DNA (deoxyribonucleic acid) vector, method for inserting exogenous gene sequence at fixed point and application of DNA vector

Abstract

The invention discloses a DNA vector, a method for fixed-point insertion of an exogenous gene sequence and application of the DNA vector, the DNA vector comprises a basic framework DNA vector and a target gene DNA vector, and genetic information of the basic framework DNA vector comprises a first promoter gene sequence, a replaceable gene sequence, a second selection marker gene sequence and a second terminator gene sequence; the target gene DNA vector comprises a target gene DNA expression unit, and the target gene DNA expression unit comprises FRT3, a target gene sequence, a first terminator gene sequence, a second promoter gene sequence and FRT; the replaceable gene sequence can be replaced by the target gene DNA expression unit. The DNA vector provided by the invention can be used for realizing stable and efficient expression of exogenous genes, the genetic background is clear, the construction time of stably transfected cell strains is greatly shortened, and large-scale production and application of cell expression antibodies or proteins are promoted.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a DNA vector, a method for inserting a foreign gene sequence at a specific point, and applications thereof. Background Art

[0002] Stable cell lines refer to cell lines that integrate specific genes into the cell genome through molecular biological methods, so that the cells can stably express the target gene or interfere with gene expression for a long time. They are suitable for various research applications, such as recombinant protein and antibody production, gene editing, functional research, drug screening, etc. By establishing stable cell lines, the cost of frequent transfection or virus packaging can be greatly reduced, making it convenient to study gene function in target cells; different from transient transfection, which randomly introduces high copy number expression in a short period of time, stable cell lines can obtain stable high expression or appropriate copy number cell lines through screening and amplification.

[0003] The methods for constructing stable cell lines can be roughly divided into four categories. The most mainstream method is lentivirus-mediated, which has the advantages of high mediation efficiency and short construction time, but there are certain biosafety risks, and it is difficult to package large genes into lentiviruses. Cell lines may undergo apoptosis or metamorphosis when infected with lentiviruses, and the workload of high-throughput stable transfection of multiple genes is large. The second category is the cell stable transfection system mediated by the transposon system. The experimental method is safe and simple, which is conducive to transposition to the transcriptionally active region of the host genome. It can effectively mediate large genes and can continuously express single or multiple genes. This method effectively makes up for the shortcomings of lentivirus mediation. The third category is the CRISPR knock-in system, which can achieve site-specific insertion of exogenous genes, but the gene knock-in of the CRISPR system is a probabilistic event. The knock-in efficiency varies with the selection of sgRNA sites and the differences in the inserted genes. It is necessary to improve the knock-in level by optimizing the sequence and mediation efficiency. In the later stage, it will take a lot of time to sort monoclones to obtain the correct site-specific knock-in cell line. The fourth type is the most primitive method for constructing stable transgenic lines, i.e., plasmid screening of stable transgenic cell lines. The target plasmid is transfected into cells. Through long-term resistance screening, there is a certain probability of obtaining stable transgenic cell lines. Due to its extremely low efficiency, it is rarely used now. There are many methods for constructing stable transgenic lines, most of which are random insertion, and fixed-point insertion is more difficult. Summary of the invention

[0004] The main purpose of the present invention is to provide a DNA vector, a method for site-specific insertion of an exogenous gene sequence and its application, aiming to solve the problem that it is difficult to site-specifically insert a target gene when preparing a stable cell line.

[0005] To achieve the above object, the present invention provides a DNA vector for site-specific insertion of an exogenous gene sequence, the DNA vector comprising:

[0006] An infrastructure DNA vector, comprising an infrastructure DNA expression unit, wherein the infrastructure DNA expression unit comprises, from 5' to 3' direction, a 5' end homology sequence, a first promoter gene sequence, a replaceable gene sequence, a second selection marker gene sequence, a second terminator gene sequence, and a 3' end homology sequence;

[0007] A target gene DNA vector, comprising a target gene DNA expression unit, wherein the target gene DNA expression unit comprises FRT3, a target gene sequence, a first terminator gene sequence, a second promoter gene sequence, and FRT in order from 5' to 3' direction;

[0008] The replaceable gene sequence includes FRT3, a first screening marker gene sequence, a first terminator gene sequence, and FRT in order from 5' to 3', and the replaceable gene sequence can be replaced by the target gene DNA expression unit by the FLP / FRT method.

[0009] Optionally, the first screening marker gene sequence and the second screening marker gene sequence are respectively selected from one of a hygromycin gene sequence and a glutamine synthetase gene sequence; and / or,

[0010] The first promoter gene sequence and the second promoter gene sequence are respectively selected from one of a CMV promoter gene sequence and a SV40 promoter gene sequence; and / or,

[0011] The first terminator gene sequence and the second terminator gene sequence are respectively selected from one of a β-globin polyA gene sequence and a SV40 polyA gene sequence.

[0012] Optionally, the first promoter gene sequence is a CMV promoter gene sequence, and the infrastructure DNA expression unit further comprises a CMV enhancer gene sequence, wherein the CMV enhancer gene sequence is disposed between the 5' end homology sequence and the first promoter gene sequence; and / or,

[0013] The infrastructure DNA expression unit further comprises an intron A gene sequence and an intron B gene sequence, wherein the intron A gene sequence is arranged between the first promoter gene sequence and FRT3, and the intron B gene sequence is arranged between FRT3 and the first screening marker gene sequence.

[0014] Optionally, the infrastructure DNA vector is obtained by transformation of a pUC19 plasmid, the infrastructure DNA expression unit is constructed on the pUC19 plasmid for replication and amplification, a large number of linearized fragments are obtained by plasmid restriction, and the infrastructure DNA vector is obtained; and / or,

[0015] The target gene DNA vector is obtained by transforming the pUC19 plasmid, and the target gene DNA vector is constructed by inserting the target gene DNA expression unit into the pUC19 plasmid.

[0016] Optionally, the nucleotide sequence of the infrastructure DNA expression unit is as shown in SEQ ID NO: 1; and / or,

[0017] The nucleotide sequence of the target gene DNA expression unit is shown in SEQ ID NO:2.

[0018] The present invention also provides a method for site-specific insertion of an exogenous gene sequence, using the DNA vector as described above, comprising the following steps:

[0019] S10, selecting a cell line and a genomic site to be modified for site-specific insertion, designing sgRNA according to the site and the gene editing protein used, and constructing the sgRNA on a plasmid to obtain an sgRNA plasmid;

[0020] S20, using the sgRNA plasmid to electroporate the infrastructure DNA expression unit into the cell line to be transformed, and obtaining an intermediate recombinant cell line through the first resistance screening and monoclonal screening;

[0021] S30, inserting the target gene DNA expression unit constructed with the target gene into the intermediate recombinant cell strain using the FLP / FRT recombinase system, and obtaining a cell strain with a fixed-site single-copy insertion of the target gene through a second resistance screening;

[0022] Wherein, the cell line to be transformed is a cell line that does not contain the second resistance screening gene.

