Engineering bacteria for high-yield production of beta-alanine by using covert plasmid as expression vector and double-carbon-source fermentation method

Abstract

The invention discloses a high-yield beta-alanine engineering bacterium taking a covert plasmid as an expression vector and a double-carbon-source fermentation method. According to the engineering bacterium, one or more of a pckA gene, a lacI gene, an asnA gene, a ygeA gene, a gldA gene, an nadB gene and a dhaK gene in a chassis bacterium genome are knocked out; and / or is constructed by overexpressing one or more of a glpF gene, a glpD gene, a yddG gene, a ydcZ gene, a rocG gene and a glnA gene; the yddG gene, the ydcZ gene and the rocG gene are subjected to overexpression by adopting a high-copy covert plasmid pMUT1. According to the method, glucose and glycerol are used as carbon sources, the yield of the engineering bacteria beta-alanine is increased to about 3 times of the original yield, the adding cost of an inducer in the fermentation process is reduced, and the fermentation production process is safe and free of pollution.

Description

(I) Technical field

[0001] The invention relates to an engineering bacterium with high beta-alanine production using a cryptic plasmid as an expression vector and a dual-carbon source fermentation method. (II) Background technology

[0002] Escherichia coli Nissle 1917 (EcN) is a Gram-negative probiotic that can prevent pathogen infection by strengthening the intestinal mucosal barrier and stimulating the immune system, and can be used to prevent and treat gastrointestinal dysfunction and immune diseases. In addition, EcN has the characteristics of rapid growth and is considered to be an ideal platform for producing metabolites, suitable for industrial production and fermentation.

[0003] At present, there are relatively few studies on the development of E. coli EcN as a chassis cell. The metabolic pathway of EcN in producing β-alanine is different from that of other chassis strains, which increases the difficulty of research. In addition, as a probiotic, EcN does not produce virulence factors. This characteristic enables the engineered strains constructed by it to be directly applied to livestock feed and used as nutritional additives. Preliminary experiments showed that EcN has a fast growth rate and its OD 600 The value is higher than that of other E. coli strains, and it shows extremely high tolerance to β-alanine. These characteristics further highlight the development potential of EcN as a chassis cell. Finally, the wild-type EcN contains two cryptic plasmids, pMUT1 and pMUT2. The plasmid-free EcN with these two cryptic plasmids removed is the first choice for constructing metabolic engineering strains, mainly because the cryptic plasmid is more compatible than other plasmids, thereby reducing the burden on cells. Therefore, the development of plasmid-free strains can promote the further application of EcN.

[0004] β-Alanine is the only β-amino acid in nature and exists in some plants and bacteria. It is also needed for the physiological functions and metabolism of animals. It is the limiting amino acid for the synthesis of endogenous imidazole dipeptides in humans and mammals. It has the effects of increasing the content of imidazole dipeptides in muscles, improving antioxidant capacity and anti-fatigue. β-Alanine can improve animal production performance, regulate muscle growth and the content of myogenic active peptides, improve meat quality, and can also be used to synthesize pantothenic acid, calcium pantothenate, carnosine, sodium pamidronate and balsalazide, as well as in electroplating, lead poisoning antidotes, synthetic sweeteners, synthetic flocculants, etc. Traditionally, the production of β-alanine by fermentation is mainly based on glucose as a carbon source. As a six-carbon carbon source, glucose has a longer metabolic pathway for the production of β-alanine as a three-carbon compound, with a larger carbon flux loss and a low conversion rate. As a three-carbon carbon source, glycerol has a shorter metabolic pathway for the production of β-alanine, a lower carbon flux loss rate, and a higher conversion rate. Combining glycerol and glucose as dual carbon sources can combine the advantages of both: glucose can provide abundant energy and intermediate metabolites, promoting the growth and metabolic activities of microorganisms; while glycerol can be more effectively converted into β-alanine, improving the utilization rate of carbon sources and the conversion rate of products. This dual carbon source fermentation method is expected to further optimize the fermentation process and make the industrial production of β-alanine more efficient and economical. (III) Summary of the invention

[0005] The purpose of the present invention is to provide an engineering bacterium and a dual-carbon source fermentation method for high-yield β-alanine using a cryptic plasmid as an expression vector. The present invention adopts a method for regulating the upstream metabolic module of glycerol, regulating the L-aspartic acid byproduct module, the L-glutamic acid module, and the β-alanine efflux protein screening module, and constructs a β-alanine high-yield bacterium using a cryptic plasmid as an expression vector of a key enzyme gene. Finally, by optimizing the culture medium, using glucose as the main carbon source and glycerol as an auxiliary carbon source for fermentation production, the ability of EcN to produce β-alanine is improved. The engineering bacteria not only have a strong tolerance to high concentrations of β-alanine, but also achieve high yields of β-alanine by optimizing the culture medium formula and other methods. The engineering bacteria can be safely used for microbial fermentation to prepare β-alanine, and the fermentation broth can also be used as a probiotic nutrient for animal breeding to improve the quality of animal meat.

[0006] The technical solution adopted by the present invention is:

[0007] The present invention provides an engineering bacterium with high beta-alanine production using a cryptic plasmid as an expression vector. The engineering bacterium is an E.coli Nissle1917ΔcycAΔfumB1ΔaspCΔpyk / pGLO-P J23100 -panD K43Y -aspB / pSU19-P J23100-ppC-aspA is a chassis bacterium (denoted as EcN-6, disclosed in patent application CN115927142A), which is constructed by knocking out one or more of the pckA gene, lacI gene, asnA gene, ygeA gene, gldA gene, nadB gene, and dhaK gene in the genome, and / or overexpressing one or more of the glpF gene, glpD gene, yddG gene, ydcZ gene, rocG gene, and glnA gene; the yddG gene, ydcZ gene, and rocG gene are overexpressed using the high-copy cryptic plasmid pMUT1.

[0008] Preferably, the yddG gene, ydcZ gene, and rocG gene adopt promoter P J23100 Expression, the promoter P J23100 The nucleotide sequence is the same as that of patent application CN115927142A. The glpF gene, glpD gene and glnA gene adopt promoter P tac Expression, the promoter P tac The nucleotide sequence is shown in SEQ ID NO.1.

[0009] Preferably, the glpF gene, glpD gene and glnA gene are overexpressed using the medium copy plasmid pSU19 (constructed with reference to Hu, S et al. Appl Microbiol Biotechnol 107, 2277–2288 (2023)).

[0010] Preferably, the nucleotide sequence of the yddG gene is shown in NZ_CP007799.1 (1667167-1668048) in NCBI, the nucleotide sequence of the ydcZ gene is shown in NZ_CP007799.1 (1636228-1636677) in NCBI, and the nucleotide sequence of the rocG gene is shown in CP147877.1 (3880740-3882014) in NCBI.

[0011] Preferably, the nucleotide sequence of the glpF gene is shown in NZ_CP007799.1 (4540078-4540923) in NCBI, the nucleotide sequence of the glpD gene is shown in NZ_CP007799.1 (3918024-3919529) in NCBI, and the nucleotide sequence of the glnA gene is shown in NZ_CP007799.1 (4483254-4484663) in NCBI.

[0012] Preferably, the nucleotide sequence of the pMUT1 plasmid is as shown in SEQ ID NO.2.

[0013] Preferably, the accession numbers of the pckA gene, lacI gene, asnA gene, ygeA gene, gldA gene, nadB gene and dhaK gene in Genbank are 915899, 914500, 915329, 916475, 915010, 914886 and 913158 respectively.

[0014] Preferably, the engineered bacteria is one of the following: (1) using EcN-6 as the base bacteria and knocking out the pckA gene in the genome, i.e., the engineered bacteria ECN-7.

[0015] (2) Based on the engineered bacteria ECN-7, the lacI gene in the genome was knocked out to produce the engineered bacteria ECN-8.

[0016] (3) Based on the engineered bacteria ECN-8, plasmid pSU19 and promoter P tac Overexpression of the glpF gene, namely the engineered bacterium ECN-9.

[0017] (4) Based on the engineered bacterium ECN-9, the asnA gene in the genome was knocked out, namely the engineered bacterium ECN-10.

[0018] (5) Based on the engineered bacteria ECN-10, the ygeA gene in the genome was knocked out, namely the engineered bacteria ECN-11.

[0019] (6) Based on the engineered bacteria ECN-11, plasmid pSU19 and promoter P tac Overexpression of the glpD gene, namely the engineered bacterium ECN-12.

[0020] (7) Based on the engineered bacterium ECN-12, the gldA gene in the genome was knocked out, namely the engineered bacterium ECN-13.

[0021] (8) Based on the engineered bacterium ECN-13, the nadB gene in the genome was knocked out, namely the engineered bacterium ECN-14.

[0022] (9) Based on the engineered bacteria ECN-14, the dhaK gene in the genome was knocked out, namely the engineered bacteria ECN-15.

[0023] (10) Based on the engineered bacteria ECN-15, plasmid pGLO and promoter P J23100 Overexpression of the ydcZ gene, namely the engineered bacterium ECN-16.

[0024] (11) Based on the engineered bacteria ECN-16, plasmid pGLO and promoter P J23100 Overexpression of the yddG gene, namely the engineered bacteria ECN-17.

[0025] (12) Based on the engineered bacteria ECN-17, plasmid pGLO and promoter P J23100 Overexpression of the rocG gene, i.e., the engineered bacterium ECN-18.

[0026] (13) Based on the engineered bacteria ECN-18, plasmid pSU19 and promoter P tac Overexpression of the glnA gene, namely the engineered bacterium ECN-19.

[0027] (14) Based on the engineered bacteria ECN-19, the pMUT1 plasmid was eliminated from the genome, and pMUT1 was used as a vector to replace the pGLO plasmid to overexpress the panD, aspB, yddG, ydcZ, and rocG genes, namely the engineered bacteria ECN-20.

