A KASP molecular marker related to early flowering traits in maize and its application
By developing the KASP molecular marker related to the early flowering trait of corn and using the ZCN7 gene mutation site to screen and identify corn varieties, the problem of screening for the early flowering trait of corn in the existing technology was solved, and efficient improvement of corn varieties and increase in yield were achieved.
Patent Information
- Application Number
- CN202510131513.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-06
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2045-02-06
AI Technical Summary
Existing technologies make it difficult to effectively screen and improve the early flowering traits of corn, which affects the corn growth period and yield formation.
A KASP molecular marker related to the early flowering trait of maize was developed. By detecting the G/A mutation at the Chr6:170682583 site of the ZCN7 gene, the KASP molecular marker was used to screen and identify early-flowering and late-flowering varieties, design primer sets and develop kits for maize variety improvement.
It has achieved efficient screening and identification of early flowering traits of corn, bred multiple excellent combinations, provided breeding directions for new corn varieties, and improved the ability to control corn yield and growth period.
Smart Images

Figure CN119842961B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of crop genetic breeding, and in particular to a KASP molecular marker related to the early flowering trait of corn and an application thereof. Background Art
[0002] Corn is my country's largest grain crop. In the Huanghuaihai region, grain production relies on a unique wheat-corn rotation system, with two crops per year. This significantly limits the production time of both corn and wheat. The current approved growing period for corn in these regions is generally around 105 days, with vegetative growth accounting for half of this time. While the time from flowering to maturity is short, it is crucial for yield formation. A shortened growing period primarily reduces yield due to a shortened grain-filling period and reduced kernel weight. During the growing period, the majority of leaf photosynthetic products are transported to the kernels to generate yield. The grain-filling period not only produces a large amount of dry matter but also primarily contributes to kernel development, directly impacting the economic efficiency of corn. Statistics show that 80% to 90% of corn kernel yield comes from photosynthetic products during the grain-filling period, with only 10% to 20% stored in organs such as the stem and leaf sheath prior to flowering and then transported to the kernels during the grain-filling period. Therefore, extending the corn growing period, increasing the duration of the grain-filling period, and increasing the intensity of the grain-filling period will result in higher corn yields. Therefore, breeding new corn varieties that bloom early and have a long growing period is of great significance for increasing corn grain yield and ensuring national food security.
[0003] Through long periods of evolutionary selection, maize evolved from teosinte to its modern form, producing two distinct inflorescences: male and female. As a monocot, the male inflorescence is produced from the apical meristem. During maize growth, the appearance of the spike at the top marks the onset of flowering and, consequently, reproductive growth.
[0004] Flowering in plants is an important trait related to environmental adaptability, regulated by both internal factors, such as the growth period, and environmental factors, such as temperature and photoperiod. In Arabidopsis, FT (Flower Locus T) and TFL1 (Terminal Flower 1) are key genes controlling flowering time. Both encode phosphatidylethanolamine-binding proteins, but a single amino acid difference in their protein sequences results in opposite functions: FT promotes flowering, while TFL1 inhibits it. In maize, there are 25 homologous genes to FT and TFL1, designated the ZCN genes (Zea centroradialis). Overexpression of four of these genes, ZCN1, ZCN2, ZCN4, and ZCN7, leads to delayed flowering; ZCN9, ZCN10, and ZCN15 are primarily expressed in the kernel; ZCN3 and ZCN6 influence tassel morphology; and overexpression of ZCN8 and ZCN9 leads to early flowering. Studies have found a single nucleotide polymorphism in the promoter region of the maize ZCN8 gene that is significantly associated with flowering time, but no association has been reported between ZCN7 and flowering in maize. Summary of the Invention
[0005] The purpose of the present invention is to provide a KASP molecular marker related to the early flowering trait of corn and its application to solve the problems existing in the above-mentioned prior art. The KASP molecular marker can be used to assist in screening early flowering corn varieties, providing a scientific basis for corn improvement and breeding of new varieties.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides a KASP molecular marker related to the early flowering trait of corn. The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO: 1, and a G / A mutation exists at position 46 of the molecular marker.
[0008] The above-mentioned KASP molecular marker is the presence of a G / A mutation at the Chr6:170682583 site of the ZCN7 gene, and the reference genome accession number of the Chr6:170682583 site is Zm00001eb293080.
[0009] Optionally, the genotype of the mutation site of the molecular marker is AA, AG and GG.
[0010] The present invention also provides a primer set for amplifying the KASP molecular marker, and the nucleotide sequence of the primer set is shown in SEQ ID NO: 2-4.
[0011] The present invention also provides a kit for identifying the early flowering trait of corn, comprising a primer set for amplifying the KASP molecular marker, wherein the nucleotide sequence of the primer set is shown in SEQ ID NO: 2-4.
[0012] The present invention also provides an application of the KASP molecular marker, the primer set or the kit in identifying the early flowering trait of corn.