[0023] Optionally, the step of "obtaining an intermediate recombinant cell line through first resistance screening and monoclonal screening" includes:

[0024] Determine whether the basic framework DNA expression unit is inserted into the genome through the first resistance screening; determine whether the basic framework DNA expression unit is correctly inserted at the gene locus by extracting the genome sequencing; determine whether a single copy of the basic framework DNA expression unit is inserted by simultaneous electroporation of red and green fluorescent genes and flow cytometry of the red-green light ratio; and obtain an intermediate recombinant cell line through monoclonal screening.

[0025] Optionally, the second screening marker is glutamine synthetase, and the cell line to be transformed is a Chinese hamster ovary cell in which both glutamine synthetase alleles are knocked out.

[0026] Optionally, the sgRNA is one of sgRNA1, sgRNA2 and sgRNA3:

[0027] Wherein, the sgRNA1 includes sgRNA1-F and sgRNA1-R, the gene sequence of the sgRNA1-F is shown in SEQ ID NO: 3, and the gene sequence of the sgRNA1-R is shown in SEQ ID NO: 4;

[0028] The sgRNA2 includes sgRNA2-F and sgRNA2-R, the gene sequence of the sgRNA2-F is shown in SEQ ID NO: 5, and the gene sequence of the sgRNA2-R is shown in SEQ ID NO: 6;

[0029] The sgRNA3 includes sgRNA3-F and sgRNA3-R, the gene sequence of the sgRNA3-F is shown in SEQ ID NO: 7, and the gene sequence of the sgRNA3-R is shown in SEQ ID NO: 8.

[0030] The present invention also provides an application of the DNA vector as described above in recombinant protein expression or gene function research.

[0031] In the technical solution of the present invention, the DNA vector includes a basic framework DNA vector and a target gene DNA vector, wherein the basic framework DNA vector includes a basic framework DNA expression unit, and the target gene DNA vector includes a target gene DNA expression unit, wherein the basic framework DNA expression unit includes a replaceable gene sequence, and the replaceable gene sequence can be replaced by a DNA expression unit containing a target gene or an exogenous gene through a gene editing method, thereby realizing the insertion of the target gene or the exogenous gene. Since the basic framework DNA expression unit does not contain the promoter of the second screening marker gene, when the target gene DNA expression unit is inserted into the basic framework DNA expression unit to replace the replaceable gene sequence, the obtained vector has the promoter of the second screening marker gene, thereby being able to start the expression of the second screening marker, and then being able to screen the vector that has not been successfully inserted into the specific site of the basic framework DNA expression unit, and obtain the vector that successfully inserts the target gene or the exogenous gene into the specific site of the basic framework DNA expression unit. Therefore, after inserting the above-mentioned infrastructure DNA expression unit into the reserved insertion site of the cell, the target gene DNA expression unit is then inserted into the specific site of the infrastructure DNA expression unit through a gene editing method, so that a stable cell line with fixed-site insertion can be obtained with a higher probability, and the screening operations after the insertion of the target gene can be reduced, which greatly shortens the screening time after the insertion of the target gene and quickly realizes the production and research applications related to the target gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the structures shown in these drawings without paying creative work.

[0033] Figure 1 A schematic diagram of genetic information in an embodiment of a basic structure DNA vector provided by the present invention;

[0034] Figure 2 A schematic diagram of genetic information in an embodiment of a target gene DNA vector provided by the present invention;

[0035] Figure 3 for Figure 2 Insertion of target gene into DNA vector Figure 1 Schematic diagram of the genetic information behind the DNA vector in the basic structure;

[0036] Figure 4 This is a schematic diagram of the chromosome walking gel results in Example 1 of the present invention;

[0037] Figure 5 This is a schematic diagram of the sgRNA verification results in Example 2 of the present invention.

[0038] The realization of the purpose, functional features and advantages of the present invention will be further explained in conjunction with embodiments and with reference to the accompanying drawings. DETAILED DESCRIPTION

[0039] To make the purpose, technical scheme and advantages of the embodiment of the present invention clearer, the technical scheme in the embodiment of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiment, it is carried out according to the normal conditions or the conditions recommended by the manufacturer. If the reagents or instruments used do not specify the manufacturer, they are all conventional products that can be purchased commercially. In addition, the meaning of "and / or" appearing in the full text includes three parallel schemes, taking "A and / or B" as an example, including scheme A, or scheme B, or schemes that A and B meet at the same time. In addition, the technical schemes between the various embodiments can be combined with each other, but must be based on the ability of ordinary technicians in the field to achieve. When the combination of technical solutions is contradictory or cannot be achieved, it should be considered that the combination of such technical solutions does not exist, and is not within the scope of protection required by the present invention. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without making creative work belong to the scope of protection of the present invention.

[0040] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a skilled artisan. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Animal Cell Culture (RI Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (PCR: The Polymerase Chain Reaction) (Academic Press, Inc., 1987). Reaction" (Mullis et al., eds., 1994); and Current Protocols in Immunology (JE Coligan et al., eds., 1991), each of which is expressly incorporated herein by reference.

[0041] Stable cell lines refer to cell lines that integrate specific genes into the cell genome through molecular biological methods, so that the cells can stably express the target gene or interfere with gene expression for a long time. They are suitable for various research applications, such as recombinant protein and antibody production, gene editing, functional research, drug screening, etc. By establishing stable cell lines, the cost of frequent transfection or virus packaging can be greatly reduced, which is convenient for studying gene function in target cells; different from transient transfection, which introduces high copy number expression randomly for a short period of time, stable cell lines can be obtained through screening and amplification to obtain stable high expression or appropriate copy number cell lines. The methods for constructing stable cell lines can be roughly divided into four categories. The most mainstream method is lentivirus-mediated, which has the advantages of high mediation efficiency and short construction time, but there are certain biosafety risks, and it is difficult to package large genes into lentiviruses. Cell lines may undergo apoptosis or metamorphosis when infected with lentiviruses, and the workload of high-throughput stable transfection of multiple genes is large. The second type is the cell stable transposon system mediated by the transposon system. The experimental method is safe and simple, which is conducive to transposition to the transcriptionally active region of the host genome. It can effectively mediate larger genes and can continuously express single or multiple genes. This method effectively makes up for the shortcomings of lentivirus-mediated transduction. The third type is the CRISPR knock-in system, which can achieve site-specific insertion of exogenous genes, but the gene knock-in of the CRISPR system is a probabilistic event. The knock-in efficiency varies with the selection of sgRNA sites and the differences in the inserted genes. It is necessary to improve the knock-in level by optimizing the sequence and mediation efficiency. In the later stage, it will take a lot of time to perform monoclonal sorting to obtain the correct site-specific knock-in cell line. The fourth type is the most primitive method for constructing stable transgenic strains, that is, plasmid screening stable transgenic cell lines, transfecting the target plasmid into the cell, and through long-term resistance screening, there is a certain probability of obtaining stable transgenic cell lines. Due to its extremely low efficiency, it is rarely used at present. There are many methods for constructing stable transgenic strains, most of which are random insertions, and site-specific insertions are more difficult.