[0028] The most preferred engineered bacterium ECN-20 for high β-alanine production of the present invention is constructed by the following method:

[0029] (1) The panD gene from Bacillus subtilis and P J23100 The promoter was cloned and connected to the linearized pGLO vector using the Clone ExpressⅡOne Step Cloning Kit to obtain pGLO-P J23100 -panD;

[0030] (2) The amino acid 43 encoded by the panD gene from Bacillus subtilis on the pGLO plasmid vector was mutated by PCR to obtain the plasmid pGLO-P that can express high enzyme activity of L-aspartate-α-decarboxylase. J23100 -panD K43Y ;

[0031] (3) Using the λ-RED recombination system, the cycA gene in the EcN genome was knocked out to obtain EcNΔcycA with enhanced tolerance to intracellular β-alanine concentration;

[0032] (4) Using the λ-RED recombination system, the fumB1 gene, aspC gene, and pyk gene in the EcNΔcycA genome were knocked out to obtain EcNΔcycAΔfumB1ΔaspCΔpyk;

[0033] (5) The aspA gene and P J23100 The promoter was connected to the pSU19 vector by one-step cloning to obtain pSU19-P J23100 -aspA;

[0034] (6) The ppC gene from the Corynebacterium glutamicum genome was amplified using primers and then cloned into pSU19-P J23100 -aspA was connected by one-step cloning to obtain pSU19-P J23100 -aspA-ppC;

[0035] (7) The fragment obtained by PCR from the aspB gene on the Corynebacterium glutamicum genome was fused to the vector pGLO-P J23100 -panD K43Y Through one-step cloning, pGLO-P J23100 -panD K43Y -aspB;

[0036] (8) Plasmid pSU19-P J23100 -P on aspA-ppC J23100 The promoter was replaced by P using PCR technology and one-step cloning. tac promoter, resulting in pSU19-P tac -aspA-ppC;

[0037] (9) The glpF gene and P tac The promoter was connected to the pSU19 vector by one-step cloning to obtain pSU19-P tac -aspA-ppC-glpF;

[0038] (10) Using the λ-RED recombination system, the lacI gene, pckA gene, asnA gene, and ygeA gene in the EcNΔcycAΔfumB1ΔaspCΔpyk genome were knocked out in sequence to obtain the EcNΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔasnAΔygeA strain;

[0039] (11) The glpD gene and P tac The promoter was connected to the pSU19 vector by one-step cloning to obtain pSU19-P tac -aspA-ppC-glpF-glpD;

[0040] (12) Using the λ-RED recombination system, the nadB gene, gldA gene, dhaK gene, and pMUT1 plasmid in the EcNΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔasnAΔygeA genome were knocked out in sequence to obtain EcNΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔasnAΔygeAΔnadBΔgldAΔdhaKΔpMUT1;

[0041] (13) The fragment obtained by PCR from the ydcZ gene on the EcN genome was fused to the vector pGLO-P J23100 -panD K43Y -aspB was connected by one-step cloning to obtain pGLO-P J23100 -panD K43Y -aspB-ydcZ;

[0042] (14) The fragment obtained by PCR from the yddG gene on the EcN genome was fused to the vector pGLO-P J23100 -panD K43Y -aspB-ydcZ was connected by one-step cloning to obtain pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG;

[0043] (15) The fragment obtained by PCR from the rocG gene on the Bacillus subtilis genome was fused to the vector pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG were connected by one-step cloning to obtain pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG-rocG;

[0044] (16) The glnA gene from the EcN genome and the P tac The promoter was connected to the pSU19 vector by one-step cloning to obtain pSU19-P tac -aspA-ppC-glpF-glpD-glnA;

[0045] (17) Plasmid pGLO-P J23100 -panD K43Y The fragment obtained by PCR was connected with the vector pMUT1 by one-step cloning to obtain pMUT1-P J23100 -panD K43Y-aspB-ydcZ-yddG-rocG;

[0046] (18) Plasmid pMUT1-P J23100 -panD K43Y -aspB-ydcZ-yddG-rocG and plasmid pSU19-P tac -aspA-ppC-glpF-glpD-glnA was transferred into EcNΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔasnAΔygeAΔnadBΔgldAΔdhaK In ΔpMUT1, the engineering strain EcNΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔasnAΔygeAΔnadBΔgldAΔdhaKΔpMUT1 / pMUT1-P J23100 -panD K43Y -aspB-ydcZ-yddG-rocG / pSU19-P tac -aspA-ppC-glp F-glpD-glnA, i.e. the engineered bacteria with high β-alanine production.

[0047] The present invention also provides a method for producing β-alanine by dual-carbon source fermentation using the high-yield β-alanine engineering bacteria, the method comprising:

[0048] The engineered bacteria are inoculated into a fermentation medium, and fermentation is carried out at 37° C. and 200 rpm to obtain a fermentation liquid containing β-alanine; the fermentation medium comprises: 8 g / L glucose, 2 g / L glycerol, 14 g / L K2HPO4·3H2O, 5.2 g / L KH2PO4, 0.3 g / L MgSO4, 1 g / L NH4Cl, 1 g / L tryptone, 2 g / L urea, 2 g / L glutamine, and 2 g / L ammonium succinate, the solvent is ddH2O, and the pH value is 7.0.

[0049] Preferably, the engineered bacteria are inoculated into a fermentation tank culture medium at a culture temperature of 37° C., a pH of 7.0, and a dissolved oxygen value of 20%; after fermentation for 8 hours, glucose is supplemented to 10-15 g / L through a feed medium every 2 hours according to the consumption of glucose, so that the residual sugar is controlled at 3-5 g / L until the fermentation is completed, and a fermentation liquid containing β-alanine is obtained, preferably the total fermentation time is 60 hours, and a total consumption of 1 L of the feed medium;

[0050] The fermentation tank medium composition: 20g / L glucose, K2HPO4·3H2O 28g / L, KH2PO4 10.4g / L, NH4Cl4g / L, MgSO4 0.6g / L, tryptone 2g / L, yeast powder 4g / L, succinylamine 2g / L, glutamine 2g / L, urea 5g / L, 1mL / L 10× metal ion, 1mL / L organic silica gel defoamer, the solvent is water; 10× metal ion formula: 10g CaCl2, 10gFeSO4·7H2O, 1g ZnSO4·7H2O, 0.2g CuSO4 and 0.02g NiCl2·7H2O dissolved in 100mL ddH2O;

[0051] The composition of feed medium: glucose 400g / L, glycerol 200g / L, yeast extract 4g / L, KH2PO4 14g / L, (NH4)2SO4 30g / L, MgSO4 0.6g / L, succinylamine 6g / L, glutamine 6g / L, defoamer 1mL / L, the defoamer is organic silica gel defoamer, and the solvent is water.

[0052] Preferably, the engineered bacteria are first activated on a slant and cultured for seed expansion before fermentation, and then the seed solution is inoculated into a fermentation medium or a fermenter medium at an inoculation volume concentration of 2-5%. The seed solution culture method is:

[0053] (1) The engineered bacteria were inoculated on an LB plate containing 0.1 mg / mL ampicillin resistance and cultured in a 37°C incubator overnight; the LB plate medium included 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, and 2 g / L agar, the solvent was water, and the pH value was natural;

[0054] (2) Pick a single colony from step (1) and inoculate it into LB liquid culture medium, and culture it in a 37°C incubator at 220 rpm overnight to obtain a seed solution.

[0055] The present invention firstly transforms EcN-6, and in order to enhance the utilization rate of glycerol in the culture medium by EcN, the glpF gene, glpD gene and glnA gene on the EcN genome are inserted into the medium copy plasmid pSU19 and then transformed into P tac In order to further expand the L-aspartate pool, the asnA, nadB, and ygeA genes on the EcN genome were knocked out to block the flow of L-aspartate to the L-aspartate byproduct. Since the production of L-aspartate requires a large amount of NH4 + and L-glutamate and NADPH to maintain intracellular NH 4+The amount of L-glutamate and NADPH was measured by PCR. The rocG gene on the Bacillus subtilis genome was cloned into a high-copy plasmid pMUT1 and then used to J23100 The strong promoter was used for transcription. A protein with the transport function of β-alanine was screened out from the DMT family transport proteins and expressed by the ydcZ and yddG genes. The ydcZ and yddG genes on the EcN genome were inserted into the high-copy plasmid pMUT1 and expressed by P J23100 The strong promoter is used for transcription. Then, in order to further reduce the consumption of phosphoenolpyruvate, the pckA, gldA, and dhaK genes on the EcN genome are knocked out to prevent glycerol from participating in the glycerol microaerobic pathway and consuming phosphoenolpyruvate, so that more phosphoenolpyruvate flows to oxaloacetate. Finally, the lacI gene on the EcN genome is knocked out to reduce the fermentation cost.

[0056] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in: first, the ability of the chassis bacteria EcN-6 used in the present invention to tolerate β-alanine during the fermentation production process is higher than that of other conventional Escherichia coli strains, and the tolerance of the constructed EcN-20 to β-alanine is further improved, which is better than the EcN-6 chassis bacteria; second, the present invention transforms the upstream pathway of glycerol, increases the utilization rate of glycerol and reduces the consumption of phosphoenolpyruvate, and further enhances the supply of β-alanine precursor L-aspartic acid through metabolic engineering transformation of asnA gene, nadB gene and ygeA gene, thereby increasing the production of β-alanine. Third, the present invention screens out two proteins with transport function for β-alanine by screening DMT family transport proteins, which are encoded by ydcZ gene and yddG gene respectively, and overexpresses ydcZ gene and yddG gene on pMUT1 plasmid, which can significantly increase the production of β-alanine. Fourth, the present invention improves NADPH and NH4 by optimizing the cycle of α-ketoglutarate, L-glutamate, and L-glutamine. + The supply of L-aspartate aminotransferase is enhanced to increase the L-aspartate pool, thereby increasing the β-alanine production. Fifth, the present invention increases the β-alanine production to about 3 times the original production by adding glutamine, succinamine and fumaric acid to the culture medium, and by knocking out the lacI gene in the genome, the cost of adding the inducer (IPTG) in the fermentation process is reduced, and a small-scale fermentation production process for β-alanine production bacteria is established; Sixth, the present invention uses probiotic engineering bacteria to ferment and produce β-alanine, and the fermentation production process is safe and pollution-free. The fermentation broth can not only be used to prepare industrial and food-grade β-alanine chemical raw materials, but also can be directly used for animal breeding. (IV) Description of the drawings

[0057] Figure 1 This is the metabolic pathway diagram for the synthesis of β-alanine in Escherichia coli EcN.

[0058] Figure 2 This is the electrophoresis diagram of the colony PCR detection of the E. coli EcNΔcycAΔfumB1ΔaspCΔpyk strain with the pckA gene knocked out in Example 1; lane 1 represents 5K Marker, lane 12 represents EcN, and lanes 2-11 represent the pckA gene knockout strain.

[0059] Figure 3 This is a comparison of the biomass and β-alanine production of the engineered bacteria EcN-7 and EcN-6 strains in Example 1. The two-tailed t-test was used for statistics (*P<0.05; **P<0.01).

[0060] Figure 4 This is the electrophoresis diagram of colony PCR detection after the lacI gene of the engineered bacteria EcNΔcycAΔfumB1ΔaspCΔpykΔpckA strain in Example 2 was knocked out and the resistance was eliminated; lane 1 represents 5K Marker, lane 2 represents EcN, and lanes 3-5 represent the lacI gene knockout strain.

