Recombinant immune cell for expressing KLHL6 as well as preparation method and application of recombinant immune cell

Abstract

The invention relates to a recombinant immune cell. The recombinant immune cell expresses a KLHL6 gene. The recombinant immune cell for expressing the KLHL6 gene, provided by the invention, remarkably inhibits the occurrence of exhaustion, improves the anti-tumor capability and prolongs the lifetime of mice.

Description

Technical Field

[0001] The present invention relates to the field of cell technology, and in particular to a recombinant immune cell expressing KLHL6 and a preparation method and application thereof. Background Art

[0002] Cancer is one of the diseases with the highest mortality rate in the world. The conventional treatment methods include surgical resection, radiotherapy and chemotherapy, but these methods still have limitations and it is difficult to completely cure tumors. In recent years, adoptive T cell therapy has made great progress in tumor immunotherapy, especially the representative chimeric antigen receptor T (CAR-T) cell therapy, T cell receptor engineered T (TCR-T) cell therapy and tumor infiltrating lymphocytes (TILs) therapy. Its main principle is to collect immune-active T cells from the patient, amplify, genetically engineer and functionally identify them in vitro, and then return them to the patient's body to achieve the purpose of directly killing tumor cells or stimulating the body's immune response to kill tumor cells. At present, a variety of CAR-T products targeting CD19 have been approved for marketing, bringing good news to most tumor patients, especially those with hematological tumors. Although CAR-T cell therapy for the treatment of solid tumors faces many challenges, it is also gradually developing and breaking through. TCR-T cell therapy represented by tumor cell antigens NY-ESO-1 and MART-1 has shown good therapeutic effects and safety in clinical treatment. In addition, TILs therapy also benefits patients with solid tumors due to its low off-target rate and high safety.

[0003] Although adoptive T cell therapy has achieved some gratifying therapeutic effects in the treatment of tumors, it still faces many difficulties and challenges. Continuous antigen stimulation and unfavorable microenvironmental factors in solid tumor tissues activate the exhaustion signal of tumor-infiltrating antigen-specific CD8+T cells, resulting in the loss of T cell anti-tumor function and promoting T cell exhaustion. Exhausted T cells highly express multiple inhibitory receptors (IRs) such as PD-1, PD-L1, PD-L2, CTLA4, LAG-3, TIM-3, CD39 and TIGIT, and lose their effector function and long-term proliferation ability. In addition, their epigenetic, transcriptional profiles and metabolic patterns change, resulting in the loss of reactivation response to immune checkpoint blocking antibodies. At present, T cell exhaustion is an important cause of clinical resistance to T cell adoptive therapy and resistance to immune checkpoint inhibitor therapy. Therefore, how to reverse or inhibit T cell exhaustion and obtain a sustained and effective immune response is an important opportunity and challenge facing tumor immunotherapy. Summary of the invention

[0004] Based on the technical problems existing in the prior art, the present invention provides a recombinant immune cell expressing KLHL6 and a preparation method and application thereof. The immune cell expressing the KLHL6 gene provided by the present invention enhances the killing ability, survival ability and proliferation ability of immune cells against solid tumors, and can significantly inhibit tumor growth.

[0005] The first object of the present invention is to provide a recombinant immune cell, wherein the recombinant immune cell expresses the KLHL6 gene.

[0006] Preferably, the nucleotide sequence encoding the KLHL6 gene is selected from the following group:

[0007] (1) the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2;

[0008] (2) having ≥95% homology, preferably ≥98%, more preferably ≥99% homology with the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2; or

[0009] (3) A nucleotide sequence complementary to the nucleotide sequence described in any one of (1) or (2).

[0010] Preferably, the recombinant immune cells are immune cells derived from mammals, preferably human or mouse immune cells.

[0011] Preferably, the immune cells are selected from at least one of peripheral lymphocytes, tumor-infiltrating lymphocytes, monocytes and tissue-resident lymphocytes;

[0012] Preferably, the immune cells are selected from T cells and peripheral blood mononuclear cells;

[0013] More preferably, the T cells are selected from at least one of CD4+T cells, CD8+T cells and γδT cells.

[0014] Preferably, the recombinant immune cells include one or more structures for adoptive cell therapy.

[0015] Preferably, the corresponding structure for adoptive cell therapy is a chimeric antigen receptor (CAR) structure, a T cell antigen receptor (TCR) structure, a receptor structure based on ligand receptor binding, or a synthetic T cell receptor and antigen receptor (STAR).

[0016] The second object of the present invention is to provide a method for preparing the recombinant immune cell as described in any one of the above items, comprising:

[0017] (1) Construction of KLHL6 gene expression vector;

[0018] (2) packaging the expression vector obtained in step (1) with a virus;

[0019] (3) Infecting immune cells with the virus obtained in step (2).

[0020] Preferably, the nucleotide sequence encoding the KLHL6 gene is selected from the following group:

[0021] (1) the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2;

[0022] (2) having ≥95% homology, preferably ≥98%, more preferably ≥99% homology with the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2; or

[0023] (3) A nucleotide sequence complementary to the nucleotide sequence described in any one of (1) or (2).

[0024] Preferably, the expression vector includes a gene sequence corresponding to a structure used for adoptive cell therapy, preferably including a gene sequence corresponding to a CAR structure, a TCR structure, or a STAR structure acting on a target.

[0025] Preferably, the immune cells are derived from mammals, preferably from humans or mice, more preferably from human or mouse T cells or peripheral blood monocytes; most preferably, they are derived from human or mouse CD4+T cells, CD8+T cells, γδT cells or peripheral blood monocytes.

[0026] Preferably, when the immune cells are of mouse origin, the immune cells in step (3) are activated and / or cultured by anti-CD3ε, anti-CD28 antibodies and cytokines, wherein the anti-CD3ε, anti-CD28 antibodies and cytokines are derived from mice; and / or,

[0027] When the immune cells are of human origin, the immune cells in step (3) are activated and / or cultured by anti-CD3, anti-CD28 antibodies and cytokines, wherein the anti-CD3, anti-CD28 antibodies and cytokines are derived from humans.

[0028] Preferably, the cytokine is selected from at least one of IL-2, IL-5, IL-7, IL-15, IL-17 and IL-21; preferably at least one of IL-2, IL-15 and IL-7; more preferably IL-2 and / or IL-7.

