Polypeptides for catalyzing hydroxylation of lignans, encoding genes, preparation methods and applications
By catalyzing the hydroxylation reaction on the bisbenzylbutane lignan benzene ring by catalyzing the hydroxylation reaction on the benzene ring of the lignan in the prior art, the problem of lignan synthesis in Schisandra is solved, and the generation of diversified lignans in Schisandra is achieved, which has important medicinal value.
Patent Information
- Application Number
- CN202510354418.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-25
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2045-03-25
AI Technical Summary
The prior art is difficult to effectively catalyze the hydroxylation reaction on the benzene ring of bisbenzylbutane lignans, which limits the development of biosynthesis and medicinal potential of diversified lignans in Schisandra.
The polypeptide SchCYP719C7 that catalyzes lignan hydroxylation and its encoding gene are provided to achieve diversified lignan synthesis by catalyzing monohydroxy or polyhydroxy addition on the bisbenzylbutane lignan benzene ring.
The catalytic generation of Schisandra neolinan B and progomecin with medicinal value has laid the foundation for the synthesis of diversified lignans in Schisandra and provided important application prospects for the pharmaceutical industry.
Smart Images

Figure CN119859620B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical fields of genetic engineering and enzyme engineering, and particularly relates to a polypeptide for catalyzing the hydroxylation of lignans, a coding gene thereof, a preparation method and an application thereof. Background Art
[0002] Schisandra chinensis ( Schisandra chinensis ) is a woody plant of the genus Schisandra in the family Schisandraceae. Schisandra chinensis has a wide range of medicinal values, including anti-hepatic injury effects, extensive central inhibitory effects, cardiotonic effects, enhancing the body's defense ability against non-specific stimuli, and inhibitory effects on Bacillus anthracis, Staphylococcus aureus, Staphylococcus albus, Salmonella typhi, Vibrio cholerae, etc. Dibenzylbutane lignans can be isolated from Schisandra chinensis.
[0003] Dibenzylbutane lignans are a class of lignans with the least modified connection between the 8 and 8' carbons of phenylpropane precursors, and some lignans of this structure show antiviral activity. For example, nordihydroguaiaretic acid (NDGA) shows dose-dependent inhibitory effects on the production of dengue virus (DENV) and the secretion of non-structural protein-1; pregomisin has platelet-activating factor antagonistic activity and inhibitory effects on the syncytium formation induced by HIV-1IIIB.
[0004] The structural diversity of dibenzylbutane lignans is inseparable from the multiple substitutions on the benzene ring. The substitution form on the benzene ring is hydroxyl substitution, and then rich structures are formed through methylation, acylation, glycosylation modification, etc. Dibenzylbutane lignans are also considered as the biosynthetic precursors of dibenzocyclooctene lignans. The benzene ring of dibenzocyclooctene lignans often has multiple hydroxyl or methoxy substitutions. Therefore, the enzyme responsible for benzene ring hydroxylation plays a key role in the diverse biosynthesis of lignans.
[0005] The functional enzyme analysis of the hydroxylation step of dibenzylbutane lignans promotes the development of its biosynthesis, provides a more convenient path to explore and utilize the medicinal potential molecules of this type of lignans, and lays an important foundation for the subsequent diverse biosynthesis of lignans. Summary of the Invention
[0006] In view of the above-mentioned prior art, the present invention provides a polypeptide for catalyzing the hydroxylation of lignans, a coding gene thereof, a preparation method and an application thereof, provides a new polypeptide that can catalyze the hydroxylation of lignans, and can catalyze the addition of single hydroxyl or multiple hydroxyls to the benzene ring of dibenzylbutane lignans, laying a foundation for the synthetic biology research of various lignans in Schisandra chinensis.
[0007] In order to achieve the above object, the technical solution adopted by the present invention is: to provide a polypeptide for catalyzing the hydroxylation of lignans, and the polypeptide for catalyzing the hydroxylation of lignans is polypeptide Sch CYP719C7, and its amino acid sequence is selected from:
[0008] (1) The amino acid sequence shown in SEQ ID No.1;
[0009] (2) An amino acid sequence generated by substituting, deleting and / or adding one or several amino acids to the amino acid sequence shown in SEQ ID No.1, and having the same catalytic activity as (1); or
[0010] (3) A truncated form of (1) or (2) having the same catalytic activity as (1).