[0013] The present invention also provides an application of the KASP molecular marker, the primer set or the kit in improving the flowering traits of corn.
[0014] The present invention also provides an application of the KASP molecular marker, the primer set or the kit in cultivating corn with early flowering traits.
[0015] The present invention also provides a method for identifying the early flowering trait of corn, comprising the following steps:
[0016] The genomic DNA of the corn sample to be tested is used as a template, and the primer set shown in SEQ ID NO: 2-4 is used to amplify the KASP molecular marker, and the corn early flowering trait is determined according to the genotype of the KASP molecular marker mutation site.
[0017] Optionally, when the genotype of the KASP molecular marker mutation site is AA or AG, it indicates that the corn sample to be tested is an early-flowering corn. When the genotype of the KASP molecular marker mutation site is GG, it indicates that the corn sample to be tested is a late-flowering corn.
[0018] The present invention discloses the following technical effects:
[0019] The present invention analyzes the coding region and promoter region of the ZCN7 gene of maize inbred lines independently bred by the Shandong Academy of Agricultural Sciences and some backbone inbred lines, identifies a G / A allele variation at position Chr6:170682583 in the promoter region (i.e., a G / A allele variation exists at position 46 of the sequence shown in SEQ ID NO:1), and develops a functional KASP molecular marker based on this.
[0020] The present invention uses the developed KASP molecular marker to screen and identify corn germplasm materials. The results show that the AA genotype at the polymorphic site of this molecular marker indicates a super-early flowering corn variety, the AG genotype indicates an early-flowering corn variety, and the GG genotype indicates a late-flowering corn variety. The present invention uses KASP molecular markers to screen for early- and late-flowering germplasm resources and has bred several excellent combinations with different growth periods, such as Ludan 510 and Ludan 509. Through approval or participation in various trials, this provides new molecular markers and breeding directions for the development of new corn varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0022] Figure 1 Results of sequencing analysis (reverse complementary sequence) of key sites regulating flowering;
[0023] Figure 2 To use KASPEF molecular markers to distinguish maize materials with different flowering periods; early-flowering materials are marked in red, late-flowering materials are marked in blue, intermediate materials are marked in green, and the negative control is marked in black;
[0024] Figure 3 The expression results of ZCN7 gene at different developmental stages of the selected variety Ludan 510 and the control variety Zhengdan 958;
[0025] Figure 4 Paraffin section analysis of tassels of Ludan 510 and Zhengdan 958; A: Ludan 510, B: Zhengdan 958, A and B are from left to right the V5 and V6 stages respectively;
[0026] Figure 5 The flowering period of Ludan 510 and Zhengdan 958 was compared in the field; the yellow-green ones represent the early-flowering materials selected (already bloomed, showing a yellowish tint), and the dark green ones represent the late-flowering materials selected. DETAILED DESCRIPTION
[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0028] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0029] Example 1
[0030] (1) Through a survey of the flowering period of more than 600 breeding materials preserved by the Shandong Academy of Agricultural Sciences, 10 early-flowering and 10 late-flowering materials were selected. The literature was consulted to find known flowering-regulating genes (see Table 1). Based on the gene sequences (some of which were derived from homologous comparisons), quantitative PCR primers were designed (see Table 2). By comparing the expression levels of the above genes in early-flowering and late-flowering germplasm materials, it was identified that the expression level of the gene ZCN7 (Zm00001eb293080), encoding chlorophyll-binding protein D1, an important component of the maize photosystem II reaction center, is closely related to the flowering period.
[0031] Table 1 Related information of the selected early-flowering and late-flowering materials
[0032] Germplasm material number Flowering time type Germplasm material number Flowering time type 23S0230 Early flowering 23S0454 late bloomer 23S0458 Early flowering 23S0457 late bloomer 23S0182 Early flowering 23S0460 late bloomer 23S0183 Early flowering 23S0461 late bloomer 23S0198 Early flowering 23S0466 late bloomer 23S0201 Early flowering 23S0469 late bloomer 23S0220 Early flowering 23S0470 late bloomer 23S0221 Early flowering 23S0471 late bloomer 23S0223 Early flowering 23S0472 late bloomer 23S0227 Early flowering 23S0473 late bloomer
[0033] Table 2 Primer sequences for quantitative PCR detection of flowering genes
[0034]
[0035]
[0036]
[0037] The quantitative PCR detection system is shown in Table 3 below:
[0038] Table 3 qPCR reaction system (20 μL)
[0039]
[0040] The qPCR reaction program (45 cycles) is shown in Table 4 below.
[0041] Table 4 qPCR reaction procedure
[0042]
[0043] According to the Ct value of the internal reference gene and the gene to be tested, 2 -ΔΔct The CT value comparison method was used to perform relative quantitative analysis on the genes to be tested.