[0029] Preferably, the concentrations of the anti-CD3ε and anti-CD28 antibodies of mouse origin are each independently 1 to 2 μg / mL; and / or the concentrations of the anti-CD3 and anti-CD28 antibodies of human origin are each independently 1 to 2 μg / mL.

[0030] Preferably, the final concentration of the cytokine is 30 to 1500 IU; preferably 30 to 1000 IU; more preferably 30 to 500 IU; most preferably 30 to 400 IU.

[0031] The third object of the present invention is to provide a pharmaceutical composition, which comprises the recombinant immune cells described in any one of the above or the recombinant immune cells obtained by the above preparation method.

[0032] The fourth object of the present invention is to provide the use of any of the above-mentioned recombinant immune cells, the recombinant immune cells obtained by the above-mentioned preparation method or the above-mentioned pharmaceutical composition in the preparation of adoptive immunotherapy products.

[0033] Preferably, the adoptive immunotherapy product is used to prevent and / or treat tumors, infectious diseases and autoimmune diseases;

[0034] Preferably, the tumor is one or more of lung cancer, liver cancer, breast cancer, colorectal cancer, nasopharyngeal cancer, kidney cancer, lymphoma, ovarian cancer, gastric cancer, pancreatic cancer, multiple myeloma, glioma, prostate cancer, cervical cancer, bile duct cancer, esophageal cancer or melanoma.

[0035] Beneficial Effects

[0036] The immune cells expressing KLHL6 protein obtained by the present invention have good survival and proliferation abilities during in vitro activation and culture, and will not promote immune cell apoptosis; the immune cells expressing KLHL6 protein obtained by the present invention have significant anti-tumor function in adoptive cell therapy, can effectively inhibit tumor growth and prolong the survival of mice; the immune cells expressing KLHL6 protein obtained by the present invention can significantly inhibit the exhaustion of immune cells in adoptive cell therapy, increase the number of tumor-infiltrating CD8+T cells, and enhance their effector function; the present invention can be applied to any adoptive immunotherapy method, including but not limited to the clinical treatment of tumors, infections and autoimmune diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The results show the effect of overexpression of KLHL6 on the activation and apoptosis of OT-1T cells.

[0038] Figure 2 The results of in vivo anti-tumor function detection of OT-1T cells overexpressing KLHL6.

[0039] Figure 3 The results of in vivo exhaustion phenotype detection of OT-1T cells overexpressing KLHL6.

[0040] Figure 4 The results of in vivo anti-tumor function detection of TCR-T cells overexpressing KLHL6.

[0041] Figure 5 The results of in vivo exhaustion phenotype detection of TCR-T cells overexpressing KLHL6. DETAILED DESCRIPTION

[0042] In order to make the technical solutions and beneficial effects of the present invention more clearly understood, the following is a detailed description by listing specific embodiments. Unless otherwise defined, the technical and scientific terms used herein have the same meanings as those in the technical field to which this application belongs.

[0043] As the most basic post-translational modification in cells, ubiquitination modification plays an important role in regulating protein homeostasis and signal transduction. It has been reported that ubiquitination modification of proteins plays an important regulatory role in TCR signal transduction and T cell anti-tumor immune response. Studies have found that KLHL6 and cullin3 assemble to form a functional cullin-RING-KLHL6 ubiquitinase complex. KLHL6 protein has been reported to participate in the maturation and differentiation of B cells and respond to BCR signals, and its mutation or deletion can lead to the occurrence of diffuse large B cell lymphoma. After extensive and in-depth research, the inventors found that immune cells overexpressing KLHL6 protein can significantly enhance the anti-tumor ability of adoptive T cells and prolong the survival of mice in adoptive immunotherapy, which provides new ideas and targets for improving the efficiency of adoptive T cell immunotherapy and engineering CAR-T, TCR-T or TILs cells.

[0044] Recombinant immune cells

[0045] In certain embodiments, the present invention provides a recombinant immune cell that expresses the KLHL6 gene.

[0046] In certain embodiments, the nucleotide sequence encoding the KLHL6 gene is selected from the group consisting of:

[0047] (1) the nucleotide sequence shown in SEQ ID NO: 1;

[0048] (2) having ≥95% homology with the nucleotide sequence shown in SEQ ID NO:1;

[0049] (3) the nucleotide sequence shown in SEQ ID NO: 2;

[0050] (4) having ≥95% homology with the nucleotide sequence shown in SEQ ID NO:2; or

[0051] (5) A nucleotide sequence complementary to the nucleotide sequence described in any one of (1) to (4).

[0052] In certain embodiments, the nucleotide sequence encoding the KLHL6 gene has ≥98% homology to the nucleotide sequence shown in SEQ ID NO:1.

[0053] In certain embodiments, the nucleotide sequence encoding the KLHL6 gene has ≥99% homology to the nucleotide sequence shown in SEQ ID NO:1.

[0054] Coding sequence of mouse KLHL6 gene (SEQ ID NO: 1)

[0055]

[0056] In certain embodiments, the nucleotide sequence encoding the KLHL6 gene has ≥98% homology to the nucleotide sequence shown in SEQ ID NO:2.

[0057] In certain embodiments, the nucleotide sequence encoding the KLHL6 gene has ≥99% homology to the nucleotide sequence shown in SEQ ID NO:2.

[0058] Coding sequence of human KLHL6 gene (SEQ ID NO: 2)

[0059] ATGTTGATGGCAGGACAAAGGGGCGCCTGGACCATGGGTGATGTGGTCGAGAAGAGTTTGGAAGGGCCCCTGGCACCTTCTACAGATGAGCCCTCCCAGAAAACAGGAGACTTGGTCGAGATCTTAAATGGGGAAAAGGTCAAATTTGACGACGCGGGACTCTCCTTAATTC