[0011] The present invention also discloses the coding gene of the polypeptide for catalyzing the hydroxylation of lignans, the polypeptide Sch The coding gene sequence of CYP719C7 is selected from:
[0012] (1) The nucleotide sequence shown in SEQ ID NO.2;
[0013] (2) A nucleotide sequence having more than 80% homology with the nucleotide sequence shown in SEQ ID NO.2, and the encoded polypeptide having the same catalytic activity as the polypeptide encoded by (1); or
[0014] (3) A truncated form of (1) or (2) having the same catalytic activity as the polypeptide encoded by (1).
[0015] Further, an expression vector containing the above coding gene.
[0016] Further, a recombinant microorganism or transgenic cell line containing the above coding gene.
[0017] Further, a method for preparing the polypeptide for catalyzing the hydroxylation of lignans, comprising the following steps: introducing the above coding gene into a recipient cell, and performing the expression and extraction of the polypeptide to obtain the polypeptide.
[0018] Further, the application of the polypeptide for catalyzing the hydroxylation of lignans, using the polypeptide for catalyzing the hydroxylation of lignans to catalyze the hydroxylation of dibenzylbutane-type lignans.
[0019] Further, the polypeptide Sch CYP719C7 catalyzes the addition of at least one hydroxyl group to the benzene ring of dibenzylbutane-type lignans.
[0020] Further, the polypeptide Sch CYP719C7 catalyzes the addition of one or two hydroxyl groups to dihydroguaiaretic acid.
[0021] Further, the polypeptide Sch CYP719C7 is used for preparing schisanhenol B or pregomisin.
[0022] The beneficial effect of the present invention is: the polypeptide in the present invention SchCYP719C7 has the function of catalyzing the formation of nor-schisandrin B and nor-pregomisin from dihydroguaiaretic acid, and can hydroxylate the dibenzylbutane lignan dihydroguaiaretic acid to generate products with one or more added hydroxyl groups. It is a key modification step in the formation of diverse lignans in Schisandra chinensis, laying a foundation for the synthetic biology research on the diversification of dibenzylbutane lignans in Schisandra chinensis and having great application value. The compounds obtained using the polypeptide Sch in CYP719C7 are active ingredients in medicine, or the obtained compounds can be used as intermediates for subsequent synthesis reactions to also obtain active ingredients in medicine. The polypeptide Sch CYP719C7 has positive application prospects in the pharmaceutical industry. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 For the recombinant vector map expressing the polypeptide Sch CYP719C7;
[0024] Figure 2 For the LC-MS map of the enzymatic catalytic reaction of the polypeptide Sch CYP719C7 with dihydroguaiaretic acid as the substrate;
[0025] Figure 3 For the LC-MS map of the product of the reaction of the polypeptide Sch CYP719C7 catalyzing dihydroguaiaretic acid after being catalyzed by a methyltransferase;
[0026] Figure 4 For the reaction process of the polypeptide Sch CYP719C7 catalyzing dihydroguaiaretic acid and subsequent methylation. DETAILED DESCRIPTION OF THE INVENTION
[0027] The following is a detailed description of the specific embodiments of the present invention in combination with the examples.
[0028] Example 1
[0029] Screening of Schisandra chinensis CYP450 genes based on transcriptome, the steps are as follows:
[0030] (1) UPLC was used to detect the content differences of dibenzylbutane lignans in Schisandra chinensis fruits, mature stems, old leaves and roots.
[0031] (2) Based on the Schisandra chinensis genome, members of the Schisandra chinensis CYP450 gene family were identified, and the key enzyme protein sequences of CYP450 in Schisandra chinensis were preliminarily screened using the HMM model of the CYP450 gene family.
[0032] (3)Based on the transcriptome data of different tissue parts of Schisandra chinensis, analyze the differential gene expression. Conduct a correlation analysis between the metabolome and the transcriptome. By ranking the calculated Pearson correlation coefficients, select the genes with high correlation coefficients related to dibenzylbutane lignans as candidate genes, and further screen the key enzyme genes responsible for hydroxyl addition in the biosynthesis pathway of dibenzylbutane lignans in Schisandra chinensis to obtain the expressed polypeptide Sch The gene of CYP719C7, polypeptide Sch The amino acid sequence of CYP719C7 is shown in SEQ ID No.1, encoding polypeptide Sch The gene sequence of CYP719C7 is shown in SEQ ID No.2.