[0061] Figure 5 This is a comparison of the biomass and β-alanine production of the engineered bacteria EcN-7 and EcN-8 strains in Example 2. The two-tailed t-test was used for statistics (*P<0.05; **P<0.01).

[0062] Figure 6 pSU19-P tac -aspA-ppC-glpF-glpD recombinant vector construction process and map.

[0063] Figure 7 The graph shows the biomass and β-alanine production of the engineered bacteria EcN-9 and EcN-8 in Example 3. The two-tailed t-test was used for statistics (*P<0.05; **P<0.01).

[0064] Figure 8 This is the electrophoresis diagram of colony PCR detection after the asnA gene was knocked out and the resistance was eliminated in the engineered bacteria EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacI strain in Example 4; lane 1 represents EcN, lanes 2-3 represent the asnA gene knockout strain, and lane 4 represents 5KMarker.

[0065] Fig. 9 The graph shows the biomass and β-alanine production of the engineered bacteria EcN-10 and EcN-9 in Example 4. The two-tailed t-test was used for statistics (*P<0.05; **P<0.01).

[0066] Fig.10 This is the electrophoresis diagram of colony PCR detection after the ygeA gene was knocked out and the resistance was eliminated in the engineered bacteria EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnA strain in Example 5; lane 1 represents EcN, lanes 2-11 represent the ygeA gene knockout strain, and lane 12 represents 5K Marker.

[0067] Fig.11 The graph shows the biomass and β-alanine production of the engineered bacteria EcN-11 and EcN-10 in Example 5. The two-tailed t-test was used for statistics (*P<0.05; **P<0.01).

[0068] Fig.12 The graph shows the biomass and β-alanine production of the engineered bacteria EcN-12 and EcN-11 in Example 6. The two-tailed t-test was used for statistics (*P<0.05; **P<0.01).

[0069] Fig.13 This is the electrophoresis diagram of the colony PCR detection of the gldA gene knocked out of the engineered bacteria EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeA strain in Example 7; lane 4 represents 5K Marker, lanes 2-3 represent the gldA gene knockout strain, and lane 1 represents EcN.

[0070] Fig.14 The electrophoresis diagrams and biomass and β-alanine production diagrams of the construction process of the engineered bacteria EcN-12 and EcN-13 in Example 7 are shown; the two-tailed t-test was used for statistics (*P<0.05; **P<0.01).

[0071] Fig.15 This is the electrophoresis diagram of the colony PCR detection of the engineered bacteria EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldA strain in Example 8 in which the nadB gene was knocked out; lane 1 represents 5K Marker, lanes 2-7 represent nadB gene knockout strains, and lane 8 represents EcN.

[0072] Fig.16 The graph shows the biomass and β-alanine production of the engineered bacteria EcN-14 and EcN-13 in Example 8. The two-tailed t-test was used for statistics (*P<0.05; **P<0.01).

[0073] Fig.17This is the electrophoresis diagram of the colony PCR detection of the engineered bacteria EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadB strain knocked out the dhaK gene in Example 9; lane 1 represents 5K Marker, lane 2 represents EcN, and lanes 3-5 represent dhaK gene knockout strains.

[0074] Fig.18 The graph shows the biomass and β-alanine production of the engineered bacteria EcN-15 and EcN-14 in Example 9. The two-tailed t-test was used for statistics (*P<0.05; **P<0.01).

[0075] Fig.19 pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG recombinant vector construction process and map.

[0076] Fig. 20 The graphs are for biomass and β-alanine production of the engineered bacteria EcN-15, EcN-16, and EcN-17 in Example 10. The two-tailed t-test was used for statistics (*P<0.05; **P<0.01).

[0077] Fig.21 pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG-rocG recombinant vector construction process and map.

[0078] Fig. 22 pSU19-P tac -aspA-ppC-glpF-glpD-glnA recombinant vector construction process and map.

[0079] Fig.23 The graph shows the biomass and β-alanine production of the engineered bacteria EcN-17, EcN-18, and EcN-19 in Example 12. The two-tailed t-test was used for statistics (*P<0.05; **P<0.01).

[0080] Fig.24 The elimination site and plasmid map of the pMUT1 plasmid were constructed for the engineered bacteria EcN-20 in Example 13.

[0081] Fig.25 The graph shows the biomass and β-alanine production of the engineered bacteria EcN-20 and EcN-19 in Example 14. The two-tailed t-test was used for statistics (*P<0.05; **P<0.01).

[0082] Fig.26The biomass and β-alanine yield of the chassis bacteria EcN-6 and the engineered bacteria EcN-20 in the shake flask fermentation medium in Example 15. The two-tailed t-test was used for statistics (*P<0.05; **P<0.01).

[0083] Fig. 27 The biomass and β-alanine yield of the engineered bacteria EcN-20 fermented with different carbon sources in Example 15.

[0084] Fig.28 The biomass and β-alanine yield of the engineered bacteria EcN-20 fermented with different nitrogen sources in Example 15.

[0085] Fig.29 HPLC chromatograms of β-alanine standards at different concentrations.

[0086] Fig.30 This is a high performance liquid chromatogram of the culture broth of the engineered bacteria EcN-20 in Example 15 in the optimized fermentation medium.

[0087] Fig.31 The biomass and β-alanine yield of the chassis bacteria EcN-6 and the engineered bacteria EcN-20 in Example 15 in the optimized fermentation medium.

[0088] Fig.32 The biomass and β-alanine yield of the engineered bacteria EcN-20 in Example 16 in a 5 L fermenter without glycerol. The two-tailed t-test was used for statistics (*P<0.05; **P<0.01).

[0089] Fig.33 The biomass and β-alanine yield of the engineered bacteria EcN-20 in Example 16 under the condition of adding glycerol to the fermentation medium in a 5 L fermenter. The two-tailed t-test was used for statistics (*P<0.05; **P<0.01). (V) Specific implementation methods

[0090] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0091] The experimental methods in the examples are conventional methods unless otherwise specified. The experimental materials used in the examples are conventional biochemical reagents unless otherwise specified.

[0092] The E. coli Nissle 1917 (EcN) strain used in the present invention was purchased from Hangzhou Fenghai Biotechnology Co., Ltd., and the strain was identified by Zhejiang Tianke High-tech Development Co., Ltd.

[0093] The pMUT1 plasmid used in the present invention was purchased from the addgene website.

[0094] E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk / pGLO-P J23100 -panD K43Y -aspB / pSU19-P J23100 -ppC-aspA, disclosed in patent application CN115927142A, denoted as EcN-6.

[0095] LB liquid culture medium composition: peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L, ddH2O, pH natural; LB plate culture medium is LB liquid culture medium with agar added to a final concentration of 2g / L.

[0096] The composition of the basic salt M9 medium is as follows: glucose 10 g / L, K2HPO4·3H2O 14 g / L, KH2PO4 5.2 g / L, (NH4)2SO4 2 g / L, MgSO4 0.3 g / L, trypsin 1 g / L, the solvent is ddH2O, and the pH value is 7.0.

[0097] Example 1: Knockout of the pckA gene in the EcN-6

[0098] In order to make more oxaloacetate flow to L-aspartate, the λ-RED recombination system was used to transform E. coli Nissle1917ΔcycAΔfumB1ΔaspCΔpyk / pGLO-P J23100 -panD K43Y -aspB / pSU19-P J23100 -ppC-aspA strain, the gene pckA related to oxaloacetate complementation of PEP was knocked out, the metabolic pathway of phosphoenolpyruvate to oxaloacetate was enhanced, and the β-alanine-producing engineered strain EcN-7 with enhanced phosphoenolpyruvate to oxaloacetate pathway was constructed. The specific steps are as follows:

[0099] (1) Using the EcN genome as a template, PCR amplification was performed using primers pckA-UP-F, primer pckA-UP-R, primer pckA-down-F, and primer pckA-down-R, respectively, to obtain fragments of the upstream and downstream homologous arms of the target gene pckA. The nucleotide sequences are shown in NCBI NZ_CP007799.1 (3887355-3888331) and NZ_CP007799.1 (3889955-3890958).

[0100] (2) Resistance fragment amplification: Using pKD4 plasmid (gift from Kirill A. Datsenko & Barry L. Wanner) as a template and primers pckA-Kan-F and pckA-Kan-R in Table 1, PCR was performed to amplify the kanamycin resistance fragment with FRT site on the pKD4 plasmid. The nucleotide sequence is shown in NCBI AY048743.1 (25-1540), where 27-60 bp and 1420-1453 bp are FRT sites; 435-1229 bp are Kan resistance nucleotide sequences.

[0101] (3) Preparation of Donor DNA: Primers pckA-UP-F and primer pckA-down-R were used to connect the Kan resistance fragment with FRT site in step (2) and the upstream and downstream homologous arms in step (1) to obtain the Kan resistance gene fragment containing the upstream and downstream homologous arms, i.e., Donor DNA.

[0102] (4) Competent cells: The pKD46 plasmid (gift from Kirill A. Datsenko & Barry L. Wanner) was transformed into E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk by electroporation to obtain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk containing the pKD46 plasmid. The cells were inoculated into LB medium containing 0.1 mg / mL ampicillin and 30 mM L-arabinose and cultured at 30°C and 220 rpm until the OD 600 When the concentration reached 0.6, the bacterial solution was centrifuged at 9000 rpm for 5 min, and the precipitate was washed four times with sterile distilled water to obtain competent cells.

[0103] (5) Strains with knockout of target gene: Electrotransform the Donor DNA fragment from step (3) into competent cells from step (4) at 1.8KV, incubate the electrotransformed bacterial solution at 30°C for 2h, centrifuge at 9000rpm for 1min per 1mL of bacterial solution, discard 900μL of supernatant, take 50μL of the precipitate and spread it on an LB plate containing 0.05mg / mL kanamycin and 0.1mg / mL ampicillin resistance, and culture at 30°C overnight. Pick a single colony as a template and perform PCR with primers pckA-detect-F and primer Kan-R-detect. Under the same conditions, agarose gel electrophoresis analysis was performed with EcN as the control. The results are as follows: Figure 2 As shown. The presence of DNA bands in the knockout strain in 1.0% agarose gel and the absence of bands in EcN confirmed the deletion of the pckA gene. The strains with knockout of cycA, fumB1, aspC, pyk, and pckA were screened and obtained.

[0104] (6) Elimination of plasmid: The strain from step (5) was inoculated into LB liquid medium containing 0.05 mg / mL kanamycin resistance, and cultured at 37°C for 12 h to eliminate pKD46, and then inoculated into LB plates containing 0.05 mg / mL kanamycin resistance and LB plates containing 0.1 mg / mL ampicillin and 0.05 mg / mL kanamycin resistance, respectively, and cultured at 37°C for 12 h to screen for knockout strains that eliminated the pKD46 plasmid. Competent cells were prepared according to the method of step (4).