[0060] TTCAGAATGGCCTGGAAACCCTGCGAATGGAAAACGCTCTGACAGATGTCATCTTGTGT

[0061] GTGGACATTCAGGAATTCTCCTGCCACCGCGTGGTGCTTGCCGCAGCCAGCAACTATTT

[0062] CAGGGCCATGTTCTGCAACGATTTAAAGGAAAAGTATGAGAAAAGGATCATTATTAAAG

[0063] GGGTTGATGCTGAGACCATGCACACTCTGTTGGACTACACGTACACCAGCAAGGCGCTG

[0064] ATCACCAAGCAGAATGTCCAGCGGGTCCTGGAGGCTGCTAACCTCTTCCAGTTCCTGCG

[0065] GATGGTGGATGCCTGTGCCAGCTTCCTCACTGAAGCCTTGAACCCAGAAAACTGCGTTG

[0066] GAATACTGAGGCTGGCTGACACACACTCGCTGGACAGTCTAAAGAAGCAGGTTCAGAG

[0067] TTACATCATTCAAAACTTTGTGCAGATTCTGAACTCTGAGGAGTTTCTTGACCTGCCCGT

[0068] GGACACTCTGCACCACATCTTGAAGAGTGATGACCTTTACGTGACCGAGGAGGCTCAGG

[0069] TGTTTGAGACCGTGATGAGCTGGGTCCGGCACAAGCCATCAGAACGACTCTGCTTACTC

[0070] CCCTATGTCCTCGAGAACGTGCGCTTACCGCTTCTGGACCCGTGGTACTTTGTGGAGAC

[0071] GGTGGAAGCAGATCCTCTCATCAGGCAGTGCCCAGAGGTCTTCCCGCTGCTCCAGGAA

[0072] GCCAGGATGTACCACCTTTCTGGCAATGAGATCATTTCGGAACGCACCAAGCCCAGGAT

[0073] GCATGAGTTCCAGTCTGAGGTGTTCATGATCATTGGCGGCTGCACGAAGGATGAACGGT

[0074] TTGTGGCAGAGGTGACCTGCCTGGACCCCCTGAGGCGCAGCCGCCTGGAGGTGGCCAA

[0075] GCTCCCGCTAACAGAGCATGAGCTGGAGAGTGAGAATAAGAAGTGGGTGGAGTTTGCA

[0076] TGCGTGACATTGAAAAATGAGGTCTACATCTCAGGTGGCAAAGAAACACAGCATGATGT

[0077] TTGGAAATATAATTCTTCGATCAACAAGTGGATTCAGATTGAGTATTTAAACATAGGCCGC

[0078] TGGAGGCATAAGATGGTGGTGTTGGGTGGCAAGGTCTATGTGATCGGAGGCTTTGACGG

[0079] CTTACAGAGAATCAACAATGTGGAGACCTACGACCCCTTTCACAACTGCTGGTCAGAGG

[0080] CCGCACCCCTCCTTGTCCATGTCAGTTCCTTTGCAGCCACCAGCCATAAGAAGAAGCTG

[0081] TATGTGATCGGGGGAGGGCCCAATGGGAAACTGGCCACAGACAAGACTCAGTGTTATG

[0082] ACCCTTCCACCAACAAGTGGAGTTTGAAGGCGGCCATGCCCGTGGAGGCTAAATGCATC

[0083] AATGCAGTGAGTTTCCGGGACCGCATCTATGTCGTTGGTGGGGCCATGAGAGCGCTGTA

[0084] CGCCTACAGCCCGCTGGAAGACAGCTGGTGCCTGGTGACCCAGCTCAGCCACGAGCGG

[0085] GCCAGCTGCGGTATCGCGCCCTGCAACAACCGGCTCTACATCACCGGCGGGCGGGACG

[0086] AGAAGAACGAGGTTATCGCCACGGTGCTGTGCTGGGACCCCGAGGCCCAGAAACTGAC

[0087] AGAGGAGTGCGTCCTGCCCCGGGGCGTGTCGCACCACGGCAGCGTCACCATCAGGAAG

[0088] TCGTACACCCACATCCGCAGGATCGTGCCCGGAGCAGTGTCTGTCTGA

[0089] In certain embodiments, the recombinant immune cells are mammalian-derived immune cells, preferably human- or mouse-derived immune cells.

[0090] In certain embodiments, the immune cells are selected from at least one of peripheral lymphocytes, tumor infiltrating lymphocytes, monocytes, and tissue-resident lymphocytes.

[0091] In certain embodiments, the immune cells are selected from T cells and peripheral blood mononuclear cells.

[0092] In certain embodiments, the T cells are selected from at least one of CD4+T cells, CD8+T cells, and γδT cells.

[0093] In certain embodiments, the present invention provides a recombinant T cell.

[0094] In certain embodiments, the recombinant immune cells include one or more constructs for adoptive cell therapy.

[0095] In certain embodiments, the corresponding structure for adoptive cell therapy is a chimeric antigen receptor (CAR) structure, a T cell antigen receptor (T cell receptor-engineered T cells, TCR) structure, a receptor structure based on ligand receptor binding, or a synthetic T cell receptor and antigen receptor (STAR). For a description of STAR, see WO2020029774A1 and Yue Liu.et,al.Chimeric STAR receptors using TCR machinerymediate robust responses against solid tumors.Sci Transl Med.2021Mar24;13(586):eabb5191.doi:10.1126 / scitranslmed.abb5191.

[0096] Method for preparing recombinant immune cells

[0097] The method for overexpressing KLHL6 on the surface of immune cells can be a conventional method in the art.

[0098] In certain embodiments, the present invention provides a method for preparing a recombinant immune cell as described in any one of the above, comprising:

[0099] (1) Construction of KLHL6 gene expression vector;

[0100] (2) packaging the expression vector obtained in step (1) with a virus;

[0101] (3) Infecting immune cells with the virus obtained in step (2).

[0102] In certain embodiments, the nucleotide sequence of the KLHL6 gene is selected from the group consisting of:

[0103] (1) the nucleotide sequence shown in SEQ ID NO: 1;

[0104] (2) having ≥95% homology with the nucleotide sequence shown in SEQ ID NO:1;

[0105] (3) the nucleotide sequence shown in SEQ ID NO: 2;

[0106] (4) having ≥95% homology with the nucleotide sequence shown in SEQ ID NO:2; or

[0107] (5) A nucleotide sequence complementary to the nucleotide sequence described in any one of (1) to (4).

[0108] In certain embodiments, the nucleotide sequence encoding the KLHL6 gene has ≥98% homology to the nucleotide sequence shown in SEQ ID NO:1.

[0109] In certain embodiments, the nucleotide sequence encoding the KLHL6 gene has ≥99% homology to the nucleotide sequence shown in SEQ ID NO:1.

[0110] In certain embodiments, the nucleotide sequence encoding the KLHL6 gene has ≥98% homology to the nucleotide sequence shown in SEQ ID NO:2.

[0111] In certain embodiments, the nucleotide sequence encoding the KLHL6 gene has ≥99% homology to the nucleotide sequence shown in SEQ ID NO:2.