[0042] Currently, it is mainly achieved through the CRISPR knock-in system, but when sgRNA is directly designed for a selected site on the genome, there is a certain probability of insertion into other sites, and the number of inserted copies is not fixed, which may pose potential risks. In the later stage, it is still necessary to conduct monoclonal screening and verification for a long time to obtain stable strains with determined sites and copy numbers, which hinders its rapid application.

[0043] In view of this, the present invention proposes a DNA vector, aiming to solve the problem that it is difficult to insert a target gene at a specific site when preparing a stable cell line.

[0044] In the technical solution of the present invention, please refer to Figures 1 to 3The DNA vector comprises a basic framework DNA vector and a target gene DNA vector, wherein the basic framework DNA vector comprises a basic framework DNA expression unit, wherein the basic framework DNA expression unit comprises a 5' end homology sequence, a first promoter gene sequence, a replaceable gene sequence, a second screening marker gene sequence, a second terminator gene sequence, and a 3' end homology sequence in sequence from 5' to 3'; the target gene DNA vector comprises a target gene DNA expression unit, wherein the target gene DNA expression unit comprises FRT3, a target gene sequence, a first terminator gene sequence, a second promoter gene sequence, and FRT in sequence from 5' to 3'; wherein the replaceable gene sequence comprises FRT3, a first screening marker gene sequence, a first terminator gene sequence, and FRT in sequence from 5' to 3', and the replaceable gene sequence can be replaced by the target gene DNA expression unit.

[0045] In the technical solution of the present invention, the DNA vector includes a basic framework DNA vector and a target gene DNA vector, wherein the basic framework DNA vector includes a basic framework DNA expression unit, and the target gene DNA vector includes a target gene DNA expression unit, wherein the basic framework DNA expression unit includes a replaceable gene sequence, and the replaceable gene sequence can be replaced by a target gene DNA expression unit containing a target gene or an exogenous gene through a gene editing method, thereby realizing the insertion of the target gene or the exogenous gene. Since the basic framework DNA expression unit does not contain the promoter of the second screening marker gene, when the target gene DNA expression unit is inserted into the basic framework DNA expression unit to replace the replaceable gene sequence, the obtained vector has the promoter of the second screening marker gene, thereby being able to start the expression of the second screening marker, and then being able to screen the vector that has not been successfully inserted into the specific site of the basic framework DNA expression unit, and obtain the vector that successfully inserts the target gene or the exogenous gene into the specific site of the basic framework DNA expression unit. Therefore, after inserting the above-mentioned infrastructure DNA expression unit into the reserved insertion site of the cell, the target gene DNA expression unit is then inserted into the specific site of the infrastructure DNA expression unit through a gene editing method, so that a stable cell line with fixed-site insertion can be obtained with a higher probability, and the screening operations after the insertion of the target gene can be reduced, which greatly shortens the screening time after the insertion of the target gene and quickly realizes the production and research applications related to the target gene.

[0046] The FRT3 gene sequence and the FRT gene sequence in the infrastructure DNA expression unit serve as sites recognized by the recombinase FLP, and can replace the sequence between FRT3 and FRT in the Master pad with the sequence between FRT3 and FRT in the target gene DNA expression unit.

[0047] The infrastructure DNA expression unit is also called Master pad. The design of Master pad requires that it be inserted into the genome at a fixed point, and at the same time reserve the insertion site and screening marker of the target gene. Its own screening marker (first screening marker) must be different from the screening marker of the target gene (second screening marker). Figure 1 , the first promoter can start the expression of the first screening marker, thereby screening out cells that have not been successfully inserted into the infrastructure DNA expression unit; along the 5' to 3' direction, in the Master pad where the target gene DNA expression unit is not inserted, the first promoter can start the expression of the first screening marker, and the first terminator is before the second screening marker gene sequence, so the second screening marker cannot be expressed; and in the Master pad where the target gene DNA expression unit is inserted, the first promoter can start the expression of the target gene, the terminator of the target gene and the promoter of the second screening marker are between FRT3 and FRT, which can not only start the expression of the target gene, but also start the expression of the second screening marker, thereby screening out cells that have not been successfully inserted into the target gene DNA expression unit. It should be noted that the second screening marker gene is not contained in the cell line to be inserted into the infrastructure DNA expression unit, so that the single copy of the target gene DNA expression unit can be inserted at the designated site.

[0048] The target gene sequence (MCS) is a multiple cloning site, and the exogenous gene can be constructed into the target gene DNA vector by double enzyme digestion or homologous recombination according to actual needs.

[0049] In the specific operation, the basic framework DNA expression unit (Masterpad) can be designed and synthesized according to the above structure, and it can be constructed on the pUC19 plasmid for replication and amplification. A large number of linearized fragments, namely the basic framework DNA vector, are obtained by plasmid enzyme digestion. The basic framework DNA vector and the sgRNA plasmid are mixed and electrotransferred into the cell, and the gene insertion is completed by the CRISPR system. Through the first screening marker, the cell strain successfully inserted into the basic framework DNA expression unit is screened, which can be used for subsequent site-specific insertion of multiple different target genes; the target gene DNA vector is used as a carrier of the target gene, and the site-specific insertion of the exogenous gene or the target gene is realized by the efficient FLP / FRT gene editing method, and the cell strain with the inserted target gene DNA expression unit is screened for the second screening marker related screening. Only the cells with the target gene inserted into the predetermined position of the Master pad will start the expression of the second screening marker gene, so that the second screening marker related screening can be passed. The technical solution of the present application saves a lot of workload and time for monoclonal screening and gene insertion position verification. The target gene or exogenous gene can be inserted into the cell strain after the transformation of the basic framework DNA vector, which is conducive to the application and promotion of stable transformation strains.

[0050] The first screening marker gene sequence and the second screening marker gene sequence are respectively selected from one of a hygromycin gene sequence and a glutamine synthetase gene sequence. It should be noted that when the first screening marker gene sequence is a hygromycin gene sequence, the second screening marker gene sequence is a glutamine synthetase gene sequence; when the first screening marker gene sequence is a glutamine synthetase gene sequence, the second screening marker gene sequence is a hygromycin gene sequence.

