Lysophospholipase mutant

Abstract

The invention belongs to the technical field of gene engineering and protein modification, and particularly provides a lysophospholipase mutant and application thereof. The mutant is obtained by mutating the 128 amino acid of wild-type lysophospholipase with an amino acid sequence of SEQ ID NO: 1 from Cys to Thr, and the specificity of hydrolyzing phosphatidylcholine 2-acyl is remarkably improved. In lysophosphatide generated by hydrolyzing soybean phospholipid by the mutant, the content of sn-1-lysophosphatidylcholine reaches 49.82%-50.26%, and sn-2-lysophosphatidylcholine is almost not generated, so that an unexpected technical effect is achieved.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and protein modification, and specifically relates to a lysophospholipase mutant. Background Art

[0002] Soybean lecithin is a product extracted from the oil foot of soybean oil production. It is a mixed lecithin, composed of phosphatidylcholine (lecithin, referred to as PC, high-grade PPC), phosphatidylethanolamine (cephalin, referred to as PE), phosphatidylinositol (inositol phospholipids, referred to as PI), phosphatidylserine (serine phospholipids, referred to as PS) and other ingredients, among which the first three are the most typical. Soybean lecithin not only has strong emulsification, wetting and dispersing effects, but also plays an important role in promoting fat metabolism, muscle growth, nervous system development and anti-oxidative damage in the body, and can be widely used in feed.

[0003] Lysophospholipids are made from soybean lecithin. Under the catalysis of phospholipase, a fatty acyl group is removed from phosphatidylcholine (lecithin) in soybean lecithin and converted into lysophosphatidylcholine. Lysophospholipids are more polar than ordinary phospholipids and can produce smaller micelles in water, which means better emulsification performance. In addition, the unsaturated double bonds of lysophospholipids are reduced and the stability is improved. Therefore, they have good emulsification stability in low pH, high temperature and high ion concentration environments. More importantly, lysophospholipids also have three important physiological functions: ① regulating the composition, morphology and physiological function of cell membranes; ② activating multiple cell signal transduction pathways through G protein-coupled receptors, thereby promoting cell proliferation and differentiation; ③ regulating fat metabolism, transporting fat in the liver together with cholesterol and protein, removing fat deposits in the liver, and preventing fatty liver.

[0004] Lysophospholipids, as functional additives modified from phospholipids, can significantly improve animal growth performance, increase the body's absorption and utilization of nutrients, and improve the body's intestinal morphology and function. Through comprehensive adjustments to feed formulas, feed quality can be further improved, formula costs can be saved, and the profitability of feed companies can be increased.

[0005] In the production process of lysophospholipids, phospholipase catalyzes the hydrolysis of the 1-acyl group of phosphatidylcholine (lecithin) to obtain the product sn-2 lysophosphatidylcholine, and hydrolyzes its 2-acyl group to obtain the product sn-1 lysophosphatidylcholine. Among them, sn-2 lysophosphatidylcholine is unstable and is easily decomposed due to the influence of solvent polarity, temperature, solvent pH, hydrolysis time, etc. Therefore, it is necessary to modify phospholipase to enhance its specificity for hydrolyzing the 2-acyl group of phosphatidylcholine, thereby improving the conversion rate of sn-1 lysophosphatidylcholine and improving the stability of lysophospholipids. Summary of the invention

[0006] The invention aims to provide a lysophospholipase mutant, which significantly improves the specificity of hydrolyzing the 2-acyl group of phosphatidylcholine and the conversion rate of sn-1-lysophosphatidylcholine, and can be widely used in the production of lysophospholipids.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: The present invention provides a lysophospholipase mutant having any one of the amino acid sequences shown in (I), (II) or (III): (I) a sequence having at least 70% homology to the amino acid sequence of lysophospholipase SEQ ID NO: 1; (II) having at least one amino acid mutation of the lysophospholipase described in (I), and the amino acid mutation of the lysophospholipase is an amino acid sequence obtained by modification, substitution, deletion or addition of one or more amino acids; (III) an amino acid sequence encoded by the nucleotide sequence as shown in SEQ ID NO: 2 or its complementary sequence, or a sequence that is different from the nucleotide sequence as shown in SEQ ID NO: 2 or its complementary sequence due to the degeneracy of the genetic code; In other embodiments of the present invention, the substitution is the substitution of one amino acid.