[0033] Example 2
[0034] Expressed polypeptide Sch Cloning of the gene of CYP719C7
[0035] 1. Extract total RNA of Schisandra chinensis by CTAB-PVP method
[0036] (1)Take fresh Schisandra chinensis plant materials (leaves or fruits) and quickly grind them into powder in liquid nitrogen.
[0037] (2)Estimate and put 100 mg of powder into a pre-cooled 2 mL centrifuge tube, add 800 μL of CTAB-PVP extraction buffer preheated at 65 °C, and place it on a vortex oscillator to shake for 30 s to fully lyse it;
[0038] The CTAB-PVP extraction buffer contains 100 mM Tris·HCl (pH 8.0), 2% CTAB (w / v), 2% PVP (polyvinylpyrrolidone, w / v), 25 mM EDTA, 2 M NaCl. After autoclaving, add mercaptoethanol with a final concentration of 0.2% (v / v); prepare the solution with double-distilled water (ddH2O) treated with DEPC and autoclaved.
[0039] (3)Water bath at 65 °C for 30 min, and invert and mix once every 10 min.
[0040] (4)After cooling to room temperature, add 800 μL of chloroform, invert and mix well, and centrifuge at 13,000 rpm for 10 min at 4 °C.
[0041] (5)Take the supernatant obtained by centrifugation into a new 2 mL centrifuge tube, add 800 μL of chloroform, oscillate and mix evenly, and centrifuge at 13,000 rpm for 10 min at 4 °C.
[0042] (6)Repeat step (5) once.
[0043] (7)Carefully aspirate the supernatant obtained by centrifugation into a new 1.5 mL centrifuge tube, add an 8 M LiCl solution with a volume one-third of that of the supernatant, and let it stand overnight at -20 °C.
[0044] (8)Centrifuge at 13,000 rpm for 10 min at 4 °C, and discard the supernatant.
[0045] (9)Add 700 μL of 75% (v / v) ethanol (prepared with DEPC water) to wash the precipitate, and then centrifuge at 13,000 rpm for 10 min at 4 °C; repeat the washing of the precipitate 3 times. After the third centrifugation, discard the supernatant and evaporate the remaining ethanol to dryness.
[0046] (10)Add 30 μL of sterilized water treated with Proteinase K to dissolve the RNA to obtain total RNA. Use a nucleic acid and protein analyzer of the BioPhotometer plus model to measure the concentration and quality of the extracted RNA.
[0047] 2. Encoding polypeptide Sch Full-length amplification of the CYP719C7 gene
[0048] (1)Primer design
[0049] Use the software SnapGene to design full-length primers SchCYP719C7-F / R on both sides of the open reading frame (ORF) of the gene encoding the polypeptide Sch CYP719C7 to amplify the gene;
[0050] The sequence of SchCYP719C7-F is:
[0051] CTATAGGGCCCGGGATGGAGATTCAATGGGCTGTG(SEQ ID No.3);
[0052] The sequence of SchCYP719C7-R is:
[0053] CTAGACTTCAGGTTGTTCAAGCAGCGCGAGGCTTG(SEQ ID No.4).
[0054] (2)cDNA synthesis
[0055] Using the total RNA of Schisandra chinensis obtained in the above steps as a template, a cDNA template strand is obtained by PCR technology with the PrimerScript RT Master Mix reverse transcription system. The reverse transcription system is shown in Table 1, and the reverse transcription program is: 37 °C, 15 min; 85 °C, 15 s. The reverse transcription product is stored at -20 °C and diluted before use.
[0056] Table 1 Reverse Transcription PCR System
[0057]
[0058] (3) Amplification of target gene
[0059] Dilute the Schisandra chinensis cDNA obtained in the above steps as a template, and use SchCYP719C7-F / R as primers for amplification. The amplification system is shown in Table 2, and the amplification program is shown in Table 3; detect the PCR reaction product by agarose gel electrophoresis and cut and recover the band of the target size, and the expressed polypeptide can be obtained. Sch The gene sequence of CYP719C7.