[0112] In certain embodiments, the expression vector comprises a gene sequence corresponding to a structure for adoptive cell therapy.

[0113] In certain embodiments, the structure for adoptive cell therapy includes a gene sequence corresponding to a CAR structure, a TCR structure, and a STAR structure acting on a target. For a description of STAR, see WO2020029774A1 and YueLiu.et,al.Chimeric STAR receptors using TCR machinery mediate robust responses against solid tumors.Sci Transl Med.2021Mar24;13(586):eabb5191.doi:10.1126 / scitranslmed.abb5191.

[0114] In certain embodiments, the expression vector includes, but is not limited to, a retroviral vector and a lentiviral vector. The vector can be a retroviral vector or a lentiviral vector known to those skilled in the art.

[0115] In certain embodiments, the virus includes retroviruses and lentiviruses.

[0116] In certain embodiments, the virus packaging process comprises the following steps: transfecting the expression vector and the virus packaging vector into HEK293T cells using a transfection reagent, thereby obtaining a retrovirus or lentivirus expressing KLHL6 and / or containing CAR / TCR / STAR / other tumor-targeting receptors.

[0117] In certain embodiments, the viral packaging vector includes, but is not limited to, PCL-ECO, PHIT60, RD114, PA2X, and VSV-G.

[0118] In certain embodiments, the source of the transfection reagent is not particularly limited, and commercially available transfection reagents known in the art can be used, including but not limited to 293 TransfectioTransITn Reagent, liposome transfection reagent, Lipofectamine 2000 / 3000, PEI and other related transfection reagents.

[0119] In certain embodiments, the immune cells are derived from a mammal.

[0120] In certain embodiments, the immune cells are derived from humans or mice.

[0121] In certain embodiments, the immune cells are derived from human or mouse T cells or peripheral blood mononuclear cells.

[0122] In certain embodiments, the immune cells are derived from human or mouse CD4+T cells, CD8+T cells, γδT cells or peripheral blood monocytes.

[0123] In certain embodiments, when the immune cells are of mouse origin, the immune cells in step (3) are activated and / or cultured by anti-CD3ε, anti-CD28 antibodies and cytokines, wherein the anti-CD3ε, anti-CD28 antibodies and cytokines are derived from mice.

[0124] In certain embodiments, when the immune cells are of human origin, the immune cells in step (3) are activated and / or cultured by anti-CD3, anti-CD28 antibodies and cytokines, wherein the anti-CD3, anti-CD28 antibodies and cytokines are derived from humans.

[0125] In the present invention, the cytokines are not limited, and any cytokine that can be used for in vitro T cell culture is suitable for this application.

[0126] In certain embodiments, the cytokine is selected from at least one of IL-2, IL-5, IL-7, IL-15, IL-17 and IL-21.

[0127] In certain embodiments, the cytokine is selected from at least one of IL-2, IL-15 and IL-7.

[0128] In certain embodiments, the cytokine is selected from IL-2 and / or IL-7.

[0129] In certain embodiments, the concentration of the mouse anti-CD3ε is 1 to 2 μg / mL, such as 1.2 μg / mL, 1.4 μg / mL, 1.6 μg / mL, 1.8 μg / mL, etc.

[0130] In certain embodiments, the concentration of the mouse anti-CD3ε is 1.5-2 μg / mL.

[0131] In certain embodiments, the concentration of the murine anti-CD28 antibody is 1 to 2 μg / mL, such as 1.2 μg / mL, 1.4 μg / mL, 1.6 μg / mL, 1.8 μg / mL, etc.

[0132] In certain embodiments, the concentration of the murine anti-CD28 antibody is 1 to 1.5 μg / mL.

[0133] In certain embodiments, the concentration of the human anti-CD3 is 1 to 2 μg / mL, such as 1.2 μg / mL, 1.4 μg / mL, 1.6 μg / mL, 1.8 μg / mL, etc.

[0134] In certain embodiments, the concentration of the human anti-CD3 is 1-1.5 μg / mL.

[0135] In certain embodiments, the concentration of the human anti-CD28 antibody is 1-2 μg / mL, such as 1.2 μg / mL, 1.4 μg / mL, 1.6 μg / mL, 1.8 μg / mL, etc.

[0136] In certain embodiments, the concentration of the human anti-CD28 antibody is 1 to 1.5 μg / mL.

[0137] In certain embodiments, the final concentration of the cytokine is 30-1500 IU, for example, 35 IU, 40 IU, 55 IU, 60 IU, 70 IU, 80 IU, 90 IU, 100 IU, 150 IU, 200 IU, 250 IU, 300 IU, 350 IU, 400 IU, 450 IU, 500 IU, 1000 IU, 1500 IU, etc.

[0138] In certain embodiments, the final concentration of the cytokine is 30 to 1000 IU.

[0139] In certain embodiments, the final concentration of the cytokine is 30 to 500 IU.

[0140] In certain embodiments, the final concentration of the cytokine is 30-400 IU.

[0141] Pharmaceutical composition

[0142] In certain embodiments, the present invention provides a pharmaceutical composition comprising any of the above-described recombinant immune cells.

[0143] In certain embodiments, the drug combination comprises the recombinant immune cells obtained by the above preparation method.

[0144] In certain embodiments, in addition to the recombinant immune cells provided by the embodiments of the present invention as an effective ingredient, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

[0145] Therapeutic applications

[0146] In certain embodiments, the present invention provides a use of any of the above-mentioned recombinant immune cells in the preparation of an adoptive immunotherapy product.

[0147] In certain embodiments, the present invention provides the use of the recombinant immune cells obtained by the above preparation method in the preparation of adoptive immunotherapy products.

[0148] In certain embodiments, the present invention provides use of the above-mentioned pharmaceutical composition in the preparation of adoptive immunotherapy products.

[0149] In certain embodiments, the adoptive immunotherapy product is used to prevent and / or treat tumors.

[0150] In certain embodiments, the tumor is one or more of lung cancer, liver cancer, breast cancer, colorectal cancer, nasopharyngeal cancer, kidney cancer, lymphoma, ovarian cancer, gastric cancer, pancreatic cancer, multiple myeloma, glioma, prostate cancer, cervical cancer, bile duct cancer, esophageal cancer or melanoma.

[0151] In certain embodiments, the adoptive immunotherapy product is used to prevent and / or treat infectious diseases.