[0105] (7) Elimination of resistance: The pCP20 (DATSENKO K A. Proceedings of the National Academy of Sciences, 2000, 97 (12): 6640-5.) plasmid was introduced into the competent medium of step (6), and the transformants were screened for 12 h on an LB plate containing 0.025 mg / mL chloramphenicol resistance at 30°C. The transformants were cultured in an LB liquid medium containing 0.025 mg / mL chloramphenicol resistance at 37°C for 12 h to eliminate the kanamycin resistance on the genome; the cultured bacterial solution was diluted 10 4 Spread on LB plate containing 0.025mg / mL chloramphenicol resistance and culture at 30℃ for 12h. The obtained single colony was first streaked on LB plate containing 0.05mg / mL kanamycin resistance and 0.025mg / mL chloramphenicol resistance double resistance, and cultured at 30℃ for 12h; pick the double resistance plate colony and continue to streak on LB plate containing 0.025mg / mL chloramphenicol resistance, and culture at 30℃ for 12h. Pick the colonies that do not grow on the double resistance but grow on the single resistance and use primers pckA-UP-F and primers pckA-down-R for colony PCR. Under the same conditions, agarose gel electrophoresis analysis was performed separately with EcN as the control. It was observed that the DNA bands present in the knockout strain in 1.0% agarose gel are just the size of the target gene pckA compared to the wild type, which means that the kanamycin resistance on the EcN genome is eliminated.

[0106] (8) Elimination of pCP20 plasmid: The colonies that did not grow on the dual-antibody but grew on the monoclonal antibody in step (7) were inoculated onto LB plates containing 0.025 mg / mL chloramphenicol resistance and LB plates without 0.025 mg / mL chloramphenicol resistance, respectively, and cultured at 37°C for 12 h. The knockout strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckA that did not grow on the LB plate containing 0.025 mg / mL chloramphenicol resistance but grew on the LB plate without chloramphenicol resistance was selected. The recombinant plasmid pGLO-P J23100 -panD K43Y -aspB and pSU19-P tac-aspA-ppC was introduced into EcNΔcycAΔfumB1ΔaspCΔpykΔpckA to obtain the engineering strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckA / pGLO-P J23100 -panD K43Y -aspB / pSU19-P J23100 -aspA-ppC, denoted as engineered bacteria EcN-7.

[0107] (9) Determination of biomass and β-alanine production

[0108] EcN-6 and EcN-7 were streaked onto LB plates and cultured overnight in a 37°C incubator. A single colony was picked and inoculated into 5 mL of LB liquid culture medium and cultured overnight at 200 rpm in a 37°C incubator to obtain seed solution. 1 mL of seed solution was inoculated into a 250 mL shake flask with 50 mL of basic salt M9 medium. The shake flask was then cultured at 200 rpm in a 37°C incubator for 24 hours. 1 mL of liquid was taken from the shake flask to measure the OD 600 .

[0109] At the same time, 1 mL of liquid was taken from the shake flask, centrifuged at 9000 rpm for 1 min, the supernatant was taken, and it was derivatized. After filtering with an organic membrane with a pore size of 45 μm, the filtrate was analyzed by HPLC for the content of β-alanine in the fermentation broth. The results are shown in Figure 3 shown.

[0110] HPLC detection conditions: Wanyi high performance liquid chromatography instrument; chromatographic column: XB-C18 chromatographic column (250mm×4.6nm); mobile phase is methanol: 0.05mol / L acetic acid-sodium acetate buffer solution (55:45, V / V); flow rate: 1.0mL / min; column temperature is room temperature.

[0111] Derivatization of samples: Take 100 μL of sample, add 100 μL of 0.5 mol / L NaHCO3 aqueous solution and 0.1 mL of 1% 2,4-dinitrofluorobenzene in acetonitrile solution, react at 60°C in the dark for 2 h, then add 700 μL of 0.2 mol / L pH 7 phosphate buffer.

[0112] The results showed that blocking oxaloacetate to replenish PEP can increase the production of β-alanine. Compared with the EcN-6 strain, the yield increased by 1.2 times to 1.2 g / L.

[0113] Table 1: Primer sequences

[0114] pckA-detect-F CCAGTCTTTCGCCATCCA pckA-UP-F TTAAACGTGACTGTGTACGC pckA-UP-R GCTCCAGCCTACACAATCGTTCACTGCTCCTTAGCCAAT pckA-down-F TCCCATGTCAGCCGTTAAGTAGCTGATATCTCATTGACCCC pckA-down-R CAGCGTAAGCACCTGTTC pckA-Kan-F ATTGGCTAAGGAGCAGTGAACGATTGTGTAGGCTGGAGC pckA-Kan-R GGGGTCAATGAGATATCAGCTACTTAACGGCTGACATGGGA

[0115] Example 2: Knockout of the lacI gene in the engineered bacterium EcN-7

[0116] In order to relieve P tac In order to inhibit the promoter and reduce the cost of adding inducers during fermentation, the λ-RED recombination system was used to regenerate EcNΔcycAΔfumB1ΔaspCΔpykΔpckA / pGLO-P J23100 -panD K43Y -aspB / pSU19-P J23100 The repressor protein gene lacI encoded by the lactose operon in the -ppC-aspA strain was knocked out to construct an economical and suitable β-alanine-producing engineered strain EcN-8. The specific steps are as follows:

[0117] Using the EcN genome as a template, PCR amplification was performed using primers lacI-UP-F, primer lacI-UP-R, primer lacI-down-F, and primer lacI-down-R, respectively, to obtain fragments of the upstream and downstream homology arms of the target gene lacI. The nucleotide sequences are shown in NZ_CP007799.1 (452324-453322) and NZ_CP007799.1 (450086-451239) in NCBI;

[0118] As in Example 1, the kanamycin resistance fragment with FRT site was obtained by pKD4 plasmid, and DonorDNA was prepared. After obtaining the target strain, pKD46 plasmid was eliminated and pCP20 plasmid was used to eliminate the kanamycin resistance gene. The electrophoresis diagram is shown in Figure 4 Finally, the pCP20 plasmid was successfully eliminated, and the final non-resistant target strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacI / pGLO-P was obtained. J23100 -panD K43Y -aspB / pSU19-P tac -aspA-ppC, denoted as engineered bacteria EcN-8.

[0119] The biomass and β-alanine production of the engineered bacteria EcN-8 were determined using the method of Example 1. The results are as follows: Figure 5 The results showed that knocking out the repressor protein gene lacI did not affect the yield compared with the EcN-7 strain.

[0120] Table 2: Primer sequences

[0121] lacI-detect-F TGCCGGGTTTTACCTGAAC lacI-UP-F GTACCACGCCAATAAACTGA lacI-UP-R TACACAATCGCTCAAATTCACCACCCTGAATTGAC lacI-down-F CCATGGCTAATTCCCGAGCGCAACACAATTAATGT lacI-down-R AGCAGCAGACCATTTTCAAT lacI-Kan-F TTGAGCGATTGTGTAGGCTG lacI-Kan-R GGGAATTAGCCATGGTCCAT

[0122] Example 3: Construction of a recombinant plasmid expressing a gene encoding a protein that promotes glycerol uptake (glpF) and the corresponding engineered bacteria EcN-9.

[0123] (1) Using the EcN genome as a template, PCR amplification was performed using primers glpF-F and glpF-R in Table 3. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI. The PCR product fragment was purified to obtain the target gene glpF fragment (the nucleotide sequence is shown in NZ_CP007799.1 (4540078-4540923) in NCBI). The pSU19-P J23100 -P in ppC-aspA J23100 P tac Promoter (nucleotide sequence is shown in SEQ ID NO.1).

[0124] (2) pSU19-P tac -aspA-ppC vector was used as a template, and PCR amplification was performed using primers pSU19-vector-R and primers pSU19-vector-F in Table 3. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI. The PCR product fragment was purified to obtain pSU19-P tac -aspA-ppC linearized vector.

[0125] (3) Use a one-step cloning kit to clone pSU19-P tac -aspA-ppC linearized vector was connected with the target gene glpF fragment to obtain the cloned recombinant plasmid pSU19-P tac -aspA-ppC-glpF (construction process and map see Figure 6 ). The plasmid was confirmed to be correct after sequencing.

[0126] (4) The recombinant plasmid pSU19-P tac -aspA-ppC-glpF was introduced into the strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacI, and the strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacI / pGLO-P was obtained by the method of Example 1. J23100 -panD K43Y -aspB / pSU19-P tac -aspA-ppC-glpF, denoted as engineered bacteria EcN-9.

[0127] The method of Example 1 was used to detect the biomass and β-alanine production of the engineered bacteria EcN-9 and EcN-8. The results are as follows: Figure 7 The results showed that enhancing the PEP to OAA pathway could further increase the production of β-alanine, which was 1.33 times higher than that of the EcN-8 strain, reaching 1.60 g / L in 72 hours.

[0128] SEQ ID NO.1P tac Promoter sequence: TTGACAATTAATCATCGGCTCGTATAATG

[0129] Table 3: Primer sequences

[0130] glpF-F CGTTCATTTTCGCCAAAAGTTACAGCGAAGCTTTTTGTTC glpF-R TTTGTTTAACTTTAAGAAGGAGAATGAGTCAAACATCAACCTTGAA TH-tac-F TTGACAATTAATCATCGGCTCGTATAATGACAGGAAACAGCTATGACAT TH-tac-R CATTATACGAGCCGATGATTAATTGTCAATTCCTGGAAGATGCCAGGAA pSU19-vector-R TCTCCTTCTTAAAGTTAAACAAAGGTATCAACAGGGACACCA pSU19-Vector-F CTTTTGGCGAAAATGAGACG glpF-JC CAATTTTTGTGCAGGCTTTCG

[0131] Example 4: Knockout of the asnA gene in the engineered bacterium EcN-9

[0132] In order to reduce the consumption of L-aspartate and enhance the L-aspartate pool of the engineered bacterium EcN-9, the EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacI / pGLO-P was constructed by the λ-RED recombination system. J23100 -panD K43Y -aspB / pSU19-P tac The L-asparagine synthetase encoding gene asnA in the -aspA-ppC-glpF strain was knocked out to reduce the consumption of L-aspartate to produce L-asparagine, and to construct the β-alanine-producing engineered strain EcN-10 that enhances the L-aspartate to β-alanine pathway. The specific steps are as follows:

[0133] (1) Using the EcN genome as a template, PCR amplification was performed using primers asnA-UP-F, asnA-UP-R, asnA-down-F, and asnA-down-R to obtain the fragments of the upstream and downstream homologous arms of the target gene asnA. The nucleotide sequences are shown in NZ_CP007799.1 (4322989-4323934) and NZ_CP007799.1 (4324842-4325836) in NCBI;

[0134] As in Example 1, the kanamycin resistance fragment with FRT site was obtained by pKD4 plasmid, and DonorDNA was prepared. After obtaining the target strain, pKD46 plasmid was eliminated and PCP20 plasmid was used to eliminate the kanamycin resistance gene. The electrophoresis diagram is shown in Figure 8 Finally, the PCP20 plasmid was successfully eliminated, and the final anti-resistant target strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnA was obtained.