[0060] Table 2 Target Gene Amplification System
[0061]
[0062] Table 3 Target Gene Amplification Program
[0063]
[0064] Example 3
[0065] Polypeptide Sch Construction of Expression Vector of CYP719C7
[0066] 1. Amplify the expressed polypeptide with homologous arms Sch The gene fragment of CYP719C7
[0067] Use the primers with homologous arms SchCYP719C7-pESC-His-F / R to amplify the gene fragment of the expressed polypeptide Sch CYP719C7. The amplification system and program are shown in Tables 2 and 3 of Example 1. Detect the PCR reaction product by agarose gel electrophoresis and cut and recover the band of the target size, and the target fragment with homologous arms can be obtained;
[0068] The sequence of SchCYP719C7-pESC-His-F is:
[0069] CCGTAATACGACTCACTATAGGGCCCGGGATGGAGATTCAATGGGCTG(SEQ ID No.5);
[0070] The sequence of SchCYP719C7-pESC-His-R is:
[0071] ATAGGGACCTAGACTTCAGGTTGTTCAAGCAGCGCGAGGCTTG(SEQ ID No.6).
[0072] 2. Construction of homologous recombination expression vector
[0073] (1)Double digestion of vector: The vector pESC-His was digested with Sal I and Xho I. The double digestion system is shown in Table 4. After the double digestion system reacted in a 37°C water bath for 30 min, 10× Loading buffer was added to the digestion product to terminate the reaction, followed by agarose gel electrophoresis and gel extraction of the correct-sized band to obtain the double-digested vector.
[0074] Table 4 Double digestion system
[0075]
[0076] (2)Homologous recombination, transformation and positive verification: The target fragment with homologous arms was ligated to the double-digested vector pESC-His using a homologous recombination kit (ClonExpress Ultra One Step Cloning Kit V2). The system is shown in Table 5.
[0077] Table 5 Homologous recombination ligation system
[0078]
[0079] After thoroughly mixing the above components, the reaction was carried out at 37°C for 30 min and then immediately cooled on ice. The ligation product was transformed into competent Escherichia coli DH5α cells. The specific steps were as follows: The competent Escherichia coli DH5α cells stored at -80°C were taken out and thawed on ice. All the ligation product was added, gently pipetted and mixed well, and then placed on ice for 30 min. After heat shock at 42°C for 45 s, it was quickly placed on ice for 2 min. 500 μL of antibiotic-free LB medium was added and then cultured with shaking in a 37°C incubator for 1 h. 200 μL of the transformation solution was spread on an LB solid medium (containing 100 μg / mL ampicillin) and incubated statically in a 37°C incubator for 12 - 16 h.
[0080] Single colonies were picked for colony PCR to verify positive clones. Positive monoclonal clones were those that could amplify a bright and single band of the target size. The positive clones were sent for sequencing. The gene sequence encoding polypeptide Sch CYP719C7 is shown in SEQ ID No.2. The correctly sequenced monoclonal clones were stored and the SchCYP719C7-pESC-His plasmid was extracted. The plasmid map is as Figure 1 shown, with a total of 8086 bp. In the figure, ori represents the origin of plasmid replication, Figure 1It contains ori, 2µ ori and f1 ori; HIS3 represents the histidine synthesis gene; SchCYP719C7 is the inserted gene sequence encoding the polypeptide SchCYP719C7; AmpR is the ampicillin resistance gene; promoter represents the promoter, Figure 1 It contains HIS3 promoter, GAL,10 promoter, AmpR promoter; terminator represents the terminator, and in the figure, there are ADH1 terminator and CYC1 terminator; MCS is the multiple cloning site, Figure 1 It contains MCS1 and MCS2.
[0081] (3) Yeast transformation and positive verification
[0082] Transform the constructed SchCYP719C7-pESC-His plasmid into the competent cells of Saccharomyces cerevisiae WAT11. The transformation method is as follows:
[0083] ① Place the Carrier DNA in a 95°C water bath or metal bath for 3 min, then quickly insert it into an ice bath and let it stand for 3 min. Then place it in a 95°C water bath or metal bath for 3 min again, and quickly insert it into an ice bath and let it stand for more than 3 min.
[0084] ② Take 100 µL of WAT11 competent cells melted on ice, and successively add about 2 µg of the pre-cooled recombinant plasmid, 10 µL of Carrier DNA, and 500 µL of PEG / LiAc, and pipette several times to mix evenly. Incubate in a 30°C water bath for 30 min (invert 8 times to mix evenly at 15 min).
[0085] ③ Then place it in a 42°C water bath for 15 min (invert 8 times to mix evenly at 7.5 min).