[0008] In other embodiments of the present invention, the substitution includes changing the 95th amino acid of the lysophospholipase with the amino acid sequence of SEQ ID NO: 1 from His to Val.

[0009] In other embodiments of the present invention, the substitution includes changing the 128th amino acid of the lysophospholipase with the amino acid sequence of SEQ ID NO: 1 from Cys to Thr.

[0010] The present invention also provides a DNA molecule encoding the above lysophospholipase mutant.

[0011] The present invention also provides a recombinant expression vector comprising the above DNA molecule.

[0012] The present invention also provides a host cell comprising the above recombinant expression vector.

[0013] The host cell is Pichia pastoris ( Pichia pastoris ).

[0014] The host cell is Aspergillus niger ( Aspergillus niger ).

[0015] The host cell is Trichoderma reesei ( Trichoderma reesei ).

[0016] The present invention also provides the use of the lysophospholipase mutant in the preparation of lysophospholipids.

[0017] Compared with the wild type, the lysophospholipase mutants provided by the present invention, which respectively contain H95V and C128T single-point mutations, have significantly improved hydrolysis specificity for the 2-acyl group of phosphatidylcholine. After reacting at 70°C for 2 h, the content of sn-1-lysophosphatidylcholine in the lysophospholipids generated by the lysophospholipase single-point mutant hydrolyzing soybean phospholipids reached 49.82%-50.26%, and sn-2-lysophosphatidylcholine was almost not generated, achieving unexpected technical effects. The lysophospholipase mutants provided by the present invention can be widely used in the production of lysophospholipids, and have broad prospects. DETAILED DESCRIPTION

[0018] The method of the present invention is further described below with reference to examples. The experimental methods in the following examples that do not specify specific conditions can usually be operated under conventional conditions, such as the conditions described in the "Molecular Cloning Experiment Guide" compiled by J. Sambrook et al., or under the conditions recommended by the manufacturer. Those skilled in the art can better understand and grasp the present invention with the help of the examples. However, the protection and claims of the present invention are not limited to the specific cases provided, but should include the protection scope that can be expanded by those skilled in the art on the basis of this specification without creative work.

[0019] Experimental materials and reagents: Enzymes and kits: PCR enzyme and ligase were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.

[0020] Culture medium formula: Escherichia coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0; LB+Amp medium: LB medium plus 100 μg / mL ampicillin; LB+Kana medium: LB medium plus 50 μg / mL kanamycin; The present invention is described in detail below with reference to the embodiments.

[0021] Example 1 Preparation of wild-type lysophospholipase 1. Expression vector construction From Aspergillus niger ( Aspergillus niger) was named PLA2, its nucleotide sequence was SEQ ID NO: 1, and the encoded amino acid sequence was SEQ ID NO: 2.

[0022] The PCR primers designed at the 5' end of the gene contain a KpnI endonuclease site, and the PCR primers designed at the 3' end contain an XbaI endonuclease site. The primer sequences are as follows: PLA2-F: GCA GGTACC ATGAAGAACATCTTCGTTGCC (underlined is the restriction endonuclease KpnI recognition site); PLA2-R: GGC TCTAGA TTACTCGTCGACGGCGAAGCG (the underline indicates the restriction endonuclease XbaI recognition site).