[0135] Using the method of Example 1, the recombinant plasmid pGLO-P J23100 -panD K43Y -aspB and pSU19-P tac-aspA-ppC-glpF was introduced into EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnA to obtain the engineering strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnA / pGLO-P J23100 -panD K43Y -aspB / pSU19-P tac -aspA-ppC-glpF, denoted as engineered bacteria EcN-10.

[0136] The biomass and β-alanine production of the engineered bacteria EcN-10 and EcN-9 were measured using the method of Example 1. The results are as follows: Fig. 9 The results showed that knocking out the L-asparagine synthetase encoding gene asnA, reducing the consumption of L-aspartate, and constructing an enhanced L-aspartate to β-alanine pathway can increase the production of β-alanine. Compared with the EcN-9 strain, it increased by 1.05 times to 1.68g / L.

[0137] Table 4: Primer sequences

[0138] asnA-detect-F TGATGATGACGTCAAAAGGAT asnA-UP-F CTGCAATGCTTCATAGAAAGG asnA-UP-R GTTTGGCAATGTAAGCGG asnA-down-F CCAGGTTCAGTGTGGTGTA asnA-down-R GATAACAATACCGCAGCTG asnA-Kan-F AACCGCTTACATTGCCAAACGATTGTGTAGGCTGGAGC asnA-Kan-R TACACCACACTGAACCTGGTTAGCCATGGTCCATATGAAT

[0139] Example 5: Knockout of the ygeA gene in the engineered bacterium EcN-10

[0140] In order to make the engineered bacteria EcN-10 reduce more L-aspartate and L-glutamate into D-aspartate and D-glutamate, and accumulate L-aspartate and L-glutamate pools for the production of β-alanine, the EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnA / pGLO-P was transformed into EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnA / pGLO-P by the λ-RED recombination system. J23100 -panD K43Y -aspB / pSU19-P tac The specific amino acid racemase gene ygeA in the -aspA-ppC-glpF strain was knocked out to construct the β-alanine-producing engineered strain EcN-11 that blocks the L-aspartate and L-glutamate consumption pathways. The specific steps are as follows:

[0141] (1) Using the EcN genome as a template, PCR amplification was performed with primers ygeA-UP-F, ygeA-UP-R, ygeA-down-F, and ygeA-down-R to obtain fragments of the upstream and downstream homologous arms of the target gene ygeA. The nucleotide sequences are shown in NZ_CP007799.1 (3223294-3224270) and NZ_CP007799.1 (3224961-3226001) in NCBI.

[0142] As in Example 1, a kanamycin resistance fragment with an FRT site was obtained by using the pKD4 plasmid. The nucleotide sequence is shown in AY048742.1 (1733-2800) in NCBI and Donor DNA was prepared. After obtaining the target strain, the pKD46 plasmid was eliminated and the kanamycin resistance gene was eliminated using the PCP20 plasmid. The electrophoresis results were as follows: Figure 10 Finally, the PCP20 plasmid was successfully eliminated, and the final non-resistant target strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeA / pGLO-P was obtained. J23100 -pa nD K43Y -aspB / pSU19-P tac -aspA-ppC-glpF, denoted as engineered bacteria EcN-11.

[0143] The biomass and β-alanine production of the engineered bacteria EcN-11 and EcN-10 were measured using the method of Example 1. The results are as follows: Figure 11 The results showed that the specific amino acid racemase gene ygeA accumulated L-aspartate and L-glutamate pools for the production of β-alanine, which was 1.07 times higher than that of the EcN-11 strain, and the yield reached 1.92 g / L in 72 hours.

[0144] Table 5: Primer sequences

[0145] ygeA-detection-F ATATGGTGGTAACTACCGTACA ygeA-UP-F TGTCGAGTCTATGCAAAAATGAT ygeA-UP-R CTAATTCCCATGTCAGCCGCTGACGACAAAATAGCGTCA ygeA-down-F GCTCCAGCCTACACAATCTCCTCTCTCCTGATGTGTGT ygeA-down-R AGCGTTCAGTTATAGCGGTA ygeA-Cm-F TGACGCTATTTTGTCGTCAGCCGGCTGACATGGGAATTAG ygeA-Cm-R ACACACATCAGGAGAGAGGAGATTGTGTAGGCTGGAGC

[0146] Example 6: Construction of a recombinant plasmid expressing the 3-glycerol phosphate dehydrogenase encoding gene (glpD) and the corresponding engineered bacteria EcN-12.

[0147] (1) Using the EcN genome as a template, PCR amplification was performed using primers glpD-F and glpD-R in Table 6. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI. The PCR product fragment was purified to obtain the target gene glpD fragment (the nucleotide sequence is shown in NZ_CP007799.1 (3918024-3919529) in NCBI).

[0148] (2) pSU19-P tac -aspA-ppC-glpF vector was used as template, and PCR amplification was performed using primers pSU19-vector-R and primers pSU19-vector-F in Table 6. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI. The PCR product fragment was purified to obtain pSU19-P tac -aspA-ppC-glpF linearized vector.

[0149] (3) Using a one-step cloning kit, clone the pSU19-P tac -aspA-ppC-glpF linearized vector was connected with the target gene glpD fragment in step (1) to obtain the cloned recombinant plasmid pSU19-P tac -aspA-ppC-glpF-glpD (construction process and map see Figure 6 ). The plasmid was confirmed to be correct after sequencing.

[0150] (4) The recombinant plasmid pSU19-P tac -aspA-ppC-glpF-glpD and pGLO-P J23100 -panD K43Y -aspB was introduced into strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeA to obtain strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeA / pGLO-P J23100 -panD K43Y -aspB / pSU19-P tac -aspA-ppC-glpF-glpD, denoted as engineered bacteria EcN-12.

[0151] The method of Example 1 was used to detect the biomass and β-alanine production of the engineered bacteria EcN-12 and EcN-11. The results are as follows: Figure 12 The results showed that further enhancing the accumulation of DHAP could further increase the production of β-alanine. Using glycerol as the carbon source, the yield increased by 1.05 times compared with the EcN-11 strain, reaching 2.01 g / L.

[0152] Table 6: Primer sequences

[0153]

[0154] Example 7: Knockout of the gldA gene in the engineered bacterium EcN-12

[0155] In order to reduce more carbon metabolic consumption of the engineered bacteria EcN-12 and direct the metabolic flow to phosphoenolpyruvate to produce β-alanine, the EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeA / pGLO-P was recombined with the λ-RED recombination system. J23100 -panD K43Y -aspB / pSU19-P tac-aspA-ppC-glpF-glpD strain, the glycerol dehydrogenase gene gldA was knocked out to construct the β-alanine-producing engineered strain EcN-13 that blocks carbon metabolism and PEP consumption pathways. The specific steps are as follows:

[0156] (2) Using the EcN genome as a template, PCR amplification was performed with primers gldA-UP-F, gldA-UP-R, gldA-down-F, and gldA-down-R to obtain fragments of the upstream and downstream homologous arms of the target gene gldA. The nucleotide sequences are shown in NZ_CP007799.1 (4571694-4572689) and NZ_CP007799.1 (4573794-4574812) in NCBI.

[0157] As in Example 1, the kanamycin resistance fragment with FRT site was obtained by pKD4 plasmid, and DonorDNA was prepared. After obtaining the target strain, pKD46 plasmid was eliminated and PCP20 plasmid was used to eliminate the kanamycin resistance gene. Figure 13 Finally, the PCP20 plasmid was successfully eliminated, and the final non-resistant target strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldA / pGLO-P was obtained. J23100 -panD K43Y -aspB / pSU19-P tac -aspA-ppC-glpF-glpD, denoted as engineered bacteria EcN-13.

[0158] The biomass and β-alanine production of the engineered bacteria EcN-13 and EcN-12 were determined using the method of Example 1. The results are as follows: Figure 14 The results showed that knocking out the glycerol dehydrogenase encoding gene gldA and blocking the glycerol uptake microaerobic pathway can increase the production of β-alanine. Using glycerol as a carbon source, compared with the EcN-12 strain, the yield increased by 1.08 times and reached 2.17g / L.

[0159] Table 7: Primer sequences

[0160] gldA-detection-F GTTGGCGTATTGAGCAATGA gldA-UP-F GCGGTATTGTGCTGATTGTG gldA-UP-R GCTCCAGCCTACACAATCGGAGTGGGAATAACCTACTCCA gldA-down-F TCCCATGTCAGCCGTTAAGTATGCGGTCCATAATTACTCC gldA-down-R GTAAACTGGAAGCCGACTTG gldA-Kan-F CGATTGTGTAGGCTGGAGC gldA-Kan-R ACTTAACGGCTGACATGGGA

[0161] Example 8: Knockout of the nadB gene in the engineered bacterium EcN-13

[0162] In order to further reduce the consumption of L-aspartate in the engineered bacteria EcN-13 and enhance the L-aspartate pool, the λ-RED recombination system was used to generate EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldA / pGLO-P J23100 -panDK43Y -aspB / pSU19-P tac The L-aspartate oxidase encoding gene nadB in the -aspA-ppC-glpF-glpD strain was knocked out to reduce the consumption of L-aspartate entering the TCA cycle, and to construct the β-alanine-producing engineered strain EcN-14 that enhances the L-aspartate to β-alanine pathway. The specific steps are as follows:

[0163] (1) Using the EcN genome as a template, PCR amplification was performed using primers nadB-UP-F, nadB-UP-R, nadB-down-F, and nadB-down-R to obtain the fragments of the upstream and downstream homologous arms of the target gene nadB. The nucleotide sequences are shown in NZ_CP007799.1 (2944352-2945351) and NZ_CP007799.1 (2946975-2947971) in NCBI;

[0164] As in Example 1, the kanamycin resistance fragment with FRT site was obtained by pKD4 plasmid, and DonorDNA was prepared. After obtaining the target strain, pKD46 plasmid was eliminated and PCP20 plasmid was used to eliminate the kanamycin resistance gene. Figure 15 Finally, the PCP20 plasmid was successfully eliminated, and the final target strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadB without resistance was obtained, and the recombinant plasmid pGLO-P was introduced. J23100 -panD K43Y -aspB and pSU19-P tac -aspA-ppC-glpF-glpD, obtained the engineering strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadB / pGLO-P J23100 -panD K43Y -aspB / pSU19-P tac -aspA-ppC-glpF-glpD, denoted as engineered bacteria EcN-14.