[0086] ④ Centrifuge at 5000 rpm for 40 s to discard the supernatant, resuspend the cells with 400 µL of ddH2O, and centrifuge at 5000 rpm for 30 s to discard the supernatant.
[0087] ⑤ Resuspend the cells with 50 µL of ddH2O, spread on plates, and culture at 29°C for about 96 h.
[0088] ⑥ Pick the monoclonal colonies on the plate and perform positive verification by the alkaline lysis method to obtain the SchCYP719C7-pESC-His-WAT11 positive clone.
[0089] Example 4
[0090] Polypeptide Sch Expression and enzyme activity function analysis of CYP719C7
[0091] 1. Polypeptide SchExpression of CYP719C7
[0092] (1)Pick a positive clone of strain SchCYP719C7-pESC-His-WAT11 and inoculate it into 50 mL of His-deficient medium (prepared by adding 8 g of His minus media to 1 L of H2O and autoclaving at high temperature and high pressure), and culture it in a shaker at 29 °C and 220 rpm for 2 days.
[0093] (2)Centrifuge the cultured bacterial solution to collect the cells, resuspend the cell pellet in 400 mL of YPL medium containing 2% (v / v) galactose, and culture it in a shaker at 29 °C and 220 rpm for 16 h to induce the expression of the target protein; the formula of YPL medium (1 L) is: 10 g peptone and 10 g yeast extraction, dissolve in water and make up to 1 L, and autoclave at high temperature and high pressure.
[0094] (3)Harvest the cells: Centrifuge the bacterial solution at 5,000 rpm for 5 min and discard the supernatant.
[0095] (4)Wash: Add 40 mL of TEK washing solution to the centrifuge tube to resuspend the cell pellet, incubate on ice for 5 min, centrifuge at 4,000×g for 10 min at 4 °C to collect the cells, and resuspend the cell pellet in 200 mL of TESB solution, incubate on ice for 10 min; TEK washing solution (350 mL): Dissolve 2.60925 g of KCl in TE solution and make up to 350 mL with TE solution, mix well; TESB solution (1 L): Dissolve 109.3 g of sorbitol in TE solution and make up to 1 L with TE solution, mix well; TE solution (1 L) contains 50 mL of 1 M Tris-HCl solution and 3.2 mL of 0.5 M EDTA solution, make up to 1 L with ddH2O, and mix well.
[0096] (5)Lyse: Disrupt the bacterial solution with a homogenizer for 6 min, and centrifuge at 12,000×g for 15 min at 4 °C to collect the supernatant.
[0097] (6)Precipitate: Add 40 g of PEG4,000 and 3.52 g of NaCl to the supernatant and shake to dissolve completely.
[0098] (7)Incubate on ice for 15 min, centrifuge at 12,000×g for 15 min at 4 °C, and discard the supernatant.
[0099] (8)Resuspend the precipitate in 6 mL of TEG solution, which is the extracted microsomal protein; TEG solution (50 mL) contains 40 mL of TE solution and 10 mL of glycerol, mix well; the extracted microsomal protein contains polypeptides SchThe total protein of CYP719C7. Currently, the common method for CYP450 verification is to extract yeast microsomal protein for verification.
[0100] 2. Polypeptide Sch Verification of the enzymatic activity function of CYP719C7
[0101] Polypeptide Sch Perform in vitro enzymatic activity function identification on CYP719C7, set up a control group. The microsomal protein in the control group is the microsomal protein extracted from the empty vector through the same above steps. The substrate is dihydroguaiaretic acid, and the enzymatic activity reaction system is shown in Table 6.
[0102] Table 6 Enzymatic activity reaction system (250 μL)
[0103]
[0104] Note: The dosages of NADPH, FAD, FMN, Glucose 6 - phosphate, and Substrates represent the final concentrations in the enzymatic activity reaction system. The dosage of Microsome 200 μL means: Take 200 μL from the protein solution resuspended with TEG solution through the above steps for function verification.
[0105] Mix the above components, place them at 29 °C for reaction overnight, then add 200 μL of ethyl acetate to extract the reaction solution. After centrifuging at 12,000 rpm for 5 min, take the supernatant, repeat the extraction once. After evaporating the organic solvent, redissolve it with chromatographic methanol, and perform enzymatic activity reaction analysis by LC - MS.