[0051] Further, the first screening marker gene sequence is a hygromycin (HygR) gene sequence. The first screening marker gene sequence can not only use the hygromycin gene sequence, but also can use other screening marker gene sequences such as glutamine synthetase gene sequence or puromycin gene sequence, as long as the cell strain after the insertion of the Master pad can be screened. It should be noted that the first screening marker cannot be the same as the second screening marker. For example, when hygromycin is selected as the first screening marker, hygromycin cannot be selected as the second screening marker. When the first screening marker gene sequence is a hygromycin gene sequence, hygromycin is added to the screening medium to screen the cell strain after the Master pad is inserted, and the surviving cell strain is the cell strain inserted with the Master pad.

[0052] The second screening marker gene sequence is a glutamine synthetase (GS) gene sequence. The second screening marker gene sequence can not only use the glutamine synthetase gene sequence, but also can use other screening marker gene sequences such as hygromycin gene sequence or puromycin gene sequence, as long as the cell strain after the insertion of the target gene DNA expression unit can be screened. It should be noted that the second screening marker cannot be the same as the first screening marker. For example, when glutamine synthetase is selected as the second screening marker, glutamine synthetase cannot be selected as the first screening marker. When the second screening marker gene sequence is a glutamine synthetase gene sequence, only cells with the target gene inserted into the predetermined position of the Master pad will start the expression of the glutamine synthetase gene, so that they can survive in a culture medium without L-glutamine.

[0053] The first promoter gene sequence and the second promoter gene sequence are respectively selected from one of the CMV promoter gene sequence and the SV40 promoter gene sequence. Further, the first promoter gene sequence is a CMV promoter gene sequence. That is, the first promoter is a CMV promoter (CMV promoter), and the first promoter can also be a SV40 promoter or a chicken β-actin promoter, etc. The use of the CMV promoter can provide strong transcriptional activity and efficiently drive gene expression. The second promoter gene sequence is an SV40 promoter gene sequence. That is, the second promoter is a SV40 promoter (SV40 promoter), and the second promoter can also be a CMV promoter or a chicken β-actin promoter, etc. The use of the SV40 promoter has a strong starting ability and can efficiently drive gene expression.

[0054] The first terminator gene sequence and the second terminator gene sequence are respectively selected from one of the β-globin polyA gene sequence and the SV40 polyA gene sequence. Further, the first terminator gene sequence is the β-globinpolyA gene sequence. That is, the first terminator is β-globin polyA, and the first terminator can also be a gene sequence such as SV40 polyA that stops the synthesis of mRNA at a specific position and starts to degrade. The second terminator gene sequence is the SV40 polyA gene sequence. That is, the second terminator is SV40 polyA, and the second terminator can also be a gene sequence such as β-globinpolyA that stops the synthesis of mRNA at a specific position and starts to degrade.

[0055] It should be noted that the above conditions can be set separately or simultaneously. Preferably, when the first screening marker gene sequence is a hygromycin gene sequence, the second screening marker gene sequence is a glutamine synthetase gene sequence, the first promoter gene sequence is a CMV promoter gene sequence, the second promoter gene sequence is an SV40 promoter gene sequence, the first terminator gene sequence is a β-globin polyA gene sequence, and the second terminator gene sequence is an SV40 polyA gene sequence, better gene editing effect and screening effect can be obtained.

[0056] Furthermore, the first promoter gene sequence is a CMV promoter gene sequence, and the infrastructure DNA expression unit further includes a CMV enhancer gene sequence, and the CMV enhancer gene sequence is arranged between the 5' end homology sequence and the first promoter gene sequence. The CMV enhancer can effectively drive the CMV promoter, thereby increasing the expression of the gene, so the combination of the CMV enhancer and the CMV promoter can improve the efficiency of gene expression.

[0057] The infrastructure DNA expression unit also includes an intron A gene sequence (IntronA) and an intron B (IntronB) gene sequence, wherein the intron A gene sequence is located between the first promoter gene sequence and FRT3, and the intron B gene sequence is located between FRT and the second screening marker gene sequence. Gene expression can be promoted by adding the intron A gene sequence and the intron B gene sequence.

[0058] Furthermore, the infrastructure DNA vector is obtained by transforming the pUC19 plasmid, and the infrastructure DNA expression unit is constructed on the pUC19 plasmid for replication and amplification. A large number of linearized fragments are obtained by plasmid enzyme digestion. The linearized fragments are the infrastructure DNA vector, which are mixed with the sgRNA plasmid and electroporated into cells, and gene insertion can be completed through the CRISPR system.

[0059] The target gene DNA vector is obtained by transforming the pUC19 plasmid, and the target gene DNA vector is constructed by inserting the target gene DNA expression unit into the pUC19 plasmid. Figure 2 On the target gene DNA vector (pDDCR plasmid) of the structure shown, the specific position is to replace the target gene sequence, so that the site-specific insertion of the exogenous gene can be achieved through the efficient FLP / FRT gene editing method.

[0060] In addition, it should be noted that the 5' end homology sequence and the 3' end homology sequence are sequences of 300 to 1000 bp near the sgRNA, and the sequences of 300 to 1000 bp near the sgRNA are used as the 5' end homology sequence and the 3' end homology sequence to determine the position of the Master pad insertion; BamHI can be selected as the restriction endonuclease for linearization of the Master pad, and the pUC19 plasmid itself is required not to contain the restriction site.

[0061] Furthermore, the nucleotide sequence of the basic framework DNA expression unit is shown in SEQ ID NO: 1, specifically:

[0062]

[0063] The nucleotide sequence of the target gene DNA expression unit is shown in SEQ ID NO: 2, specifically:

[0064]

[0065] The present invention further provides a method for site-specific insertion of an exogenous gene sequence, using the DNA vector as described above, the method for site-specific insertion of an exogenous gene sequence comprises the following steps:

[0066] S10, selecting a cell line and a genomic site to be modified for site-specific insertion, designing sgRNA according to the site and the gene editing protein used, and constructing the sgRNA on a plasmid to obtain an sgRNA plasmid;

[0067] S20, using the sgRNA plasmid to electroporate the infrastructure DNA expression unit into the cell line to be transformed, and obtaining an intermediate recombinant cell line through the first resistance screening;

[0068] S30, inserting the target gene DNA expression unit constructed with the target gene into the intermediate recombinant cell strain using the FLP / FRT recombinase system, and obtaining a cell strain with a fixed-site single-copy insertion of the target gene through a second resistance screening;

[0069] Wherein, the cell line to be transformed is a cell line that does not contain the second resistance screening gene.

