A method for detecting 25-OH-VD using a dual-sandwich method based on VDR and RXRα

Abstract

This invention provides a method for detecting 25-OH-VD using a VDR and RXRα double-sandwich method, comprising: sequentially synthesizing VDR and RXRα sequences, expressing VDR and RXRα, purifying VDR and RXRα; and using the purified VDR and RXRα proteins to detect the content of 25-OH-VD using the double-sandwich method. This invention provides a method for detecting 25-OH-VD content using a VDR and RXRα double-sandwich method, which solves the problems of low accuracy and narrow linear range in competitive methods for detecting 25-OH-VD content. Furthermore, this method is simple to operate, does not require animal immunization for antibody preparation, and saves preparation time and resources.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for detecting 25-OH-VD based on a double sandwich method using VDR and RXRα. Background Technology

[0002] Vitamin D (VD) is a fat-soluble vitamin with a variety of important physiological functions. VD regulates calcium and phosphorus metabolism and plays a vital role in bone development. In addition, VD also plays a role in the occurrence and development of diseases such as cardiovascular disease, diabetes, and Alzheimer's disease.

[0003] VD exerts its physiological functions through the VD receptor (VDR). VDR is a ligand-dependent transcription factor belonging to the nuclear receptor superfamily. After VDR binds to VD, its conformation changes, thereby enabling it to exert its physiological functions.

[0004] The retinoid X receptor (RXR) can bind to VDR to form a VDR-RXR heterodimer, promoting VDR's function of activating target gene transcription. After binding to VD, VDR binds tightly to RXR, forming a ternary complex. There are three isoforms of RXR: RXRα, RXRβ, and RXRγ. We chose RXRα as the subject of our study.

[0005] 25-hydroxyvitamin D (25-OH-VD) is the most abundant vitamin D metabolite in the body's circulation and can reflect the body's vitamin D nutritional level. Currently, immunoassay is the mainstream method for detecting 25-OH-VD in human blood. However, because 25-OH-VD is a small molecule compound with only a single antigenic determinant, it cannot be detected using a double-sandwich method. Therefore, competitive methods are currently the primary approach for 25-OH-VD detection. Competitive methods suffer from low detection accuracy and a narrow linear range. Summary of the Invention

[0006] The purpose of this invention is to overcome the above-mentioned shortcomings of the prior art and provide a method for detecting 25-OH-VD based on a dual-sandwich method using VDR and RXRα.

[0007] A method for detecting 25-OH-VD based on a dual-sandwich method using VDR and RXRα includes:

[0008] The VDR sequence and RXRα sequence were synthesized sequentially, followed by VDR expression and RXRα expression, and then VDR purification and RXRα purification.

[0009] The content of 25-OH-VD was detected by double-sandwich assay using purified VDR and RXRα proteins.

[0010] Furthermore, the VDR sequence is shown in SEQ ID NO:1 and was constructed into the pcDNA3.1 vector to obtain the pcDNA3.1-VDR plasmid.

[0011] Furthermore, the RXRα sequence is shown in SEQ ID NO:2. At the same time, an FC tag is added to the 3' end, the sequence of which is shown in SEQ ID NO:3. The FC tag is then constructed into the pcDNA3.1 vector to obtain the pcDNA3.1-RXRα plasmid.

[0012] Furthermore, VDR expression was performed as follows: the constructed pcDNA3.1-VDR plasmid was transfected into 293F cells using the PEI transfection method. After successful transfection, the cells were cultured in a shaker at 37°C, 8% CO2, and 120 rpm for 24 h. Then, 3.5% (v / v) feed medium was added, and the cells were returned to the shaker for further culture for 96 h to obtain 293F cell culture medium expressing VDR.

[0013] Furthermore, RXRα expression was achieved by transfecting the constructed pcDNA3.1-RXRα plasmid into 293F cells using the PEI transfection method. After successful transfection, the cells were cultured in a shaker at 37°C, 8% CO2, and 120 rpm for 24 h. Then, 3.5% (v / v) feed medium was added, and the cells were returned to the shaker for further culture for 96 h to obtain 293F cell culture medium expressing RXRα.