[0165] The biomass and β-alanine production of the engineered bacterium EcN-14 were determined using the method of Example 1. The results are as follows: Figure 16 The results showed that knocking out the L-aspartate oxidase encoding gene nadB reduced the consumption of L-aspartate and enhanced the L-aspartate pool, which could increase the production of β-alanine. Compared with the EcN-13 strain, using glycerol as a carbon source increased the production by 1.09 times, reaching 2.37 g / L.

[0166] Table 8: Primer sequences

[0167] nadB-detection-F GAGCGATGGCAGAGAATCAA nadB-UP-F CCAGTATCCCGCTATCGTC nadB-UP-R GCTCCAGCCTACACAATCGCTAAACACGGTTTGGTCAGC nadB-down-F TCCCATGTCAGCCGTTAAGTTGGCCCACGAATGACTAAG nadB-down-R CGCAGAACCGAGTACATCAC nadB-Kan-F GCTGACCAAACCGTGTTTAGCGATTGTGTAGGCTGGAGC nadB-Kan-R CTTAGTCATTCGTGGGCCAACTTAACGGCTGACATGGGA

[0168] Example 9: Knockout of the dhaK gene in the engineered bacterium EcN-14

[0169] In order to reduce the consumption of PEP and enhance the PEP pool of the engineered bacteria EcN-14, the λ-RED recombination system was used to transform EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadB / pGLO-P J23100 -panD K43Y -aspB / pSU19-P tac The PEP-dependent dihydroxyacetone kinase encoding gene dhaK was knocked out in the -aspA-ppC-glpF-glpD strain, the glycerol to 3-phosphoglycerol metabolic pathway was enhanced, the PEP consumption was reduced, and the β-alanine-producing engineered strain EcN-15 with enhanced glycerol to 3-phosphoglycerol aerobic pathway was constructed. The specific steps are as follows:

[0170] (1) Using the EcN genome as a template, PCR amplification was performed using primers dhaK-UP-F, dhaK-UP-R, dhaK-down-F, and dhaK-down-R to obtain the fragments of the upstream and downstream homologous arms of the target gene dhaK. The nucleotide sequences are shown in NZ_CP007799.1 (1417886-1418907) and NZ_CP007799.1 (1419979-1420979) in NCBI;

[0171] As in Example 1, the kanamycin resistance fragment with FRT site was obtained by pKD4 plasmid, and DonorDNA was prepared. After obtaining the target strain, pKD46 plasmid was eliminated and PCP20 plasmid was used to eliminate the kanamycin resistance gene. Fig.17 Finally, the PCP20 plasmid was successfully eliminated, and the final target strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadBΔdhaK / pGLO-P was obtained. J23100 -panD K43Y -aspB / pSU19-P tac -aspA-ppC-glpF-glpD, denoted as engineered bacteria EcN-15.

[0172] The biomass and β-alanine production of the engineered bacteria EcN-15 and EcN-14 were measured using the method of Example 1. The results are as follows: Fig.18The results showed that knocking out the PEP-dependent dihydroxyacetone kinase encoding gene dhaK, enhancing the metabolic pathway of glycerol to 3-phosphoglycerol, reducing PEP consumption, and constructing an enhanced aerobic pathway of glycerol to 3-phosphoglycerol can increase the production of β-alanine. Using glycerol as a carbon source, compared with the EcN-14 strain, the yield increased by 1.05 times, reaching 2.49g / L.

[0173] Table 9: Primer sequences

[0174] dhaK-Detect-F ATCAGTGCAGAGTAAATTGCC dhaK-UP-F TGTGACTGTTTTATTGCTTGTTG dhaK-UP-R TCCCATGTCAGCCGTTAAGTTATTTTGCTCCAGCAATTACGG dhaK-down-F GCTCCAGCCTACACAATCGGGAGAAAGCAATGTCACTGA dhaK-down-R GTAAACCCAGTTGTTCACGT dhaK-Kan-F CGATTGTGTAGGCTGGAGC dhaK-Kan-R ACTTAACGGCTGACATGGGA

[0175] Example 10: Construction of a recombinant plasmid expressing a DMT family inner membrane protein encoding gene (ydcZ) and the corresponding engineered bacteria EcN-16.

[0176] (1) Using the EcN genome as a template, PCR amplification was performed using primers ydcZ-F and ydcZ-R in Table 10. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI. The PCR product fragment was purified to obtain the target gene ydcZ fragment (the nucleotide sequence is shown in NZ_CP007799.1 (1636228-1636677) in NCBI).

[0177] (2) pGLO-P J23100 -panD K43Y -aspB vector was used as template, and PCR amplification was performed using primers pGLO-vector-R and primers pGLO-vector-F in Table 10. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI, and the PCR product fragment was purified to obtain pGLO-P J23100 -panD K43Y -aspB linearized vector.

[0178] (3) Using a one-step cloning kit, pGLO-P J23100 -panD K43Y -aspB linearized vector was connected with the target gene ydcZ fragment to obtain the cloned recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-ydcZ (construction process and map see Fig.19 ). The plasmid was confirmed to be correct after sequencing.

[0179] (4) The recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-ydcZ introduced strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadBΔdhaK / pSU19-Ptac -aspA-ppC-glpF-glpD, obtained strain Ec NΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadBΔdhaK / pGLO-P J23100 -pan D K43Y -aspB-ydcZ / pSU19-P tac -aspA-ppC-glpF-glpD, denoted as engineered bacteria EcN-16.

[0180] The method of Example 1 was used to detect the biomass and β-alanine production of the engineered bacteria EcN-16 and EcN-15. The results are as follows: Fig. 20 The results showed that overexpression of the inner membrane protein encoding gene ydcZ can increase the production of β-alanine. Using glycerol as the carbon source, the yield increased by 1.04 times compared with the EcN-15 strain, reaching 2.59 g / L.

[0181] Table 10: Primer sequences

[0182]

[0183] Example 11: Construction of a recombinant plasmid expressing an aromatic amino acid transporter encoding gene (yddG) and the corresponding engineered bacteria EcN-17.

[0184] (1) Using the EcN genome as a template, PCR amplification was performed using primers yddG-F and yddG-R in Table 11. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI. The PCR product fragment was purified to obtain the target gene yddG fragment (the nucleotide sequence is shown in NZ_CP007799.1 (1667167-1668048) in NCBI).

[0185] (2) pGLO-P J23100 -panD K43Y -aspB-ydcZ vector was used as a template, and PCR amplification was performed using primers pGLO-vector-R and primers pGLO-vector-F in Table 11. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was eliminated with DpnI. The PCR product fragment was purified to obtain pGLO-P J23100 -panD K43Y -aspB-ydcZ linearized vector.

[0186] (3) Using a one-step cloning kit, clone the pGLO-P J23100 -panD K43Y-aspB-ydcZ linearized vector was connected with the target gene yddG fragment in step (1) to obtain the cloned recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG (construction process and map see Fig.19 ). The plasmid was confirmed to be correct after sequencing.

[0187] (4) The recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG introduced strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadBΔdhaK / pSU19-P tac -aspA-ppC-glpF-glpD, obtained strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadBΔdha / pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG / pSU19-P tac -aspA-ppC-glpF-glpD, denoted as engineered bacteria EcN-17.

[0188] The method of Example 1 was used to detect the biomass and β-alanine production of the engineered bacteria EcN-17, EcN-16, and EcN-15. The results are as follows: Fig. 20 The results showed that overexpression of the aromatic amino acid transporter encoding gene yddG could increase the production of β-alanine. Using glycerol as the carbon source, the yield increased by 1.06 times compared with the EcN-16 strain, reaching 2.74 g / L.

[0189] Table 11: Primer sequences

[0190]

[0191] Example 12: Construction of a recombinant plasmid expressing the NAD-specific glutamate dehydrogenase gene (rocG) and the corresponding engineered bacteria EcN-18.

[0192] (1) Using the Bacillus subtilis genome as a template, PCR amplification was performed using primers rocG-F and primers rocG-R in Table 12. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI, and the PCR product fragment was purified to obtain the target gene rocG fragment (the nucleotide sequence is shown in NCBI CP147877.1 (3880740-3882014)).

[0193] (2) pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG vector was used as a template, and PCR amplification was performed using primers pGLO-vector-R and primers pGLO-vector-F in Table 12. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was eliminated with DpnI. The PCR product fragment was purified to obtain pGLO-P J23100 -panD-aspB-ydcZ-yddG linearized vector.

[0194] (3) Using a one-step cloning kit, clone the pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG linearized vector was connected with the target gene rocG fragment in step (1) to obtain the cloned recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG-rocG (construction process and map see Fig.21 ). The plasmid was confirmed to be correct after sequencing.

[0195] (4) The recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG-rocG introduced strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadBΔdhaK / pSU19-P tac -aspA-ppC-glpF-glpD, obtained strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadBΔdhaK / pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG-rocG / pSU19-P tac -aspA-ppC-glpF-glpD, denoted as engineered bacteria EcN-18.

[0196] The method of Example 1 was used to detect the biomass and β-alanine production of the engineered bacteria EcN-18 and EcN-17. The results are as follows: Fig.23 The results showed that overexpression of the NAD-specific glutamate dehydrogenase gene rocG could increase the production of β-alanine, and using glycerol as the carbon source, the yield increased by 1.03 times compared with the EcN-17 strain, reaching 2.82 g / L.

[0197] Table 12: Primer sequences

[0198]

[0199] Example 13: Construction of a recombinant plasmid expressing the glutamine synthetase encoding gene (glnA) and the corresponding engineered bacteria EcN-19.

[0200] (1) Using the EcN genome as a template, PCR amplification was performed using primers glnA-F and glnA-R in Table 13. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI. The PCR product fragment was purified to obtain the target gene glnA fragment (the nucleotide sequence is shown in NZ_CP007799.1 (4483254-4484663) in NCBI).

[0201] (2) Using pSU19-P tac -aspA-ppc-glpF-glpD vector was used as a template, and PCR amplification was performed using primers pSU-vector-R and primer pSU-vector-F in Table 13. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI. The PCR product fragment was purified to obtain pSU19-P tac -aspA-ppc-glpF-glpD linearized vector.

[0202] (3) Using a one-step cloning kit, clone the pSU19-P tac -aspA-ppc-glpF-glpD linearized vector was connected with the target gene glnA fragment in step (1) to obtain the cloned recombinant plasmid pSU19-P tac -aspA-ppc-glpF-glpD-glnA (construction process and map see Fig. 22 ). The plasmid was confirmed to be correct after sequencing.

