power of the plasma treatment is 30-160 W; The working gas for the plasma treatment is selected from any one of nitrogen, oxygen, argon and air; The flow rate of the working gas for the plasma treatment is 10-100 mL / h; The silane coupling agent is selected from at least one of (3-mercaptopropyl)triethoxysilane, mercaptopropylmethyldimethoxysilane and (3-mercaptopropyl)trimethoxysilane; The volume percentage concentration of the silane coupling agent solution is 1%-20%; The reaction time is 2h-24h; The reaction temperature is 20°C-60°C.

7. The method according to claim 5, characterized in that: The 5'-end modified single-stranded oligo is combined with the functionally modified biochip by spotting; The spotting concentration of the 5'-end modified single-stranded oligo is 1-10 μmol / L; The spotting volume of the 5'-end modified single-stranded oligo is 1-5 μL; The time for the 5'-end modified single-stranded oligo to combine with the functionally modified biochip is 6 h to 24 h; The temperature for combining the 5'-end modified single-stranded oligo with the functionally modified biochip is 20° C.-60° C., and the ambient humidity is 70%-80%.

8. The method according to claim 5, characterized in that: The preparation method further comprises the step of cleaning the glass slide before treating the glass slide with plasma; The cleaning step comprises the following steps: placing the glass slide in an organic solvent for cleaning, then soaking the glass slide in a glass cleaning agent for ultrasonic treatment, and drying.

9. The method according to claim 5, characterized in that: The method for recycling the stationary phase of the biochip comprises the following steps: The used biochip stationary phase is immersed in a reducing agent for reaction, and then the 5'-end modified single-chain oligo is combined with the biochip stationary phase treated with the reducing agent to achieve the recycling of the biochip stationary phase.

10. The method according to claim 9, characterized in that: The reducing agent is at least one of tris(2-carboxyethyl)phosphine, dithiothreitol, mercaptoethanol and disulfide erythritol; The solution concentration of the reducing agent is 10 mM-2 M; The reaction temperature is 20° C.-80° C., and the reaction time is 0.5 h-6 h.

11. The method according to claim 9, wherein: The 5'-end modified single-stranded oligo is combined with the functionally modified biochip by spotting; The spotting concentration of the 5'-end modified single-stranded oligo is 1-10 μmol / L; The spotting volume of the 5'-end modified single-stranded oligo is 1-5 μL; The time for the 5'-end modified single-stranded oligo to combine with the functionally modified biochip is 6-24 hours; The temperature for combining the 5'-end modified single-stranded oligo with the functionally modified biochip is 20° C.-60° C., and the ambient humidity is 70%-80%.

Citation Information

Patent Citations

  • Regeneration method of silicon nanowire biosensor and regenerated silicon nanowire biosensor

    CN113607777A

  • Preparation method and application of substrate with high-density reaction sites

    CN116446055A