[0014] Further, VDR was purified as follows: the obtained 293F cell culture medium expressing VDR was centrifuged at 12,000 rpm for 30 min at 4 °C, the supernatant was collected, and the cell supernatant was filtered through a 0.22 μm filter membrane; the supernatant was diluted 5 times with Buffer A and loaded onto a Q chromatography column; Buffer B was used to wash away impurities; Buffer C was used to elute proteins; the purified VDR protein was ultrafiltered, concentrated, and stored in PBS pH 7.4 to obtain VDR protein.

[0015] Further purification of RXRα was performed as follows: The obtained 293F cell culture medium expressing RXRα was centrifuged at 12,000 rpm for 30 min at 4°C, the supernatant was collected, and the cell supernatant was filtered through a 0.22 μm filter membrane. Protein A packing material was used for protein purification. Before use, the Protein A column was equilibrated with 5 column volumes of equilibration buffer containing 0.02 M PB and 0.15 M NaCl at pH 6.5. The filtered cell culture medium was passed through the column, and the column was washed with 5 column volumes of equilibration buffer containing 0.02 M PB and 0.15 M NaCl at pH 6.5. Elution was then performed with 5 column volumes of elution buffer containing 0.1 M Glycine-HCl at pH 2.7, and the elution buffer was immediately neutralized with 1.0 M Tris-HCl at pH 9.0. The purified RXRα protein was then ultrafiltered, concentrated, and stored in PBS at pH 6.5 to obtain the RXRα protein.

[0016] Furthermore, using the purified VDR and RXRα proteins, the content of 25-OH-VD was detected using a double-sandwich assay, including:

[0017] Dissolve VDR protein at a concentration of 1 μg / ml in coating buffer, add 100 μL to the corresponding well, and incubate overnight at 4°C. Aspirate the liquid from the wells and wash three times with 300 μL of washing buffer. Add 300 μL of blocking buffer to each well and incubate at 37°C for 1 h. Aspirate the liquid from the wells and wash three times with 300 μL of washing buffer. Add 100 μL of 3-fold serially diluted 25-OH-VD sample and pre-calibrated blood sample to each well and incubate at 37°C for 1 h. Aspirate the liquid from the wells and wash three times with 300 μL of washing buffer. Add 100 μL of blocking buffer to each well. Add 1 μg / ml RXRα protein; aspirate the liquid from the wells, wash three times with 300 μL washing buffer, add 100 μL HRP-labeled rabbit anti-human antibody to each well, and incubate at 37°C for 30 min; aspirate the liquid from the wells, wash five times with 300 μL washing buffer; add 100 μL chromogenic solution to each well, incubate at 37°C for 10 min, then add 50 μL 2 mol / L H2SO4 stop solution. Within 20 min after adding the stop solution, read the values ​​on a microplate reader at 450 nm.

[0018] The advantages and beneficial effects of this invention compared to the prior art are as follows:

[0019] 1. The detection method provided by this invention solves the problems of low accuracy and narrow linear range in the competitive detection of 25-OH-VD content. It is also simple to operate, does not require immunizing animals to prepare antibodies, and saves preparation time and manpower.

[0020] 2. The detection method provided by this invention can be applied to the immunoassay for the detection of 25-OH-VD content. This method uses a sandwich method, which is simple to operate and provides accurate data.

[0021] 3. The VDR nucleotide sequence provided by the present invention enables the expression of VDR protein, which can specifically bind to 25-OH-VD and undergo a conformational change after binding to 25-OH-VD, thereby binding tightly to RXRα.

[0022] 4. The RXRα nucleotide sequence provided by the present invention enables the expression of RXRα protein, which can tightly bind to VDR after binding 25-OH-VD, thereby realizing sandwich detection of 25-OH-VD.

[0023] 5. For the purpose of convenient detection, the RXRα protein provided by this invention is tagged with a human FC tag, which can be bound by HRP-labeled rabbit anti-human or mouse anti-human antibodies, thereby developing color and achieving the purpose of detection. Attached Figure Description

[0024] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 This is a VRD purification electrophoresis image from an embodiment of the present invention;

[0026] Figure 2 This is an electrophoresis image of RXRα purification in an embodiment of the present invention;

[0027] Figure 3 This is a graph showing the results of ELISA detection of 25-OH-VD content in an embodiment of the present invention. Detailed Implementation

[0028] To make the technical problem to be solved, the technical solution, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present invention and are not intended to limit the present invention.

[0029] Example 1

[0030] A method for detecting 25-OH-VD using a dual-sandwich method based on VDR and RXRα

[0031] (1) VDR sequence synthesis

[0032] The VDR sequence was obtained from NCBI KR710973.1 (SEQ ID NO:1), and the sequence was synthesized by Shanghai Sangon Biotech and constructed into the pcDNA3.1 vector.