[0044] (2) The promoter is a key region that determines the level of gene expression. By comparing the promoter region sequences of early-flowering and late-flowering materials, it was found that the G / A allelic variation at position Chr6:170682583 (corn reference genome version V5) in the promoter region of the ZCN7 gene is a key site that determines the differential expression of ZCN7; the analysis of the promoter cis-acting elements found that the G / A at position Chr6:170682583 is located within the AE-box element (see Figure 1 ), and the AE-box is related to the light response.
[0045] (3) Using SNP_Primer_Pipeline2, the KASP molecular marker development platform was built on the unit server. The functional molecular marker KASPEF was developed using this tool. The sequences of its FAM, HEX, and R primers are as follows:
[0046] KASPEF-F (SEQ ID NO.2): 5'-GAAGGTGACCAAGTTCATGCTTTTCAGATCAGACGAAAAGAGAAAC-3';
[0047] KASPEF-H (SEQ ID NO.3): 5'-GAAGGTCGGAGTCAACGGATTTTTCAGATCAGACGAAAAGAGAAAT-3';
[0048] KASPEF-R (SEQ ID NO. 4): 5'-GCATATTAGGTTAAATATCTAAGTAGTGT-3'.
[0049] The reaction system is shown in Table 5 below.
[0050] Table 5 Reaction system
[0051]
[0052]
[0053] The reaction conditions are shown in Table 6 below.
[0054] Table 6 Reaction procedure
[0055]
[0056] The amplified sequence (SEQ ID NO.1) is shown below:
[0057] GAAGGTGACCAAGTTCATGCTTTTCAGATCAGACGAAAAGAGAAA[C / T]AAGACAACACTACTTAGATATTTAACCTAATATGC.
[0058] Note: [C / T] indicates the mutation site.
[0059] (4) Application of flowering marker KASPEF
[0060] Using the KASPEF molecular marker developed above, the materials with different flowering periods were screened and identified in the breeding materials of Shandong Academy of Agricultural Sciences. The DNA of the materials was extracted and then screened and identified using the molecular marker KASPEF. The results are as follows: Figure 2 shown.
[0061] The results showed that 526 materials of early-flowering genotype A and 350 materials of late-flowering genotype were screened and identified. The early-flowering and late-flowering materials were hybridized and matched. Taking into account the hybrid advantage pattern and yield factors, two super-early flowering combinations (flowering in 40-41 days), 14 medium-early flowering combinations (flowering in 42-48 days) and one late-flowering combination (flowering 57 days after sowing) were created. Some varieties have passed the review, see Table 7.
[0062] Table 7 Statistics of excellent combination genotypes, flowering period and test results
[0063]
[0064]
[0065] Example 2
[0066] Analysis of phenotypes and flowering gene expression levels of materials with different flowering periods. Taking two materials with different flowering periods, Zhengdan 958 (genotype GG) and Ludan 510 (genotype AA), as examples, summer corn was sown in the Huanghuaihai region and their phenotypes and flowering gene expression levels were analyzed.
[0067] like Figure 3-Figure 5 As shown, the results showed that Ludan 510 flowered approximately 7 days earlier than Zhengdan 958. Paraffin section analysis of early female spike differentiation revealed that tassel differentiation began in Ludan 510 at the fifth to sixth leaf stage, while Zhengdan 958 only began differentiation at the sixth to seventh leaf stage. Comparison of the expression levels of the flowering-related gene ZCN7 during tassel formation revealed that during the critical stages of tassel formation, V4 and V5, the expression level of ZCN7 in Ludan 510 was over six times that of Zhengdan 958. However, the expression level of this gene in Zhengdan 958 only increased rapidly at V6, approximately one leaf age (approximately one week) later than in Ludan 510. This gene is highly expressed during tassel formation and rapidly downregulated after tassel formation.
[0068] It can be seen from the results of the above embodiments that the present invention detects all flowering-related genes by comparing corn inbred lines and hybrids with different flowering periods, identifies that ZCN7 has an important function in regulating flowering, and identifies the G / A allelic variation at position Chr6:170682583 in the promoter region of this gene, thereby developing a functional molecular marker; and performs sequence analysis on it to discover the key elements that regulate gene expression, develop functional markers, and use them to screen germplasm, and select 2 super-early flowering combinations, 14 medium-early flowering combinations, and 1 late flowering combination.
[0069] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. Use of a primer set or kit in identifying early flowering traits of corn, characterized in that: The nucleotide sequence of the primer set is shown in SEQ ID NO: 2-4; the kit includes the primer set.
2. Use of a primer set or kit in cultivating early-flowering corn, characterized in that: The nucleotide sequence of the primer set is shown in SEQ ID NO: 2-4; the kit includes the primer set.
3. A method for identifying the early flowering trait of corn, characterized in that: The following steps are involved: Using the genomic DNA of the corn sample to be tested as a template, amplification is performed using the primer set shown in SEQ ID NO: 2-4, and the early flowering trait of the corn is determined according to the genotype; When the genotype is AA and AG, it indicates that the corn sample to be tested is corn with early flowering trait.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker combination related to corn kernel traits and application thereof
CN119193901A