[0070] In the technical solution provided in the present application, the cell line is transformed, and a single copy of some elements is inserted into a specific site in advance, and a single clone is obtained through the first resistance screening. The subsequent insertion of the target gene is carried out on the transformed intermediate recombinant cell line. Since the second screening marker gene is inserted into the genome in advance, and its promoter is brought in when the target gene is inserted, even if the target gene is mistakenly inserted into other sites, the cell line still cannot pass the relevant screening of the second screening marker. Therefore, the cell strains that pass the relevant screening of the second screening marker are theoretically the same in genetic background, thereby greatly reducing the screening time when inserting the target gene and ensuring the realization of fixed-point single-copy insertion, which is conducive to the rapid realization of its production and research applications.

[0071] Further, the second screening marker is glutamine synthetase, and the cell line to be modified is a Chinese hamster ovary cell in which the biallelic gene (GS) of glutamine synthetase is knocked out. Chinese hamster ovary cells (CHO-K1 2H11) in which the biallelic gene of glutamine synthetase is knocked out cannot survive in a culture medium without L-glutamine, and the CHO-K12H11 (referred to as 2H11-MP) inserted into the infrastructure DNA expression unit cannot survive in a culture medium without L-glutamine because the GS gene cannot be expressed; only the 2H11-MP inserted into the target gene DNA expression unit can start the expression of the GS gene, so it can survive in a culture medium without L-glutamine. Therefore, the cell line with a single copy of the target gene inserted at a fixed point can be screened by using a culture medium without L-glutamine.

[0072] In step S10, CHO-K1 2F10 (CGMCC 45325) cell line is obtained by domestication based on CHO-K1 (ECACC), and then the GS double allele is knocked out to obtain CHO-K1 2H11 cell line (also referred to as 2H11 or CHO-K1 2H11 cell line in other places in this application), and the locus in the genome of CHO-K1 2H11 cell line that can be used for site-specific insertion of exogenous genes is determined by chromosome walking technology sequencing, and the locus should have the characteristics of stability, high expression, and no effect on the expression of other genes. Preferably, the locus that can be used for site-specific insertion of exogenous genes is LOC103161380. Using CRISPR-Cas9 technology, the CRISPOR website (http: / / crispor.tefor.net / ) is used to select the three pairs of sgRNAs with the highest comprehensive scores for the locus sequence, namely sgRNA1, sgRNA2 and sgRNA3.

[0073] Wherein, the sgRNA1 includes sgRNA1-F and sgRNA1-R, and the gene sequence of the sgRNA1-F is shown in SEQ ID NO: 3, specifically:

[0074] caccGTTGGTTCAAAAATCTTCAG

[0075] The gene sequence of the sgRNA1-R is shown in SEQ ID NO: 4, specifically:

[0076] aaacCTGAAGATTTTTGAACCAAC

[0077] The sgRNA2 includes sgRNA2-F and sgRNA2-R. The gene sequence of sgRNA2-F is shown in SEQ ID NO: 5, specifically:

[0078] caccGGTGGCTAAGGAGATGAACT

[0079] The gene sequence of the sgRNA2-R is shown in SEQ ID NO: 6, specifically:

[0080] aaacAGTTCATCTCCTTAGCCACC

[0081] The sgRNA3 includes sgRNA3-F and sgRNA3-R. The gene sequence of sgRNA3-F is shown in SEQ ID NO: 7, specifically:

[0082] caccGCCTTGCACCATGTGGGTTTC

[0083] The gene sequence of the sgRNA3-R is shown in SEQ ID NO: 8, specifically:

[0084] aaacGAAACCCACATGGTGCAAGGC

[0085] In step S20, the sgRNA is one of sgRNA1, sgRNA2 and sgRNA3, and the sgRNA is used to insert the infrastructure DNA vector into the cell line to be transformed. In some embodiments, the CRISPR-Cas9 gene editing method is used to insert the infrastructure DNA template into the cell line to be transformed at a determined site under the guidance of sgRNA to complete the transformation of the cell line.

[0086] Determine whether the infrastructure DNA expression unit is inserted into the genome through the first resistance screening; the first resistance screening is a screening related to the first screening marker gene sequence, for example: when the first screening marker gene is the hygromycin gene, the first resistance screening is to transfer the cells to a culture medium containing hygromycin for screening. Determine whether the infrastructure DNA expression unit is correctly inserted at the locus position by extracting the genome sequencing. The red and green fluorescent genes are electroporated simultaneously, and the red and green light ratio is determined by flow cytometry to determine whether a single copy of the infrastructure DNA expression unit is inserted; the FLP / FRT gene editing method is used to complete the transfection of the red and green fluorescent genes to determine whether a single copy of the infrastructure DNA expression unit is inserted. Through the above screening, an intermediate recombinant cell line is obtained, pending the subsequent insertion of multiple target genes or exogenous genes.

[0087] Before step S30, the process also includes inserting the target gene or exogenous gene into the target gene DNA expression unit. For example, when the exogenous gene is an Anti-HCG antibody gene, the Anti-HCG antibody sequence is constructed onto the pDDCR plasmid to replace the target gene sequence, thereby obtaining a target gene DNA expression unit constructed with the Anti-HCG antibody gene, and the vector thereof is the pDDCR plasmid.

[0088] In step S30, the target gene DNA expression unit constructed with the target gene is inserted into the intermediate recombinant cell strain, and a cell strain with a fixed-site single-copy insertion of the target gene is obtained through a second resistance screening.

[0089] The method for site-specific insertion of exogenous gene sequences provided by the present invention can be used to achieve stable and efficient expression of exogenous genes, with a clear genetic background, greatly shortening the time for constructing stable cell lines, and promoting large-scale production and application of cell-expressed antibodies or proteins.

[0090] The present invention also provides an application of the DNA vector as described above in recombinant protein / antibody expression or gene function research.

[0091] The technical solution of the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only used to explain the present invention, and are not used to limit the present invention.

[0092] Example 1 Selection of site-directed insertion loci

[0093] 1. MM16-14B10 cell line performance verification

[0094] In the early experiments, it was found that the MM16-14B10 stable cell line expressed MM16 antibody at a yield of up to 3g / L. In the subsequent exploration of its growth performance, it was found that the stable cell line was subcultured to the 20th generation in Quacell CHO CD04 medium, with good cell uniformity (>90%), a stable viability of more than 98%, and an average doubling time of 22h, showing good subculture stability. 6 cells / ml, and the counting density was 4×10 every 3 days. 6 ~6×10 6 cells / ml; 0.3×10 6 cells / ml, and the density was 6.3×10 cells / ml every 4 days. 6 ~7.5×10 6 cells / ml, and the overall cell density showed a slow upward trend, which was in line with the growth law of CHO cells. The P0, P5, P10, P15, and P20 generation cells were cultured in shake flasks and Fed Batch culture to track the antibody production and quality. The antibody expression was acceptable, the quality did not change significantly, and it remained relatively stable, with good target gene expression stability. At the same time, the genomes of the P5, P10, P15, and P20 generation cells of M16-14B10 were extracted, and the optimal primers of the target gene and the internal reference gene B2M were used as templates for qPCR detection. The copy number deviations of P5, P10, P15, and P20 relative to P0 were 1%, 0%, 5%, and 11%, respectively. The genetic material remained relatively stable, with good genetic stability. It was further found that the MM16-14B10 cell line was a single copy. In summary, the insertion site of the MM16 antibody has good performance and can be used as a site for single-copy fixed-point insertion.