[0023] Using the genomic DNA of Aspergillus niger as a template, PCR amplification was performed with the above primers. The PCR amplification system was: template 1 μL, upstream primer PLA2-F 1 μL, downstream primer PLA2-R 1 μL, 5×PS Buffer 10 μL, dNTPs (2.5 mM) 4 μL, Primer-Star DNA polymerase 1 μL, ddH2O 32 μL, and the total reaction system was 50 μL. The PCR cycle program was: pre-denaturation at 95°C for 5 min, 30 cycles: 94°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec, 72°C for 10 min; the PCR product was recovered from the gel, digested with KpnI and XbaI, and then connected with the pSE vector digested with the same enzymes at 16°C overnight and transformed into Escherichia coli DH5a, spread on LB+Amp plates, and cultured inverted at 37°C. After the transformants appeared, the positive clones were verified by colony PCR, and the correct recombinant plasmid pSE-PLA2 was finally obtained after sequencing verification.

[0024] 2. Recombinant expression of wild-type lysophospholipase Protoplast preparation: Inoculate the Aspergillus niger host on a PDA+U plate and culture at 30℃ for 5-7 days. Cut a 2cm×2cm block and inoculate it in 100mL of liquid PDA+U medium. Culture it at 30℃ for 24h to grow mycelium for transformation. Filter the grown mycelium, resuspend it with 20mL of 1.2M magnesium sulfate solution, and add 0.2g of lysozyme. Culture it at 30℃ and 100rpm for 2-3h. Filter the lysed mycelium with 2 layers of lens paper and centrifuge it at 3000rpm for 10min to obtain protoplasts.

[0025] Transformation: The protoplasts were washed twice with 1.2 M sorbitol solution and then resuspended with an appropriate amount of sorbitol solution to make the protoplast concentration reach 10 8CFU / mL. Add 10uL of prepared plasmid to 200uL protoplasts, add 50uL of 25% PEG6000, ice bath for 20min, then add 2mL of 25% PEG6000 and place at room temperature for 5min, add 4mL of sorbitol solution and mix by inversion. Pour 50mL of transformation upper layer culture medium, pour into 4 transformation lower layer plates, wait for the upper layer culture medium to solidify, and invert and culture in a 30℃ incubator for 5d.

[0026] Transformant screening: After 5 days of culture, pick the grown colonies and plant them on the lower transformation plate for rescreening, and culture at 30℃ for 2 days. Inoculate the normally growing transformants onto fresh PDA plates and culture at 30℃ for 5-7 days. Cut 2cm×2cm bacterial blocks from each transformant and inoculate them into 50mL liquid shake flask culture medium for fermentation. Culture at 32℃ for 5 days, add appropriate amount of ammonia water every day, and control the pH at about 4.5. After 5 days of culture, centrifuge the bacteria to obtain the supernatant, which is the crude enzyme solution. Use the phospholipase A2 kit to detect the enzyme activity and screen out the transformants expressing lysophospholipase.

[0027] The Aspergillus niger engineered strain with the highest expression of lysophospholipase obtained by screening was named Su2-PLA2. Under shake flask fermentation conditions, the enzyme activity of lysophospholipase in its fermentation supernatant reached 582 u / mL.

[0028] Lysophospholipase activity assay (1) Definition of enzyme activity unit The amount of enzyme required to hydrolyze 2-thiohexadecanoylethylphosphocholine (HEPC) to produce 1 nmol of free sulfhydryl group per minute at 37°C and pH 7.0 is defined as one enzyme activity unit (U).

[0029] (2) Enzyme activity determination steps Add 100 uL of diluted enzyme solution to the sample tube, then add 300 uL of substrate solution (HEPC) and 600 uL of colorimetric solution (5,5'-dithiobis(2-nitrobenzoic acid) DTNB), mix thoroughly, react at 37°C for 10 min, adjust to zero with distilled water in a 1 mL glass cuvette, and measure the absorbance at 412 nm, which is A1.