[0033] SEQ ID NO:1

[0034]

[0035] (2) Synthesis of RXRα sequence

[0036] The RXRα sequence was obtained from NCBI NM_002957.6 (SEQ ID NO:2), with an FC tag (SEQ ID NO:3) added to the 3' end. The sequence was synthesized by Shanghai Sangon Biotech and constructed into the pcDNA3.1 vector.

[0037] SEQ ID NO:2

[0038]

[0039] SEQ ID NO:3

[0040] GAGCCCAAGAGCTGCGACAAGACCCACACATGCCCTCCCTGTCCCGCTCCCGAGCTGCTGGGCGGCCCTAGCGTGTCCTGTTCCCCCCCAAGCCCAAGGACACCCTGATGATCAGCAGAACCCCCGAGGTGACCTGCGTGGTCGTGGACGTGAGCCACGAGGACCCCGAGGTG AAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCACAACGCCAAGACCAAGCCTAGAGAGGAGCAGTACAACAGCACCTACAGAGTGGTGAGCGTGCTGACCGTGCTGCACCAAGACTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTGAGCAACAAAGCCCTGCCTGCCCCT ATCGAGAAGACCATCAGCAAGGCCAAGGGGCAGCCTAGAGAGCCCCAAGTGTACACCCTGCCCCCTAGCAGAGACGAGCTGACCAAGAACCAAGTGAGCCTGACCTGCCTGGTCAAGGGCTTCTACCCTAGCGACATCGCCGTGGAGTGGGAGAGCAACGGGCAGCCCGAGAAC AACTACAAGACCACCCCCCCCGTGCTGGACAGCGACGGCAGCTTCTCCTGTACAGCAAGCTGACAGTGGACAAGAGCAGATGGCAGCAAGGCAACGTGTTTAGCTGCAGCGTGATGCACGAGGCCCTGCACAACCACTACACACAGAAAAGCCTGAGCCTGAGCCCTGGCAAA

[0041] (3) VDR expression

[0042] The constructed pcDNA3.1-VDR plasmid was transfected into 293F cells using the PEI transfection method. After successful transfection, the cells were cultured in a shaker at 37°C, 8% CO2, and 120 rpm for 24 h. Then, 3.5% feed medium was added, and the cells were returned to the shaker for another 96 h to obtain 293F cell culture medium expressing VDR.

[0043] (4) RXRα expression

[0044] The constructed pcDNA3.1-RXRα plasmid was transfected into 293F cells using the PEI transfection method. After successful transfection, the cells were cultured in a shaker at 37°C, 8% CO2, and 120 rpm for 24 h. Then, 3.5% feed medium was added, and the cells were returned to the shaker for another 96 h to obtain 293F cell culture medium expressing RXRα.

[0045] (5) VDR purification

[0046] Centrifuge at 12,000 rpm for 30 min at 4℃, collect the supernatant, and filter the cell supernatant through a 0.22 μm filter membrane. Dilute 5-fold with Buffer A (20 mM PB, adjusted to pH 7.4) and load onto a Q chromatography column; wash away contaminating proteins with Buffer B (20 mM PB, 20 mM sodium chloride, adjusted to pH 7.4); elute proteins with Buffer C (20 mM PB, 500 mM sodium chloride, adjusted to pH 7.4); ultrafilter the purified VDR protein, change the buffer, concentrate, and store in PBS at pH 7.4. Results are as follows. Figure 1 As shown, it is possible to express and purify VDR protein with high purity.

[0047] (6) RXRα purification

[0048] Centrifuge at 12,000 rpm for 30 min at 4℃, collect the supernatant, filter the cell supernatant through a 0.22 μm filter membrane, and purify the protein using Protein A packing material. Before use, the Protein A column was equilibrated with 5 column volumes of equilibration buffer containing 0.02 MPB and 0.15 M NaCl, pH 6.5. The filtered cell culture medium was passed through the column, and the column was washed with 5 column volumes of equilibration buffer containing 0.02 M PB and 0.15 M NaCl, pH 6.5. Elution was then performed with 5 column volumes of elution buffer containing 0.1 M Glycine-HCl, pH 2.7, and the elution buffer was immediately neutralized with 1.0 M Tris-HCl, pH 9.0. The purified RXRα protein was then ultrafiltered, concentrated, and stored in PBS, pH 6.5. The results are as follows. Figure 2 As shown, it is possible to express and purify RXRα protein with high purity.