[0095] 2. Determine the location of the MM16 antibody insertion locus

[0096] The unknown sequence region was amplified using chromosome walking technology, and three specific primers 3'-SP1, 3'-SP2, and 3'-SP3 at the 3' end of the known sequence were designed, and their nucleotide sequences are shown in SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11, and three specific primers 5'-SP1, 5'-SP2, and 5'-SP3 at the 5' end, and their nucleotide sequences are shown in SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14.

[0097] The specific nucleotide sequence of 3'-SP1 is: GCTCCGTGGTGCACGAGGGCCTGCAC

[0098] The specific nucleotide sequence of 3'-SP2 is: GAAGATCCCTCGAGATCCATTGTGCT

[0099] The specific nucleotide sequence of 3'-SP3 is: CATGCGTCATTTTGACTCACGCGGTC

[0100] The specific nucleotide sequence of 5'-SP1 is: AGCCTCCTCACTACTTCTGGAATAGC

[0101] The specific nucleotide sequence of 5'-SP2 is: GCCTGGGGACTTTCCACACCCTAACTG

[0102] The specific nucleotide sequence of 5'-SP3 is: GCTGTCCCTCATAAAAGTTTTGTTAC

[0103] The design principles of specific primers refer to the instructions of Takara Genome Walking Kit (Code NO.6108). Three rounds of PCR were performed using three specific primers at the 3' end and 5' end and four degenerate primers provided by the kit. The template for the next round was the PCR product of the previous round. The PCR products of the three rounds were subjected to agarose gel electrophoresis. The results of the gel run were as follows: Figure 4 As shown. The clear electrophoresis bands in the third round of PCR products were recovered by gel excision. After TA cloning of the PCR products at both ends, 10 strains were randomly selected for sequencing. The sequencing results showed that the 10 sequencing fragments at the 5' end and the 10 sequencing fragments at the 3' end were the same sequence. The sequencing results were compared with the whole genome of CHO-K1 and the locus inserted in the MM16-14B10 cell line was determined to be LOC103161380.

[0104] Example 2 Design, synthesis and verification of sgRNA

[0105] 1. Design and synthesis of sgRNA

[0106] Using CRISPR-Cas9 technology, the three pairs of sgRNAs with the highest comprehensive scores were selected from the CRISPOR website (http: / / crispor.tefor.net / ) for the locus sequence and named sgRNA1, sgRNA2 and sgRNA3, respectively. sgRNA1 includes sgRNA1-F and sgRNA1-R, sgRNA2 includes sgRNA2-F and sgRNA2-R, sgRNA3 includes sgRNA3-F and sgRNA3-R, the gene sequence of sgRNA1-F is shown in SEQ ID NO: 3, the gene sequence of sgRNA1-R is shown in SEQ ID NO: 4, the gene sequence of sgRNA2-F is shown in SEQ ID NO: 5, the gene sequence of sgRNA2-R is shown in SEQ ID NO: 6, the gene sequence of sgRNA3-F is shown in SEQ ID NO: 7, and the gene sequence of sgRNA3-R is shown in SEQ ID NO: 8. As shown in IDNO: 8, it was synthesized by Shanghai Jierui Biotechnology Co., Ltd. and constructed into the PX458 plasmid, which contains the functional elements required for gene editing, including gRNA scaffold, cas9 protein gene sequence and green fluorescent protein GFP.

[0107] 2. Verification of sgRNA editing efficiency

[0108] Preparation of CHO-K1 2H11 transfected cells: The present invention is based on the CHO-K1 (ECACC) domesticated CHO-K12F10 (CGMCC 45325) cell line, and then the CHO-K1 2H11 cell line (hereinafter referred to as 2H11) obtained by knocking out the GS double alleles. This cell line needs to be supplemented with 4-6mM L-glutamine in the culture medium to maintain normal growth. Inoculate a bottle of 2H11 cells, and the cell density is controlled at 5×10 5 cells / mL, incubate at 180 rpm in a humidified orbital shaking incubator containing 5% CO2 at 37°C for 24 h. Count the cells using an automated cell counter by trypan blue exclusion to calculate the appropriate volume of culture required for transfection (cell density adjusted to 1×10 7 cells / mL), transferred to a sterile conical centrifuge tube, centrifuged at 15-25°C, 1000 rpm for 5 minutes, carefully aspirated the supernatant, and resuspended the cell pellet in PBS (pH 7.4) for later use.

[0109] Transfection of sgRNA plasmid: Prepare complete medium (supplemented with 6 mM L-glutamine) as transfection and recovery medium, label 3 T-25cm 2Suspension cell culture flasks, under sterile conditions, add 4.0 mL of complete medium to each culture flask, gently mix 0.8 mL of cell suspension and 30 μg of sgRNA1 plasmid or sgRNA2 plasmid or sgRNA3 plasmid in 3 sterile microcentrifuge tubes, transfer them to 3 cooled electroporation cups, and perform electroporation according to certain parameters (300 V voltage, 950 μF capacitance, exponential decay pulse). After electroporation, transfer the cells to a T-25 cm containing 4.0 mL of complete medium. 2 The suspension cells were placed in culture flasks and incubated at 37°C and 5% CO2 for 48 hours.

[0110] Verification of editing efficiency: The cell genome was extracted 2 days after transfection, and PCR amplification was performed using verification primers. The verification primers (YZ primer) included YZ primer-F and YZ primer-R. The sequence of YZ primer-F is shown in SEQ ID NO: 15, specifically:

[0111] TGGAGTGTTCTACATGGCAC

[0112] The sequence of YZ primer-R is shown in SEQ ID NO: 16, specifically:

[0113] TCTGTCTGAGGTGGAGGCTC

[0114] T7 Endonuclease I was added to half of the PCR products, and not added to the other half. Both were run on a gel to determine the bands. The results are as follows: Figure 5 As shown. If the product with added T7 Endonuclease I shows multiple bands, and the product without added is a single band, then the sgRNA can cut the gene. For the cutting principle and enzyme cutting system of T7 Endonuclease I, please refer to the product manual of Novizan T7 Endonuclease I (EN303). As can be seen from the figure, all three pairs of sgRNAs can be used for gene editing, and sgRNA2 is finally selected for subsequent CRISPR gene editing.