[0203] (4) The recombinant plasmid pSU19-P tac -aspA-ppc-glpF-glpD-glnA introduced strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadBΔdhaK / pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG-rocG, obtained strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadBΔdhaK / pGLO-P J23100 -panD K43Y-aspB-ydcZ-yddG-rocG / pSU19-P tac -aspA-ppC-glpF-glpD-glnA, denoted as engineered bacteria EcN-19.

[0204] The method of Example 1 was used to detect the biomass and β-alanine production of the engineered bacteria EcN-19 and EcN-18. The results are as follows: Fig.23 The results showed that overexpression of the glutamine synthetase encoding gene glnA can increase the production of β-alanine. Using glycerol as a carbon source, the yield increased by 1.03 times compared with the EcN-18 strain, reaching 2.90 g / L.

[0205] Table 13: Primer sequences

[0206]

[0207] Example 14: Construction of the engineered bacterium EcN-20 using the cryptic plasmid pMUT1 as the expression vector.

[0208] In order to overexpress the key gene for β-alanine production using the cryptic plasmid pMUT1 carried by EcN itself, the pMUT1 on the genome of the EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadBΔdhaK strain was knocked out using the CRISPR / Cas system to avoid the inability of the pMUT1 plasmid we constructed to be transferred into EcN-19 due to plasmid incompatibility. The specific steps are as follows:

[0209] (1) Competent cells: The pCas9 plasmid (Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology 81.7 (2015): 2506-2514) was transformed into EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadBΔdhaK by electroporation to obtain EcN containing the pCas9 plasmid, which was inoculated into LB medium containing 0.1 mg / mL kanamycin and 30 mM L-arabinose and cultured at 30°C and 220 rpm until the OD 600 When the concentration reached 0.6, the bacterial solution was centrifuged at 5000 rpm for 5 min, and the precipitate was washed four times with sterile distilled water to obtain competent cells.

[0210] (2) pMUT1 knockout strain: The pTargetF (targeting pMUT1) plasmid was transferred into EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadBΔdhaK+pCas9 competent cells by electroporation, and EcN containing pCas9 and pTargetF plasmids was obtained on a dual-resistance LB plate containing 0.1 mg / mL spectinomycin and 0.05 mg / mL kanamycin.

[0211] (3) Elimination of plasmid: The strain in step (2) was inoculated into LB liquid culture medium containing 20 mM IPTG, and cultured at 37°C for 12 h to eliminate the pCas9 and pTargetF plasmids, and then inoculated into LB plates containing 0.05 mg / mL kanamycin resistance, 0.1 mg / mL spectinomycin resistance, and 0.1 mg / mL spectinomycin and 0.05 mg / mL kanamycin double resistance LB plates, and cultured at 37°C for 12 h to screen for knockout strains that eliminated the pCas9 and pTargetF plasmids.

[0212] (4) Using the recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG-rocG was used as a template, and PCR amplification was performed using primers JG-F and JG-R in Table 14. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI, and the PCR product fragment was purified to obtain the target gene P J23100 -panD K43Y -aspB-ydcZ-yddG-rocG fragment.

[0213] (5) Using pMUT1 vector ( Fig.24 ) was used as a template, and PCR amplification was performed using primers pMUT1-vector-R and primers pMUT1-vector-F in Table 14. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was digested with DpnI, and the PCR product fragment was purified to obtain the pMUT1 linearized vector (nucleotide sequence is shown in SEQ ID NO.2).

[0214] (6) Using a one-step cloning kit, clone the pMUT1 linearized vector from step (2) and the target gene P from step (1) using one-step cloning. J23100 -panD K43Y -aspB-ydcZ-yddG-rocG fragments were connected to obtain the cloned recombinant plasmid pMUT1-P J23100 -panD K43Y -aspB-ydcZ-yddG-rocG. The plasmid was verified to be correct by sequencing.

[0215] (7) The recombinant plasmid pMUT1-P J23100 -panD K43Y -aspB-ydcZ-yddG-rocG introduced strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔasnAΔygeAΔgldAΔnadBΔdhaKΔpMUT1 / pSU19-P tac -aspA-ppC-glp F-glpD-glnA, obtained strain EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔygeAΔgldAΔdhaKΔasn AΔnadBΔdhaKΔpMUT1 / pMUT1-P J23100 -panD K43Y -aspB-ydcZ-yddG-rocG / pSU19-P tac -aspA-ppC-glp F-glpD-glnA, denoted as engineered bacteria EcN-20.

[0216] The method of Example 1 was used to detect the biomass and β-alanine production of the engineered bacteria EcN-20 and EcN-19. The results are as follows: Fig.25 The results showed that replacing the pGLO plasmid with the cryptic plasmid pMUT1 as the expression vector could increase the production of β-alanine. Using glycerol as the carbon source, the yield increased by 1.05 times compared with the EcN-19 strain, reaching 3.04 g / L.

[0217] Table 14: Primer sequences

[0218] JG-F TTTTCGTTTTCTCCGTTCTGTTTGACGGCTAGCTCAGTC JG-R GCAATCAACTCACTGGCTCATTAGACCCATCCGCGGAA pMUT1-vector-R TGAGCCAGTGAGTTGATTGC pMUT1 vector-F TGAGCCAGTGAGTTGATTGC JC-F AATAACTCAATGGGCTGGTG JC-R ACATGATCCCCCATGTTGT

[0219] Example 15: Optimization of shake flask culture conditions of engineered bacteria EcN-20 and fermentation process for producing β-alanine.

[0220] 1. Capacity of different engineered bacteria to produce β-alanine

[0221] The chassis bacteria EcN-6 and the engineered bacteria EcN-20 constructed in Example 14 were respectively tested in a shake flask fermentation experiment to compare the ability of the strains to produce β-alanine before and after the transformation. The shake flask fermentation experiment was carried out according to the following scheme:

[0222] Each strain was streaked onto an LB plate containing 0.1 mg / mL ampicillin resistance, cultured overnight in a 37°C incubator, and a single colony was picked and inoculated into 5 mL of LB liquid medium, and cultured overnight at 200 rpm in a 37°C incubator to obtain seed liquid. LB plate medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 2 g / L, pH natural. LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH natural.

[0223] 50 mL of basic salt M9 medium was added to a 250 mL shake flask, and 1 mL of seed liquid was inoculated into the basic salt M9 medium of the shake flask. The shake flask was then cultured in an incubator at 37°C at a speed of 200 rpm for 24 hours. 1 mL of liquid was taken from the shake flask, centrifuged at 9000 rpm for 1 min, and the supernatant was taken and derivatized. After filtering with an organic membrane with a pore size of 0.45 μm, the filtrate was analyzed for the content of β-alanine in the fermentation broth by HPLC as described in Example 1. Finally, the amount of β-alanine obtained by the strain before and after the transformation was compared. The results are shown in Fig.26 .

[0224] The composition of basic salt M9 medium is: K2HPO4·3H2O 14g / L, KH2PO4 5.2g / L, (NH4)2SO4 2g / L, MgSO4 0.3g / L, trypsin 1g / L, the solvent is ddH2O, and the pH value is 7.0.

[0225] After fermentation, it was found that the modified strain had the ability to produce β-alanine, and the modification of the β-alanine transport system significantly improved the strain's tolerance to high concentrations of β-alanine. The modified strain produced 1.6g / L more β-alanine than the original strain.

[0226] 2. Carbon source optimization

[0227] Carbon source optimized medium: 10g / L carbon source, K2HPO4·3H2O 14g / L, KH2PO4 5.2g / L, (NH4)2SO4 2g / L, MgSO4 0.3g / L, trypsin 1g / L, solvent is ddH2O, pH value is 7.0. The carbon source is a mixture of glucose and glycerol in a mass ratio of 1:1, 2:1, 3:1, 4:1, 5:1.

[0228] Add 50 mL of carbon source optimized medium to a 250 mL shake flask, add 1 mL of the seed solution prepared in step 1, and culture at 200 rpm in a 37 ° C incubator for 24 hours. Take 1 mL of liquid from the shake flask, centrifuge at 9000 rpm for 1 min, take the supernatant, and analyze the β-alanine content in the fermentation broth using the method in step 1. The results are as follows: Figure 2 As shown, the results showed that the optimal carbon source ratio was glucose: glycerol 4:1.

[0229] 3. Nitrogen source optimization

[0230] Nitrogen source optimized culture medium: 2-6g / L nitrogen source, 8g / L glucose, 2g / L glycerol, K2HPO4·3H2O 14g / L, KH2PO45.2g / L, MgSO4 0.3g / L, solvent is ddH2O, pH 7.0.

[0231] 2g / L urea, 2g / L glutamine, 2g / L ammonium succinate, 2g / L urea + 2g / L glutamine, 2g / L urea + 2g / L glutamine, 2g / L ammonium succinate + 2g / L glutamine, and 2g / L urea + 2g / L glutamine + 2g / L ammonium succinate were selected as nitrogen sources.

[0232] Add 50 mL of nitrogen source optimized medium to a 250 mL shake flask, add 1 mL of the seed solution prepared in step 1, and culture at 200 rpm in a 37°C incubator for 24 hours. Take 1 mL of liquid from the shake flask, centrifuge at 9000 rpm for 1 min, take the supernatant, and analyze the biomass and β-alanine content in the fermentation broth using the method in step 1. The results are as follows: Fig.28 As shown in , the optimal nitrogen source is a combination of 2g / L urea + 2g / L glutamine + 2g / L ammonium succinate.

[0233] Therefore, the optimized fermentation medium composition was: 8 g / L glucose, 2 g / L glycerol, 14 g / L K2HPO4·3H2O, 5.2 g / L KH2PO4, 0.3 g / L MgSO4, 1 g / L NH4Cl, 1 g / L tryptone, 2 g / L urea, 2 g / L glutamine, 2 g / L ammonium succinate, the solvent was ddH2O, and the pH value was 7.0.

[0234] 4. Optimize fermentation medium

[0235] 1 ml of seed solution of EcN-6 and EcN-20 prepared in step 1 was inoculated into a shake flask containing 50 ml of optimized fermentation medium, and cultured in an incubator at 37 ° C at a speed of 200 rpm for 24 hours. 1 ml of liquid was taken from the shake flask, centrifuged at 9000 rpm for 1 min, and the supernatant was taken. The biomass and β-alanine content in the fermentation broth were analyzed by the method of step 1. The HPLC chart of EcN-20 fermentation broth is shown in Fig.30 As shown, HPLC of β-alanine standards with different concentrations (1mM, 5mM, 10mM, 20mM, 40mM) Fig.29 shown.