[0049] (7) ELISA detection of 25-OH-VD content

[0050] Dissolve VDR protein at a concentration of 1 μg / ml in coating buffer, add 100 μL (100 ng / well) to the corresponding well, and incubate overnight at 4°C. Aspirate the liquid from the wells and wash three times with 300 μL of wash buffer. Add 300 μL of blocking buffer (5% skim milk, prepared with PBST) to each well and incubate at 37°C for 1 h. Aspirate the liquid from the wells and wash three times with 300 μL of wash buffer. Add 100 μL of serially diluted 25-OH-VD sample (3-fold) and pre-calibrated blood sample to each well, and incubate at 37°C for 1 h. Aspirate the liquid from the wells and wash three times with 300 μL of wash buffer. Add 100 μL of 1 μg / ml RXRα protein to each well. Aspirate the liquid from the wells and wash three times with 300 μL of wash buffer. Add 100 μL of HRP-labeled rabbit anti-human antibody (1:5000, diluted with PBST) to each well and incubate at 37°C for 30 min. Aspirate the liquid from the wells and wash five times with 300 μL of wash buffer. Add 100 μL of chromogenic solution to each well and incubate at 37°C for 10 min. Then add 50 μL of 2 mol / L H2SO4 stop solution. Read the values ​​at 450 nm using a microplate reader within 20 min after adding the stop solution. Results are as follows. Figure 3 As shown in Table 1.

[0051]

[0052] from Figure 3 It is evident that the detection method exhibits good linearity within the 25-OH-VD concentration range of 0.15-333.33 ng / mL. VDR demonstrates good binding activity to 25-OH-VD and can also bind to RXRα, making it suitable for the double-sandwich method detection of 25-OH-VD. Compared to the control / competitive method kit with a detection range of 5-100 ng / mL, the linear detection range is wider. Based on the results in Table 1, the deviation between the ELISA method and the calibrated concentration of 25-OH-VD in blood samples is within ±10%, indicating its applicability for 25-OH-VD concentration detection in blood samples.

[0053] This invention provides a novel method for detecting 25-OH-VD, the principle of which is as follows: VDR binds to 25-OH-VD in the sample, and RXRα forms a sandwich complex with the former two, which improves the detection precision and accuracy, expands the linear range, and solves the problems existing in competitive methods.

[0054] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for detecting 25-OH-VD based on a dual-sandwich method using VDR and RXRα, characterized in that, Includes the following steps: The VDR protein was coated onto a solid phase, and the sample to be tested was added. 25-OH-VD in the sample bound to the VDR protein to form a first complex. The nucleotide sequence of the VDR protein is shown in SEQ ID NO:

1. Then, an RXRα protein containing an FC tag is added, which binds to the first complex to form a second complex. The nucleotide sequence of the RXRα protein containing the FC tag is shown in SEQ ID NO:2, and the nucleotide sequence of the FC tag is shown in SEQ ID NO:

3. Finally, add HRP-labeled antibody and colorimetric solution, and analyze the 25-OH-VD content based on the colorimetric analysis.

2. The method for detecting 25-OH-VD based on a dual-sandwich structure of VDR and RXRα according to claim 1, characterized in that, The VDR protein was obtained through recombinant expression.

3. The method for detecting 25-OH-VD based on a dual-sandwich structure of VDR and RXRα according to claim 1, characterized in that, The RXRα protein containing the FC tag is obtained by adding the FC tag nucleotide sequence to the 3' end of the RXRα protein's original nucleotide sequence, and then constructing an expression vector for recombinant expression.

4. A reagent for the double-sandwich detection of 25-OH-VD, characterized in that, The invention comprises a VDR protein, an RXRα protein containing an FC tag, an HRP-labeled antibody, and a chromogenic solution. The nucleotide sequence of the VDR protein is shown in SEQ ID NO:1, the nucleotide sequence of the RXRα protein containing the FC tag is shown in SEQ ID NO:2, and the nucleotide sequence of the FC tag is shown in SEQ ID NO:

3.

5. A double-sandwich detection kit for 25-OH-VD, characterized in that, The reagent for detecting 25-OH-VD using a double-sandwich method as described in claim 4.

Images