[0115] Example 3 Design and synthesis of Master pad and pDDCR plasmid

[0116] 1. Design and synthesis of master pad sequences

[0117] Master pad is a sequence pre-integrated into the genome of CHO-K1 2H11 cells, which is synthesized by General Biotech Co., Ltd. and constructed on the pUC19 plasmid for replication and amplification. A large number of linearized fragments are obtained by plasmid restriction digestion, mixed with sgRNA2 plasmid and electroporated into cells, and gene insertion is completed through the CRISPR system. The master pad structure diagram is shown in the figure below. Figure 1 The nucleotide sequence of the Master pad is shown in SEQ ID NO:1.

[0118] BamHI was selected as the restriction endonuclease for linearization of the Master pad, requiring that the pUC19 plasmid itself does not contain this restriction site;

[0119] The 300-1000bp sequence near the endonuclease sgRNA2 is used as the 5' and 3' homology arms to determine the position of the Master pad insertion. The nucleotide sequence of the 5' homology arm is shown in SEQ ID NO: 17, specifically:

[0120] GGAGACGGGGTTTCTCTGGGGGGTTTTGGAGCCTGTCCTGGCCCTCACTCTGTAGACCAGGCTAGCCTCGAACTCAGAGAGATCCGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGTGCCACCAACGCCCAGCTCCCCCTGGAGTGTTCTACATGGCACAGACCATCCAAATCTTGACTGGATTCTCTGCCTCTAAATTTGAGCACTTTCTAAATTTATTCTTTCTTTTTTTGAGACA AGGTCTCACGTGTCCTACTCTGCCCCGTCTCCCTGTGTAGTCAAGGATAATCTTGAACTCCTGATCCTCCTGCCTCCACTTCTAAGTGCTGAGAACAAGGCATGTCCCACTGTGCCTGGCTCTGAGTTACTGACCAAATGGACAAATAATCATTTCATTAGTTGGTTCAAAAATCTTCAGTGGGGTTGGCCAGATGGCTTAGCAGATGAAGGCACTTGCTGTCCAGCCTCATGACCAGAGTTTGAT

[0121] The nucleotide sequence of the 3' homology arm is shown in SEQ ID NO: 18, specifically:

[0122] AGGGACACATTCTAAGACATGTCAGGTGCCCGGAGCTCCACCTCAGACAGAGCCCTCTGTACTAATTTTTTTTTTTCCTATGTGCTTGCAGCAT TGCTACACAGACCATGATTAATCTGTCCTTACATGATTTAAGTCCTGCTGTCTACCCCTTTACTACTCTTGGGCTTTTGAGTCATTACTAAGTAAAATAAGGATTATTGAACAGCAGCATGTGGAACCCGGGCAGTAAATCTGACAAGCAAGGGAGGTACCAAGTGAGTAATTCCATGGCTACTATGTGGCTAATGACT CTACTAACTGGTAGACATGCTGGACACAGGATGATTCATGTTCTGGTAGGGACAGGGTGAGATGCTGTGTGGCTCAGAGCACTGTTCAACCTGAAGCTCATGTCTTGAACATTTCTGGAATTTTCCATGTCATATTTCTAAACTGTGGTTGGCTGGGTAAGTGAAAGTATAGGAAATAAAGCCACAGATAAGTGGGGACCAC

[0123] The guide RNA uses the strong CMV promoter to drive the expression of the hygromycin (HygR) gene, which serves as a selection marker for Master pad insertion;

[0124] β-globin polyA serves as the terminator for hygromycin (HygR) expression;

[0125] The FRT3 and FRT gene sequences are reserved as sites recognized by the recombinase FLP;

[0126] The glutamine synthetase gene (GS) is reserved as a screening marker for subsequent insertion of the target gene;

[0127] SV40 polyA serves as the terminator for GS.

[0128] 2. Design and synthesis of pDDCR plasmid

[0129] pDDCR is a plasmid that matches the 2H11-MP cell line and completes site-specific insertion of exogenous genes. It is transformed from the pUC19 plasmid. It contains the following elements, as shown in the schematic diagram of the structure. Figure 2 :

[0130] The FRT3 and FRT gene sequences are the sites recognized by the recombinase FLP. The sequence between the two can completely replace the sequence between FRT3 and FRT on the Master pad by "copy and paste"; MCS is a multiple cloning site, and the exogenous gene can be constructed into the pDDCR plasmid by double enzyme digestion or homologous recombination according to actual conditions; β-globin polyA serves as the terminator of the target gene; SV40 promoter can initiate the expression of the GS gene and serves as a screening marker for whether the target gene is correctly inserted.

[0131] Example 4 Master pad site-specific insertion into CHO-K1 2H11 cells and verification

[0132] 1. Master pad inserted into 2H11 cell

[0133] Linearization of Master pad: The Master pad-pUC19 plasmid was transformed into DH5α, and the plasmid was extracted after overnight culture in LB medium. The linearized Master pad was obtained by single digestion with BamHI restriction endonuclease.

[0134] Preparation of 2H11 transfected cells: The preparation process of 2H11 cells is the same as that of Example 2, and 4-6 mM L-glutamine needs to be added to the culture medium.

[0135] Transfection of linearized Master pad and sgRNA2 plasmid: Prepare complete medium (supplemented with 6 mM L-Gln) as transfection and recovery medium, label T-25cm 2 Suspension cell culture flask, under sterile conditions, add 4.0mL complete medium to the culture flask, gently mix 0.8mL cell suspension, 10μg sgRNA2 plasmid and 30μg linearized Master pad in a sterile microcentrifuge tube, transfer to a cooled electroporation cup, and perform electroporation according to certain parameters (300V voltage, 950μF capacitance, exponential decay pulse). After electroporation, transfer the cells to a T-25cm 2 The suspension cells were placed in culture flasks and incubated at 37°C and 5% CO2 for 48 hours.

[0136] 2. Monoclonal screening

[0137] 48 hours after transfection, cells were transferred from T-25cm 2Aseptically transfer the culture flask to a 15 ml sterile conical tube, centrifuge at 1000 rpm for 5 minutes at 15-25°C, and carefully remove the supernatant. Resuspend the cell pellet in 10.0 mL of screening medium (CHO fusion medium containing 400 μg / mL hygromycin), aseptically pipette a small amount of sample and count using an automatic cell counter by trypan blue exclusion. 4 The total volume to be added is calculated based on the density of cells / well. The cells are diluted to the required cell density with an appropriate amount of screening medium. The diluted cells are added to a 96-well plate (200 μl per well) using a multichannel pipette. The cells are placed in a humidified CO2 incubator at 37°C. After 5 days, the plate is taken out to observe the cell growth. Do not take it out to interfere with its recovery. After that, the evaporated medium is replaced with screening medium every week. Once the cells reach a confluence of nearly 80% and are relatively healthy under a microscope, the cells can be distributed to a 96-well plate (first passage plate) containing 200 μl screening medium at a dilution ratio of 1:4. This operation should occur on the 10th to 21st day after inoculation. After multiple rounds of passaging, 15 monoclonal clones were finally screened and named 2H11-MP-1, 2H11-MP-2, 2H11-MP-3, 2H11-MP-4, 2H11-MP-5, 2H11-MP-6, 2H11-MP-7, 2H11-MP-8, 2H11-MP-9, 2H11-MP-10, 2H11-MP-11, 2H11-MP-12, 2H11-MP-13, 2H11-MP-14, and 2H11-MP-15, and all of them were banked and cryopreserved.