[0152] In certain embodiments, the adoptive immunotherapy product is used to prevent and / or treat an autoimmune disease.

[0153] the term

[0154] In order to more easily understand the present disclosure, some terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms should have the meaning given below. Other definitions are set forth throughout the application.

[0155] The term "about" can refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0156] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0157] As used herein, KLHL6 is a member of the Kelch superfamily protein. In mammals, it is the third BTB / Kelch protein described after Keap1 and KLHL10. KLHL6 is located on human chromosome 3q27.1, is 6.3 kbp long, and contains 7 exons. The amino terminus of the KLHL6 protein has a BTB / POZ domain, the carboxyl terminus has a repeating domain composed of 5 Kelch conformations, and the middle part also contains a BTB domain.

[0158] As used herein, sequence identity or homology is determined by comparing two aligned sequences along a predetermined comparison window (which can be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of a reference nucleotide sequence or protein), and determining the number of positions at which identical residues occur. Typically, this is expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a method well known to those skilled in the art.

[0159] As used herein, the term "overexpression" in the embodiments of the present invention means that the cell itself does not express (or expresses at a low level) KLHL6, and by adopting methods such as transfection of exogenous viruses or drug induction, the cell is made to additionally express the KLHL6 gene on the basis of the existing expression level, so that the amount of KLHL6 expressed by the cell exceeds its original expression level.

[0160] As used herein, the term "chimeric antigen receptor (CAR)" consists of an extracellular antigen recognition domain, a transmembrane domain, and an intracellular signaling domain. Currently commercialized CAR-T products are mainly based on the second-generation CAR structure, containing costimulatory domains such as CD28, 4-1BB, OX40 or ICOS, which enable them to have better proliferation ability and release more cytokines.

[0161] As used herein, the term "T cell receptor (TCR)" is a heterodimeric membrane protein on the surface of T cells that specifically recognizes antigens and mediates immune responses. TCR includes two receptors, αβ and γδ. About 95% of human peripheral blood T lymphocytes express αβ chain receptors. αβTCR mediates T cell immune function by binding to the major histocompatibility complex (MHC) on antigen presenting cells (APC) and activating TCR downstream signaling pathways. TCR-T cells can not only recognize specific antigens on the surface of tumor cells, but also recognize antigens in cells, which enables TCR-T cells to recognize a wider spectrum of antigens. Specifically, the T cell receptors (TCR) used in the present invention are OT-1TCR and 1G4 TCR. OT-1TCR can recognize the tumor antigen OVA, and 1G4 TCR can recognize the tumor antigen NY-ESO-1.

[0162] As used herein, the term "T cell" refers to a cell having a TCR on the cell surface or a TCR gene-edited or modified cell. In the present invention, "T cells" include but are not limited to CD4 + T cells, CD8 + T cells, γδT cells, STAR-T cells, TCR-T cells and CAR-T cells.

[0163] As used herein, the term "CD3" has five peptide chains, namely, γ chain, δ chain, ε chain, ζ chain and η chain, all of which are transmembrane proteins. The transmembrane region of the CD3 molecule is connected to the transmembrane region of the two peptide chains of the TCR through a salt bridge to form a TCR-CD3 complex, which jointly participates in the recognition of antigens by T cells. The activation signal generated by TCR recognition of antigens is transduced into T cells by CD3, and is mainly used to mark thymocytes, T lymphocytes and T cell lymphomas. In the present invention, "CD3ε antibody" refers to a monoclonal antibody that can bind to the CD3ε subunit and activate T cells.

[0164] As used herein, the term "CD28" as a co-stimulatory molecule participates in the reception of the second signal and plays an important role in the activation of T cells. It binds to the B7 molecule on the APC (antigen presenting cell), mediates the co-stimulation of T cells and promotes their survival, proliferation and cytokine production. In the present invention, "CD28 antibody" refers to a monoclonal antibody that can bind to the CD28 molecule and activate T cells.

[0165] As used herein, the term "cytokine" generally refers to a class of small molecule proteins with a wide range of biological activities that are synthesized and secreted by immune cells (such as monocytes, macrophages, T cells, B cells, NK cells, etc.) and certain non-immune cells (endothelial cells, epidermal cells, fibroblasts, etc.) upon stimulation. The cytokine may have multiple functions such as regulating innate immunity and adaptive immunity, hematopoiesis, cell growth, APSC multipotent cells, and damaged tissue repair. In the present invention, the cytokine may include interleukins, interferons, tumor necrosis factor superfamily, colony stimulating factors, chemokines, and growth factors.

[0166] As used herein, the term "interleukin" generally refers to a secretory protein or signaling molecule that can promote the development and differentiation of T and / or B lymphocytes and / or hematopoietic cells. Interleukins can be synthesized by helper CD4 T lymphocytes, monocytes, macrophages and endothelial cells. As in the present invention, interleukin 2 (IL-2) is a cytokine that is mainly synthesized by T cells and plays an important role in the body's immune response and antiviral infection, and can be used for clinical research and tumor treatment.

[0167] As used herein, the term "RetroNectin" is a recombinant human fibronectin. In the process of gene introduction and lymphocyte expansion culture, the use of RetroNectin can effectively improve the infection efficiency of mammalian cells infected by retrovirus or lentivirus, and at the same time it can also stimulate lymphocyte expansion. Therefore, It is widely used in gene therapy clinical trials. For example, in tumor immunotherapy (CAR-T / TCR), RetroNectin can assist in gene introduction and T cell expansion culture.

[0168] As used herein, the term "Matrigel" is a soluble extracellular matrix extracted from Engelbreth-Holm-Swarm (EHS) mouse sarcoma (a tumor rich in extracellular matrix proteins), including: ECM proteins such as laminin (main component), type IV collagen, heparan sulfate proteoglycans, nestin and a variety of growth factors. It can effectively promote the adhesion and differentiation of normal and transformed anchorage-dependent epithelial cells and other types of cells.

[0169] As used herein, the term "B16-OVA cells (mouse melanoma cells, highly expressing OVA antigen peptide)" refers to malignant melanoma, which is a highly malignant tumor derived from melanocytes, mostly occurring in the skin, but also in mucosa and internal organs, accounting for about 3% of all tumors. It is caused by excessive proliferation of abnormal melanocytes and is extremely malignant.