[0030] For a blank control, add 100 uL of diluted enzyme solution to the sample tube, then add 900 uL of substrate solution (HEPC), mix thoroughly, react at 37°C for 10 min, adjust to zero with distilled water in a 1 mL glass cuvette, and measure the absorbance at 412 nm, which is A2.

[0031] (3) Calculation of enzyme activity The activity of lysophospholipase was calculated according to the following formula: U=(A1-A2)×10×N / (ε×d) / T.

[0032] U——lysophospholipase activity, u / g or u / mL; A1——sample absorbance value; A2——blank control absorbance value; 10——Conversion factor, sample dilution multiple in the reaction system; N——sample dilution multiple before reaction; ε——TNB extinction coefficient, 13600L / mol / cm; d——light path of cuvette, cm; T——reaction time, 10 min.

[0033] Example 2 Preparation of Lysophospholipase Mutants In order to further improve the specificity of lysophospholipase PLA2 in hydrolyzing the 2-acyl group of phosphatidylcholine and improve the conversion rate of sn-1-lysophosphatidylcholine, the protein structure of lysophospholipase PLA2 was simulated and analyzed, and it was found that the amino acid sites that may be related to the hydrolysis of the 2-acyl group of phosphatidylcholine in lysophospholipase are histidine (His) at position 95 and cysteine ​​(Cys) at position 128. The amino acids at positions 95 and 128 in lysophospholipase were saturated and mutated to screen out the mutation sites that significantly improve the specificity of lysophospholipase in hydrolyzing the 2-acyl group of phosphatidylcholine.

[0034] Primers were designed and PCR was performed with pSE-PLA2 plasmid as template. The reactions were all carried out in 50 μL system under the following conditions: 94℃ pre-denaturation for 5 min; followed by 30 cycles (94℃ 30s, 56℃ 30s, 72℃ 7 min); 72℃ extension for 10 min; and finally 4℃ incubation. The PCR products were digested with DpnⅠ (Fermentas) and transformed into Escherichia coli JM109 competent cells. The transformation products were spread on LB plates containing 100 mg / L ampicillin and cultured at 37℃ overnight. Two single colonies were picked from the plates and inoculated into LB liquid medium. Plasmids were extracted 8 hours later and were sequenced correctly. The constructed plasmids were single-point mutants of lysophospholipase.

[0035] (2) Expression of mutant enzymes An Aspergillus niger engineered strain expressing a recombinant lysophospholipase single point mutant was constructed by referring to the method described in Example 1. Under shake flask conditions, the lysophospholipase activity in the fermentation supernatant was 550-650 u / mL.

[0036] Example 3 Analysis of the specificity of lysophospholipase mutants in hydrolyzing the 2-acyl group of phosphatidylcholine Weigh 95 g of soybean lecithin, add 5 g of water, stir thoroughly, and then add 1 mL of the fermentation supernatant of the Aspergillus niger engineering strain recombinantly expressing the single-point mutant of lysophospholipase described in Example 2, and react at 70°C for 2 h. After the reaction, samples were taken and the contents of sn-1-lysophosphatidylcholine and sn-2-lysophosphatidylcholine were detected according to the following method. At the same time, wild-type lysophospholipase PLA2 was used as a control.

[0037] Method for determination of sn-1-lysophosphatidylcholine and sn-2-lysophosphatidylcholine in enzyme-modified phospholipids (1) Sample preparation Weigh 50-100 mg of phospholipid sample, dissolve and dilute to 25 mL with 95% ethanol, centrifuge with a high-speed centrifuge, take the supernatant and filter it with a 0.45 μm fiber membrane, and prepare it for use immediately.

[0038] (2) HPLC conditions Amino column: 250 mm×4.6 mm; mobile phase: 95% ethanol: oxalic acid solution = 92:8, filtered through a 0.45 μm fiber membrane and degassed by ultrasonic treatment; flow rate: 1 mL / min; column temperature: 25°C.