[0106] The results are as Figure 2 and Figure 3 shown. Among them, 3 is dihydroguaiaretic acid, 4 is nor - schisandrin B, 5 is nor - pregomisin, 6 is schineolignin B, 7 is pregomisin; compared with the negative control, the molecular weight of the product shows that the polypeptide Sch CYP719C7 can catalyze the mono - hydroxyl addition of the benzene ring of the dibenzylbutane - type lignin dihydroguaiaretic acid (to obtain the product nor - schisandrin B) and the di - hydroxyl addition (to obtain the product nor - pregomisin). After the product is further methylated by SchOMT02, comparing with the standard product, it is confirmed that the methylated product is schineolignin B or pregomisin, verifying Sch the function and position of CYP719C7 in catalyzing the hydroxylation of dibenzylbutane - type lignin. The reaction process is as Figure 4 shown, Figure 4SchOMT02 in it is the enzyme reported in the patent "Lignan O-methyltransferase and Its Application" (CN116478949A).
[0107] Polypeptide Sch Amino acid sequence of CYP719C7:
[0108] MEIQWAVAAMVVVGAILIRFWRKEKAVEWPVGPSKLPIIGNLHQISKGGELVHVTLAKFAEEYGPMITVWMGGWRPTIVVSNQELAWEVLVTKATDYASRKLPYMSRFVTADWQTLATSDFGPYWQGLRKGVQNAALNPVNISSQTHLQERDVQAMTEALSMEASKNGGVVRPLVQFRRLTMRLVGRICFAFEFNDEKFMDGMDAAVEETIRLTGHARLVDVFAATRFLPGLSLPFKQTYQVQGRIRDLIRPYFSRCKPNSYMHFLLSQKMSEETVIFNIFEMFLLAVDSTSTSISWALAFMICNQDIQEKLYAEIRRITADRSEEERKWVSVEDVTKMQYVHAIVKETMRMKPIAPLAVPHMAINECNLMGTKIPAGTSVIVNIYKVLYDPKVWEEPYRFTPERFMAKQSDGDASARMRAMDRSFLPFGAGRRVCAGMDLAKLHVALTIANLVNAYQWCPMEGQLPDMTEDLTFVLRMKTPLAVGIKPRAA(SEQ ID No.1);
[0109] Encoding polypeptide Sch Gene sequence of CYP719C7:
[0110]
[0111] Although the specific implementation manners of the present invention have been described in detail in conjunction with the embodiments, it should not be construed as a limitation on the protection scope of this patent. Within the scope described in the claims, various modifications and variations that can be made by those skilled in the art without creative efforts still fall within the protection scope of this patent.
Claims
1. A polypeptide for catalyzing the hydroxylation of lignans, characterized in that The polypeptide catalyzing the hydroxylation of the lignan is polypeptide Sch CYP719C7, and its amino acid sequence is the amino acid sequence shown in SEQ ID No.
1.
2. The coding gene of the polypeptide for catalyzing the hydroxylation of lignans according to claim 1, characterized in that, The polypeptide Sch The coding gene sequence of CYP719C7 is the nucleotide sequence shown in SEQ ID NO.
2.
3. An expression vector containing the coding gene according to claim 2.
4. A recombinant microorganism or transgenic cell line containing the coding gene according to claim 2.
5. The preparation method of the polypeptide for catalyzing the hydroxylation of lignans according to claim 1, characterized in that, It includes the following steps: introducing the coding gene according to claim 2 into a recipient cell, expressing and extracting the polypeptide, and thus obtaining it.
6. Use of a polypeptide for catalyzing hydroxylation of lignans, characterized in that: The polypeptide for catalyzing the hydroxylation of lignans is used for catalyzing the hydroxylation of dibenzylbutane-type lignans, and the polypeptide for catalyzing the hydroxylation of lignans is polypeptide Sch CYP719C7, and its amino acid sequence is shown in SEQ ID No.
1.
7. The application according to claim 6, wherein: The polypeptide Sch CYP719C7 catalyzes the addition of at least one hydroxyl group to the benzene ring of dibenzylbutane lignans.
8. The application according to claim 7, wherein: The said polypeptide Sch CYP719C7 catalyzes the addition of one or two hydroxyl groups to dihydroguaiaretic acid.
9. The application according to claim 8, wherein: The polypeptide Sch CYP719C7 is used for preparing schisanlignan B or pregomisin.
Citation Information
Patent Citations
Lignans hydroxylase
CN101469324A
Lignan oxygen methyl transferase and application thereof
CN116478949A