[0170] The “conventional biological methods in this field” involved in the present invention can refer to the corresponding methods recorded in public publications such as “Current Protocols in Molecular Biology (published by Wiley)” and “Molecular Cloning: A Laboratory Manual (published by Cold Spring Harbor Laboratory)”.

[0171] In order to enable those skilled in the art to clearly understand the implementation details and operations of the present invention, and to significantly demonstrate the improved performance of the embodiments of the present invention and its applications, the above technical solutions are illustrated by multiple embodiments below.

[0172] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0173] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0174] Example 1 Construction of OT-1T cells overexpressing KLHL6 and in vitro activation and apoptosis detection

[0175] (1) Construct a plasmid vector expressing KLHL6 protein. Using the retroviral vector plasmid MSGV-Thy1.1-P2A-Vector, according to the principle of molecular cloning, the CDS sequence of the mouse KLHL6 gene, as described above, SEQ ID NO: 1, was connected to the plasmid vector using restriction endonuclease digestion and T4 ligase ligation. MSGV-Thy1.1-P2A-vector was used as a control plasmid. The plasmid expressing KLHL6 or empty vector and the virus packaging plasmid were transfected into HEK293T cells to obtain virus liquid expressing KLHL6 or empty vector.

[0176] (2) Activation and infection of OT-1 T cells. In this example, mouse OT-1 T cells were used. The spleen of healthy OT-1 mice was isolated, ground, and red blood cells were lysed according to the kit MojoSort Mouse CD8 Isolation Steps of T Cell Isolation Kit CD8 + T. Got CD8 + T cells were 1×10 6 The number of cells / well was placed in a 24-well plate coated with anti-mouse CD3ε (2μg / mL, 300μL / well, overnight at 4°C), and anti-mouseCD28 (1μg / mL, 300μL / well) antibody and mouse IL-2 (final concentration of 30U / mL) were added for activation. OT-1T cells activated for 24h were collected, centrifuged and counted, and the cell density was adjusted to 1.5×10 6 / mL. Add 500μL of KLHL6-expressing virus solution to a 24-well low-adsorption plate coated with Retronectin (15μg / mL, 250μL / well, overnight at 4℃), and then add 500μL of cell suspension. Centrifuge at 30℃, 2500rpm for 90min for the first infection. 24h after the infection, aspirate 500μL of cell supernatant, and add 500μL of virus solution for the second infection, that is, obtain OT-1T cells overexpressing KLHL6. Detect the infection efficiency 48h after the infection, and subculture every 1-2 days according to the cell growth status to maintain normal growth requirements.

[0177] (3) Activation and apoptosis detection of OT-1T cells overexpressing KLHL6. OT-1T cells were activated 24h and 48h after the second infection. The activation markers detected were CD44, CD69 and CD25. Compared with the control group (overexpression empty load), it was found that overexpression of KLHL6 did not affect T cell activation ( Figure 1, A). The cells were cultured normally until the 6th day, and cell apoptosis was detected. It was found that compared with the control group, overexpression of KLHL6 did not affect T cell apoptosis ( Figure 1 , B). This indicates that KLHL6 is suitable for transformation of a wider range of T cell types and has no toxic side effects during the expansion process.

[0178] Example 2 Detection of anti-tumor function of OT-1T cells overexpressing KLHL6 in vivo

[0179] (1) Construction of a mouse B16-OVA tumor-bearing mouse model. Prepare B16-OVA tumor cells, remove dead cells, ensure that the viable cell rate is above 95%, resuspend in 1× PBS after centrifugation, count the cells and adjust to the required cell density. Mix the cell suspension and matrix gel at a ratio of 1:1 on ice and blow evenly. Inoculate 0.2×10 cells / mL of each C57BL / 6N mouse subcutaneously. 6 When the tumor volume of the tumor-bearing mice reached 100mm 3 Adoptive T cell therapy was performed around 14:00 pm, and mice were irradiated (5 Gy) one day before the adoptive transfer. The adopted OT-1 T cells were obtained and activated and infected according to the method in step (2) of Example 1. If necessary, flow cytometry was performed to obtain positive cells with an infection efficiency of 90-100%. The cells were cultured normally until the 6th day, and the cells were collected and dead cells were removed. The cell density was adjusted and 3×10 cells were injected into the tail vein of each mouse. 6 The mice bearing the tumors were adoptively treated with 100 μL of cell suspension per 200 μL of cell suspension. The experimental design included three groups: experimental group (KLHL6, T cells overexpressing KLHL6), control group (Control, T cells overexpressing empty vector), and PBS group, with 7 mice in each group. The day of adoptive T cell transfer was defined as day 0 for C57BL / 6N mice. The length and width (mm) of the tumors were measured every 2 days thereafter, and the tumor volume (mm) was calculated according to the following formula. 3 ). When the mouse tumor volume exceeds 1500mm 3 Mice need to be euthanized by CO2.

[0180]

[0181] (2) Tumor volume and survival cycle curves were drawn based on tumor volume and mouse survival cycle. CD8 + The proportion of T cells overexpressing KLHL6 was statistically analyzed. + T cells have a significant function in inhibiting tumor growth ( Figure 2 , A), and can significantly prolong the survival of mice ( Figure 2 , B). In addition, overexpression of KLHL6 can significantly increase tumor-infiltrating CD8+ The proportion of T cells ( Figure 2 , C and Figure 2 , D), while increasing tumor-draining lymphocytes and CD8 + The proportion of T cells ( Figure 2 , E and Figure 2 , F). These results indicate that T cells transformed by KLHL6 have significant anti-tumor function.

[0182] Example 3 Detection of exhaustion phenotype of OT-1T cells overexpressing KLHL6 in vivo

[0183] (1) Construction of a mouse B16-OVA tumor-bearing mouse model. OT-1 T cells for adoptive therapy were prepared as described in Example 1, and a tumor model was constructed as described in Example 2. Experimental design: There were three groups: experimental group (KLHL6, T cells overexpressing KLHL6), control group (Control, T cells overexpressing empty vector), and PBS group, with 7 mice in each group.