[0039] (3) Standard curve Accurately weigh phosphatidylcholine, sn-1-lysophosphatidylcholine, and sn-2-lysophosphatidylcholine, respectively, dissolve them in 95% ethanol, dilute them, and prepare a series of standard solutions. The concentration of each phospholipid component in the standard solution is in the range of 0.05 mmol / L~2.0 mmol / L.

[0040] Use a microsyringe to accurately inject 10 μl of standard solution of each concentration, record the peak area, and draw a standard curve based on the peak area versus injection volume.

[0041] (4) Sample measurement Accurately inject 10 μl of sample solution with a micro syringe, perform chromatographic analysis and record the peak area. Qualitative analysis is performed based on retention time and quantitative analysis is performed using the external standard method to obtain the molar concentration c of sn-1-lysophosphatidylcholine and sn-2-lysophosphatidylcholine in the sample.

[0042] (5) Content calculation P = c × Mw × V × 0.1 / m.

[0043] P——the content of sn-1-lysophosphatidylcholine or sn-2-lysophosphatidylcholine in the sample, %; c——molar concentration of sn-1-lysophosphatidylcholine or sn-2-lysophosphatidylcholine measured by external standard method, mmol / L; Mw——the average value of the molar mass of sn-1-lysophosphatidylcholine or sn-2-lysophosphatidylcholine, g / mol; V——final volume of sample, mL; M——weighed sample mass, mg.

[0044] The test results showed that compared with the wild type, some mutations had no effect on the specificity of lysophospholipase PLA2 in hydrolyzing the 2-acyl group of phosphatidylcholine, and some mutations even reduced its substrate specificity. The mutation sites that were finally screened out to significantly improve the specificity of lysophospholipase PLA2 in hydrolyzing the 2-acyl group of phosphatidylcholine were H95V and C128T.

[0045] The contents of sn-1-lysophosphatidylcholine and sn-2-lysophosphatidylcholine produced by enzymatic hydrolysis of soybean lecithin by H95V single point mutant and C128T single point mutant are shown in Table 1.

[0046] Table 1 Analysis of the specificity of lysophospholipase in hydrolyzing the 2-acyl group of phosphatidylcholine name sn-1-lysophosphatidylcholine content sn-2-lysophosphatidylcholine content Wild-type PLA2 39.21% 11.30% H95V single point mutant 49.82% 1.09% C128T single point mutant 50.26% 0.83% From the results in Table 1, it can be seen that compared with the wild type, the specificity of the lysophospholipase mutant containing a single mutation site of H95V or C128T in hydrolyzing the 2-acyl group of phosphatidylcholine is significantly improved. After reacting at 70°C for 2 h, the wild-type lysophospholipase PLA2 hydrolyzes soybean phospholipids to generate lysophospholipids, and the content of sn-1-lysophosphatidylcholine is 39.21%, and the content of sn-2-lysophosphatidylcholine is 11.30%. In the lysophospholipids generated by the lysophospholipase single-point mutant hydrolyzing soybean phospholipids provided by the present invention, the content of sn-1-lysophosphatidylcholine reaches 49.82%-50.26%, and sn-2-lysophosphatidylcholine is almost not generated, achieving unexpected technical effects.

[0047] In summary, compared with the wild type, the lysophospholipase mutant screened and obtained in the present invention has better substrate specificity, which is conducive to its wide use in the preparation of lysophospholipids.

[0048] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A lysophospholipase mutant, characterized in that: The mutant is a lysophospholipase with an amino acid sequence of SEQ ID NO: 1, in which the 128th amino acid is changed from Cys to Thr.

2. A DNA molecule encoding the lysophospholipase mutant according to claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 3.

5. The host cell according to claim 4, characterized in that The host cell is Pichia pastoris ( Pichia pastoris ) or Aspergillus niger ( Aspergillus niger ) or Trichoderma reesei ( Trichoderma reesei ).

6. Use of the lysophospholipase mutant according to claim 1 in the production of lysophospholipids.