[0236] The strain EcN-20 with the best performance after transformation produced β-alanine at a level higher than that of EcN-6, from 2.05±0.1 g / L to 3.54±0.1 g / L in the optimized fermentation medium. Fig.31 ).

[0237] Example 16: Fed-batch fermentation culture of the engineered bacteria EcN-20 in a 5 L fermenter.

[0238] (1) Activation culture:

[0239] EcNΔcycAΔfumB1ΔaspCΔpykΔpckAΔlacIΔgldAΔdhaKΔygeAΔasn AΔnadBΔdhaKΔpMUT1 / pMUT1-P stored in -80°C glycerol J23100 -panD K43Y -aspB-ydcZ-yddG-rocG / pSU19-P tac The -aspA-ppC-glp F-glpD-glnA strain was streaked on LB plate culture medium and activated and cultured overnight in an incubator at 37°C to obtain activated bacteria; LB plate culture medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 2 g / L, the solvent was water, and the pH value was natural.

[0240] (2) Seed culture: fresh activated bacteria from step (1) were selected and inoculated into LB liquid culture medium test tubes, cultured overnight at 37°C and a shaking speed of 220 r / min, and then the culture solution was transferred to a 250 mL Erlenmeyer flask containing 50 mL of LB liquid culture medium at an inoculum concentration of 1% by volume, and cultured overnight at 37°C and a shaking speed of 220 r / min to obtain seed solution. LB liquid culture medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, the solvent is water, and the pH value is natural.

[0241] (3) Fed-batch fermentation culture:

[0242] According to the inoculation amount of 5% by volume, the seed liquid of step (2) was inoculated into a 5L fermenter containing 2L of fermenter medium. The culture temperature was 37°C, pH 7.0, and the dissolved oxygen value was maintained at 20%. After 8 hours of fermentation, glucose was supplemented to 10-15g / L by adding feed medium (without adding glycerol as a control) every 2 hours according to the consumption of glucose, and the residual sugar was controlled at 3-5g / L until the fermentation was completed to obtain a fermentation liquid containing β-alanine. The total fermentation time was 60 hours, and the feed medium consumed a total of 1L. During the feeding process, samples were taken every 2 hours to measure the cell growth OD 600 , glucose residual sugar content (residual sugar analyzer) and β-alanine concentration (same as Example 1 HPLC). Fig.32 As shown, in the absence of glycerol in the feed bottle, OD 600 When the growth rate reaches about 28.4, the production of β-alanine reaches 42.5g / L. Fig.33 As shown, when glycerol was added to the feed bottle, the OD 600 When the growth reaches about 22.5, the production of β-alanine reaches 58.4g / L.

[0243] Fermentation tank medium: 20g / L glucose, K2HPO4·3H2O 28g / L, KH2PO4 10.4g / L, NH4Cl 4g / L, MgSO40.6g / L, tryptone 2g / L, yeast powder 4g / L, succinylamine 2g / L, glutamine 2g / L, urea 5g / L, 1mL / L10× metal ion, 1mL / L organic silica gel defoamer, the solvent is water; 10× metal ion formula: 10g CaCl2, 10gFeSO4·7H2O, 1g ZnSO4·7H2O, 0.2g CuSO4 and 0.02g NiCl2·7H2O dissolved in 100mL ddH2O;

[0244] The feed medium is composed of: 400 g / L glucose, 200 g / L glycerol, 4 g / L yeast extract, 14 g / L KH2PO4, 30 g / L (NH4)2SO4, 0.6 g / L MgSO4, 6 g / L succinylamine, 6 g / L glutamine, 1 mL / L defoamer, the defoamer is an organic silica gel defoamer, and the solvent is water.

Claims

1. An engineered bacterium that produces high β-alanine using a cryptic plasmid as an expression vector, characterized in that: The engineering bacteria were E. coli Nissle1917ΔcycAΔfumB1ΔaspCΔpyk / pGLO-P J23100 -panD K43Y -aspB / pSU19-P J23100 -ppC-aspA is a chassis bacterium, and one or more of the pckA gene, lacI gene, asnA gene, ygeA gene, gldA gene, nadB gene, and dhaK gene in the genome are knocked out, and / or one or more of the glpF gene, glpD gene, yddG gene, ydcZ gene, rocG gene, and glnA gene are overexpressed; the yddG gene, ydcZ gene, and rocG gene are overexpressed using a high-copy cryptic plasmid pMUT1.

2. The engineered bacteria according to claim 1, characterized in that The yddG gene, ydcZ gene, and rocG gene are promoter P J23100 The glpF gene, glpD gene and glnA gene are expressed by promoter P tac Expression, the promoter P tac The nucleotide sequence is shown in SEQ ID NO.

1.

3. The engineered bacteria according to claim 1, characterized in that The glpF gene, glpD gene and glnA gene are overexpressed using the medium copy plasmid pSU19.

4. The engineered bacteria according to claim 1, characterized in that The yddG gene nucleotide sequence is shown in 1667167-1668048 of NZ_CP007799.1 in NCBI, the ydcZ gene nucleotide sequence is shown in 1636228-1636677 of NZ_CP007799.1 in NCBI, and the rocG gene nucleotide sequence is shown in 3880740-3882014 of CP147877.1 in NCBI.

5. The engineered bacteria according to claim 1, characterized in that The nucleotide sequence of the glpF gene is shown in NCBI NZ_CP007799.1 at 4540078-4540923, the nucleotide sequence of the glpD gene is shown in NCBI NZ_CP007799.1 at 3918024-3919529, and the nucleotide sequence of the glnA gene is shown in NCBI NZ_CP007799.1 at 4483254-4484663.

6. The engineered bacteria according to claim 1, characterized in that The nucleotide sequence of the pMUT1 plasmid is shown in SEQ ID NO.

2.

7. The engineered bacteria according to claim 1, characterized in that The engineered bacteria is one of the following: (1) Knock out the pckA gene in the genome of the chassis bacteria, i.e., the engineered bacteria ECN-7; (2) Based on the engineered strain ECN-7, the lacI gene in the genome was knocked out to obtain the engineered strain ECN-8; (3) Based on the engineered bacteria ECN-8, plasmid pSU19 and promoter P tac Overexpression of the glpF gene, i.e., engineered bacteria ECN-9; (4) Based on the engineered strain ECN-9, the asnA gene in the genome was knocked out, i.e., the engineered strain ECN-10; (5) Based on the engineered strain ECN-10, the ygeA gene in the genome was knocked out, i.e., the engineered strain ECN-11; (6) Based on the engineered bacteria ECN-11, plasmid pSU19 and promoter P tac Overexpression of the glpD gene, i.e., engineered bacteria ECN-12; (7) Based on the engineered strain ECN-12, the gldA gene in the genome was knocked out, i.e., the engineered strain ECN-13; (8) Based on the engineered strain ECN-13, the nadB gene in the genome was knocked out, i.e., the engineered strain ECN-14; (9) Based on the engineered strain ECN-14, the dhaK gene in the genome was knocked out, i.e., the engineered strain ECN-15; (10) Based on the engineered bacteria ECN-15, plasmid pGLO and promoter P J23100 Overexpression of the ydcZ gene, i.e., engineered bacteria ECN-16; (11) Based on the engineered bacteria ECN-16, plasmid pGLO and promoter P J23100 Overexpression of the yddG gene, i.e., engineered bacteria ECN-17; (12) Based on the engineered bacteria ECN-17, plasmid pGLO and promoter P J23100 Overexpression of the rocG gene, i.e., engineered bacteria ECN-18; (13) Based on the engineered bacteria ECN-18, plasmid pSU19 and promoter P tac Overexpression of the glnA gene, i.e., engineered bacteria ECN-19; (14) Based on the engineered bacteria ECN-19, the pMUT1 plasmid was eliminated from the genome, and pMUT1 was used as a vector to replace the pGLO plasmid to overexpress the panD, aspB, yddG, ydcZ, and rocG genes, namely the engineered bacteria ECN-20.

8. A method for producing β-alanine by dual-carbon source fermentation using the high-yield β-alanine engineering bacteria of claim 1, characterized in that: The method is: The engineered bacteria are inoculated into a fermentation medium, and fermented and cultured at 37° C. and 200 rpm to obtain a fermentation liquid containing β-alanine; the fermentation medium comprises: 8 g / L glucose, 2 g / L glycerol, 14 g / L K2HPO4·3H2O, 5.2 g / L KH2PO4, 0.3 g / L MgSO4, 1 g / L NH4Cl, 1 g / L tryptone, 2 g / L urea, 2 g / L glutamine, and 2 g / L ammonium succinate, the solvent is ddH2O, and the pH value is 7.

0.

9. The method according to claim 8, characterized in that The engineered bacteria are inoculated into a fermentation tank culture medium at a culture temperature of 37° C., a pH of 7.0, and a dissolved oxygen value of 20%; after fermentation for 8 hours, glucose is supplemented to 10-15 g / L through a feed culture medium every 2 hours according to the consumption of glucose, so that the residual sugar is controlled at 3-5 g / L until the fermentation is completed, thereby obtaining a fermentation liquid containing β-alanine; The fermentation tank medium composition: 20g / L glucose, K2HPO4·3H2O 28g / L, KH2PO4 10.4g / L, NH4Cl 4g / L, MgSO40.6g / L, tryptone 2g / L, yeast powder 4g / L, succinylamine 2g / L, glutamine 2g / L, urea 5g / L, 1mL / L10× metal ion, 1mL / L organic silica gel defoamer, the solvent is water; 10× metal ion formula: 10g CaCl2, 10gFeSO4·7H2O, 1gZnSO4·7H2O, 0.2g CuSO4 and 0.02g NiCl2·7H2O dissolved in 100mL ddH2O; The composition of the feed medium: glucose 400 g / L, glycerol 200 g / L, yeast extract 4 g / L, KH2PO4 14 g / L, (NH4)2SO4 30 g / L, MgSO4 0.6 g / L, succinylamine 6 g / L, glutamine 6 g / L, defoamer 1 mL / L, the defoamer is an organic silica gel defoamer, and the solvent is water.

10. The method according to claim 8, characterized in that The engineered bacteria are first activated on a slant and cultured for seed expansion before fermentation, and then the seed solution is inoculated into a fermentation medium or a fermentation tank medium at an inoculation volume concentration of 2-5%. The seed solution preparation method is as follows: (1) The engineered bacteria were inoculated on an LB plate containing 0.1 mg / mL ampicillin resistance and cultured in a 37°C incubator overnight; the LB plate medium included 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, and 2 g / L agar, the solvent was water, and the pH value was natural; (2) Pick a single colony from step (1) and inoculate it into LB liquid culture medium, and culture it in a 37°C incubator at 220 rpm overnight to obtain a seed solution.

Images