[0184] (2) After 14 days of adoptive treatment, the mice were anesthetized and killed to obtain tumor tissue, tumor-draining lymph nodes and spleen. The tumor tissue was ground, digested with collagenase and filtered to prepare a single-cell suspension, and the tumor-infiltrating T lymphocytes were separated by density gradient centrifugation; the tumor-draining lymph nodes and spleen tissues were ground and filtered to prepare a single-cell suspension, and finally the expression of related exhaustion markers and the secretion of cytokines were detected by flow cytometry. The results showed that KLHL6 overexpression inhibited terminally exhausted T cells (PD-1 + TIM-3 + and TIM-3 + LAG-3 + )Subgroup formation ( Figure 3 , A and Figure 3 , B), increased the expression of T cell stemness-related factor TCF-1 ( Figure 3 , D), while reducing the expression of exhaustion driver TOX ( Figure 3 , C). These results indicate that overexpression of KLHL6 significantly inhibited the tumor-infiltrating CD8 + T cell exhaustion. Cytokine detection results showed that overexpression of KLHL6 significantly promoted the production of IFN-γ and TNF-α, indicating that overexpression of KLHL6 relatively maintained the effector function of tumor-infiltrating T cells ( Figure 3 , E). Further analysis revealed that overexpression of KLHL6 increased the expression of memory T cells (CD44 + CD62L + ) ratio( Figure 3 , F and Figure 3, G), which is consistent with the enhanced anti-tumor immune response. The above results indicate that overexpression of KLHL6 can inhibit the exhaustion of tumor-infiltrating T cells and enhance their anti-tumor ability.

[0185] Example 4 In vivo anti-tumor function detection of TCR-T cells overexpressing human KLHL6

[0186] (1) Construct a plasmid vector expressing KLHL6 protein. Using the retroviral vector plasmids MSGV-NGFR-P2A-Vector and MSGV-Thy1.1-P2A-Vector, according to the principle of molecular cloning, the CDS sequence of the human KLHL6 gene (SEQ ID NO: 2 as described above) and the 1G4 TCR sequence were connected to the plasmid vectors respectively using restriction endonuclease digestion and T4 ligase ligation. MSGV-NGFR-P2A-vector was used as a control plasmid. The plasmid expressing KLHL6 or empty vector and the virus packaging plasmid were transfected into HEK293T cells to obtain virus liquid expressing KLHL6 or empty vector.

[0187] (2) Activation and infection of human PBMC. An equal volume of DPBS (Dulbecco's Phosphate Buffered Saline) or saline was added to the peripheral blood collected from the vein for dilution (1:1), and then slowly added to a flow cytometry tube containing lymphocyte separation fluid (Ficoll or Histopaque-1077). Centrifuge at 800 g for 20 min, aspirate the cells above the lymphocyte separation fluid, transfer to a new centrifuge tube, add 1640 culture medium, centrifuge and discard the supernatant. Keep the cell pellet at the bottom of the centrifuge tube to obtain peripheral blood mononuclear cells. The peripheral blood mononuclear cells obtained were counted at 1×10 6 Each well was added to a 24-well plate coated with anti-human CD3 (1 μg / mL, 300 μL / well, overnight at 4°C), and anti-human CD28 (1 μg / mL, 300 μL / well) antibody and IL-2 at a final concentration of 300 U / mL were added for activation. When the T cells were activated for 48 hours, 500 μL of supernatant was discarded, 500 μL of virus solution was added, centrifuged at 2500 rpm for 90 minutes, and cultured for 24 hours. The solution was changed to obtain human T cells overexpressing KLHL6. In this embodiment, human 1G4 TCR-T cells were used, which were obtained by adding the corresponding virus solution in equal proportions and infecting them simultaneously. If T cells co-expressing CAR / STAR / other tumor-targeting receptors are to be obtained, the corresponding virus solution is added in equal proportions and infected simultaneously. The method for constructing the virus solution in this embodiment is basically the same as step (1) of Example 1, except that the nucleotide sequence of the KLHL6 gene is expressed, as shown in SEQ ID NO:2 as described above.

[0188] (3) Humanized NCG mouse tumor model. Prepare NY-ESO-HepG2 tumor cells, remove dead cells, ensure that the viable cell rate is above 95%, resuspend in 1× PBS after centrifugation, count cells and adjust to the required cell density. Mix the cell suspension and matrix gel at a ratio of 1:1 on ice and blow evenly. Inoculate 4×10 cells per NCG mouse subcutaneously. 6 When the tumor volume of NCG mice reached 100mm 3 Adoptive T cell therapy was performed around 14:00 p.m., and mice were irradiated (1 Gy) one day before the adoptive transfer. The adopted PBMC cells were activated and infected according to the method in (1) above to obtain 1G4 TCR-T cells overexpressing KLHL6. If necessary, flow cytometry was performed to obtain positive cells with an infection efficiency of 100%. The cells were cultured normally until the 12th day, and the cells were collected and dead cells were removed. The cell density was adjusted and 5×10 cells were injected into the tail vein of each mouse. 6 The mice were adoptively treated with 1G4 TCR-T cells / 200 μL cell suspension. Experimental design Experimental group (KLHL6, 1G4 TCR-T cells overexpressing KLHL6) and control group (Control, 1G4 TCR-T cells overexpressing empty vector), 8 mice in each group. The day of adoptive T cell transfer in NCG mice was taken as day 0. The length and width (mm) of the mouse tumor were measured every 2 days thereafter, and the tumor area (mm) was calculated according to the following formula 2 ).

[0189] Tumor area(mm2)=length×width

[0190] When the tumor area of ​​mice exceeds 150mm 2 Mice were euthanized with CO2 and tumor growth curves were plotted. The ratio of tumor-infiltrating T lymphocytes to T cells in the blood was statistically analyzed. The results showed that overexpression of KLHL6 could effectively inhibit tumor growth and significantly increase tumor-infiltrating CD8 + TCR-T cells and CD4 + The proportion of TCR-T cells ( Figure 4 , AD), while increasing CD8 + TCR-T cells and CD4 + The proportion of TCR-T cells ( Figure 4 , E and Figure 4 , F). This indicates that 1G4 TCR-T cells transformed with KLHL6 have significant anti-tumor ability.

[0191] Example 5 Detection of in vivo exhaustion phenotype of TCR-T cells overexpressing KLHL6

[0192] (1) Construction of humanized NCG mouse tumor (NY-ESO-HepG2 tumor) model. 1G4 TCR-T cells for adoptive therapy were prepared and NY-ESO-HepG2 tumor model was constructed as described in Example 4 above.

[0193] (2) After 21 days of adoptive treatment of NCG mice, the mice were anesthetized and killed to obtain tumor tissue and blood. The tumor tissue was ground, digested with collagenase and filtered to prepare a single-cell suspension, and the tumor-infiltrating TCR-T lymphocytes were separated by density gradient centrifugation; the blood was lysed with erythrocyte lysis fluid to obtain a single-cell suspension; the spleen tissue was ground and filtered to prepare a single-cell suspension. Finally, flow cytometry was used to detect the expression of related exhaustion markers and the secretion of cytokines. The results showed that KLHL6 overexpression significantly inhibited the expression of exhaustion molecules LAG-3 and TIM-3 in adoptive TCR-T cells ( Figure 5 , A and Figure 5 , B), and significantly reduced the expression of transcription factor TOX ( Figure 5 , C). Cytokine detection results showed that overexpression of KLHL6 relatively maintained the effector function of tumor-infiltrating T cells, and the expression of IFN-γ and TNF-α was significantly increased ( Figure 5 , D). These results indicate that overexpression of KLHL6 significantly inhibited the exhaustion of tumor-infiltrating TCR-T cells. Further analysis revealed that overexpression of KLHL6 increased the expression of Tcm (CD62L + CD45RA - ) ratio( Figure 5 , E), Similarly, overexpression of KLHL6 also significantly enhanced the expression of tumor-infiltrating CD4 + TCR-T and CD8 + Tcm (CD27 + CD45RO + ) and Tem(CD27 - CD45RO + ) ratio( Figure 5 , F). This phenomenon is consistent with the enhanced anti-tumor immune response. The above results indicate that overexpression of KLHL6 can inhibit the exhaustion of tumor-infiltrating TCR-T cells and enhance their anti-tumor ability.

[0194] It should be understood that the above embodiments are exemplary and are not intended to include all possible implementations included in the claims. Various modifications and changes may be made on the basis of the above embodiments without departing from the scope of the present disclosure. Similarly, the various technical features of the above embodiments may be arbitrarily combined to form other embodiments of the present invention that may not be explicitly described. Therefore, the above embodiments only express several implementations of the present invention and do not limit the scope of protection of the patent of the present invention.

Claims

1. A recombinant immune cell, characterized in that: The recombinant immune cells express the KLHL6 gene.

2. The recombinant immune cell according to claim 1, characterized in that The nucleotide sequence encoding the KLHL6 gene is selected from the following group: (1) the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2; (2) having ≥95% homology, preferably ≥98%, more preferably ≥99% homology with the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2; or (3) A nucleotide sequence complementary to the nucleotide sequence described in any one of (1) or (2).

3. The recombinant immune cell according to claim 1 or 2, characterized in that The recombinant immune cells are immune cells derived from mammals, preferably immune cells derived from humans or mice.

4. The recombinant immune cell according to claim 3, characterized in that The immune cells are selected from at least one of peripheral lymphocytes, tumor-infiltrating lymphocytes, monocytes and tissue-resident lymphocytes; Preferably, the immune cells are selected from T cells and peripheral blood mononuclear cells; More preferably, the T cells are selected from at least one of CD4+T cells, CD8+T cells and γδT cells.

5. The recombinant immune cell according to any one of claims 1 to 4, characterized in that The recombinant immune cells include one or more structures for adoptive cell therapy.

6. The recombinant immune cell according to claim 5, characterized in that The corresponding structure for adoptive cell therapy is a chimeric antigen receptor (CAR) structure, a T cell antigen receptor (TCR) structure, a receptor structure based on ligand receptor binding or a synthetic T cell receptor and antigen receptor (STAR).

7. A method for preparing a recombinant immune cell according to any one of claims 1 to 6, characterized in that: include: (1) Construction of KLHL6 gene expression vector; (2) packaging the expression vector obtained in step (1) with a virus; (3) Infecting immune cells with the virus obtained in step (2).

8. The preparation method according to claim 7, characterized in that: The nucleotide sequence encoding the KLHL6 gene is selected from the following group: (1) the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2; (2) having ≥95% homology, preferably ≥98%, more preferably ≥99% homology with the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2; or (3) a nucleotide sequence complementary to the nucleotide sequence described in any one of (1) or (2); Preferably, the expression vector includes a gene sequence corresponding to a structure used for adoptive cell therapy, preferably including a gene sequence corresponding to a CAR structure, a TCR structure, or a STAR structure acting on a target site; Preferably, the immune cells are derived from mammals, preferably from humans or mice, more preferably from human or mouse T cells or peripheral blood mononuclear cells; most preferably from human or mouse CD4+T cells, CD8+T cells, γδT cells or peripheral blood mononuclear cells; Preferably, when the immune cells are of mouse origin, the immune cells in step (3) are activated and / or cultured by anti-CD3ε, anti-CD28 antibodies and cytokines, wherein the anti-CD3ε, anti-CD28 antibodies and cytokines are derived from mice; and / or, When the immune cells are of human origin, the immune cells in step (3) are activated and / or cultured by anti-CD3, anti-CD28 antibodies and cytokines, wherein the anti-CD3, anti-CD28 antibodies and cytokines are derived from humans; Preferably, the cytokine is selected from at least one of IL-2, IL-5, IL-7, IL-15, IL-17 and IL-21; preferably at least one of IL-2, IL-15 and IL-7; more preferably IL-2 and / or IL-7; Preferably, the concentrations of the anti-CD3ε and anti-CD28 antibodies of mouse origin are independently 1 to 2 μg / mL; and / or, the concentrations of the anti-CD3 and anti-CD28 antibodies of human origin are independently 1 to 2 μg / mL; Preferably, the final concentration of the cytokine is 30 to 1500 IU; preferably 30 to 1000 IU; more preferably 30 to 500 IU; most preferably 30 to 400 IU.

9. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the recombinant immune cell according to any one of claims 1 to 6 or the recombinant immune cell obtained by the preparation method according to claim 7 or 8.

10. Use of the recombinant immune cell according to any one of claims 1 to 6, the recombinant immune cell obtained by the preparation method according to claim 7 or 8, or the pharmaceutical composition according to claim 9 in the preparation of an adoptive immunotherapy product. Preferably, the adoptive immunotherapy product is used to prevent and / or treat tumors, infectious diseases and autoimmune diseases; Preferably, the tumor is one or more of lung cancer, liver cancer, breast cancer, colorectal cancer, nasopharyngeal cancer, kidney cancer, lymphoma, ovarian cancer, gastric cancer, pancreatic cancer, multiple myeloma, glioma, prostate cancer, cervical cancer, bile duct cancer, esophageal cancer or melanoma.

Images