[0138] 3. Sequencing to determine the insertion of the Master pad

[0139] The whole genomes of 15 monoclones were extracted and PCR amplified using sequencing primers. The sequencing primers CX primers include CX primer-F and CX primer-R. The sequence of CX primer-F is shown in SEQ ID NO: 19, specifically:

[0140] CACCCATCCCTTCCTTTATGT

[0141] The sequence of CX primer-R is shown in SEQ ID NO: 20, specifically:

[0142] CCCTGTCCCTACCAGAACATG

[0143] The PCR products and primers were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing to determine whether the Masterpad was correctly inserted into the selected locus. According to the sequencing results, all 15 single clones were correctly inserted into the selected locus.

[0144] 4. Use the FLP / FRT gene editing method to complete the transfection of red and green fluorescent genes to determine whether the Master pad is a single copy

[0145] Preparation of pDDCR-DsRED, pDDCR-eGFP and pGAP-FLP plasmids: The red and green fluorescent genes were constructed into the pDDCR plasmid through the two restriction sites of BstBI and SalI to obtain pDDCR-DsRED and pDDCR-eGFP. The plasmid construction was completed by General Biotech Co., Ltd. The pDDCR-DsRED and pDDCR-eGFP plasmids were transformed into DH5α, respectively, and the plasmids were extracted after overnight culture in LB medium for use. The pGAP-FLP plasmid was purchased from Hangzhou Hongsai Biotechnology Co., Ltd. The plasmid was transformed into DH5α, and the plasmid was extracted after overnight culture in LB medium for use.

[0146] Preparation of 2H11-MP transfected cells: The preparation process of 2H11-MP is the same as that in Example 2. 4-6 mM L-glutamine needs to be added to the culture medium. Transfected cells need to be prepared for all 15 monoclonal clones.

[0147] Transfection of pDDCR-DsRED, pDDCR-eGFP and pGAP-FLP plasmids: Use medium containing 6 mM L-glutamine as transfection and recovery medium, and label T-25cm 2 Suspension cell culture flask, under sterile conditions, add 4.0mL complete medium to the culture flask, gently mix 0.8mL cell suspension, 5μg pGAP-FLP plasmid, 15μg pDDCR-DsRED plasmid and 15μg pDDCR-eGFP plasmid in a sterile microcentrifuge tube, transfer to a cooled electroporation cup, and perform electroporation according to certain parameters (300V voltage, 950μF capacitance, exponential decay pulse). After electroporation, transfer the cells to a T-25cm 2 The suspension cells were placed in culture flasks and incubated at 37°C and 5% CO2 for 48 hours.

[0148] Subculturing of transfected cells: 48 h after transfection, culture the cells in a T-25 cm 2 The cells in the culture flask were centrifuged at 1000 rpm for 5 minutes at 15-25°C. The supernatant was carefully removed and the cell pellet was resuspended in 10.0 mL of GS screening medium (without L-glutamine). The resuspended cells were plated at 1 × 10 6 Total number of cells in T-75cm 2 The cells were expanded in culture flasks and incubated at 37°C and 5% CO2 for 12 days. After 12 days, the cell density was measured and 3×10 5The viable cells / mL were passaged twice.

[0149] Flow cytometry to determine the ratio of red and green fluorescence: transfer the cells after two passages to a 50mL centrifuge tube, centrifuge at 1500rpm for 5min, discard the supernatant, obtain the cell pellet, and send it to the Science Compass test platform for flow cytometry to determine the ratio of red and green fluorescence. According to the analysis results, 14 of the 15 monoclonal clones had cells that only emitted red or green light, accounting for more than 99% of the total number of cells, and the ratio of red light to green light was approximately 1:1, indicating that the Master pads in the 14 monoclonal clones were all inserted in a single copy. After a comprehensive comparison of the growth status of the cell lines, 2H11-MP-3, 2H11-MP-8, and 2H11-MP-12 were finally determined, and subsequent fixed-point insertions can be performed.

[0150] Example 5 Site-directed insertion of Anti-HCG antibody gene into 2H11-MP cells and identification

[0151] In order to verify the effect of site-specific insertion into cell lines to express antibodies, this example selected the Anti-HCG antibody sequence to be site-specifically inserted into the 2H11-MP-3 cell line for determination.

[0152] 1. Site-specific insertion of Anti-HCG antibody sequence into 2H11-MP-3 cells

[0153] The Anti-HCG antibody sequence was constructed into the pDDCR plasmid: The heavy chain and light chain sequences of the Anti-HCG antibody were connected with IRES, and then constructed into the pDDCR plasmid through the two restriction sites of BstBI and SalI. The plasmid construction was completed by General Biotechnology Co., Ltd. The pDDCR-Anti-HCG plasmids were transformed into DH5α, and the plasmids were extracted after overnight culture in LB medium for standby use. The preparation of the pGAP-FLP plasmid was the same as in Example 4.

[0154] Preparation of 2H11-MP-3 transfected cells: The preparation process of 2H11-MP-3 is the same as that of Example 2, and 4-6 mM L-glutamine needs to be added to the culture medium.

[0155] Transfection of pDDCR-Anti-HCG into 2H11-MP-3: Use medium containing 6 mM L-glutamine as transfection and recovery medium, and label T-25cm 2Suspension cell culture flask, under sterile conditions, add 4.0mL complete medium to the culture flask, gently mix 0.8mL cell suspension, 5μg pGAP-FLP plasmid and 25μg pDDCR-Anti-HCG plasmid in a sterile microcentrifuge tube, transfer to a cooled electroporation cup, and perform electroporation according to certain parameters (300V voltage, 950μF capacitance, exponential decay pulse). After electroporation, transfer the cells to a T-25cm 2 The suspension cells were placed in culture flasks and incubated at 37°C and 5% CO2 for 48 hours.

[0156] Subculture and fermentation of 2H11-Anti-HCG cells: Subculture of transfected cells was the same as in Example 4. After two subcultures, the cells were cultured at 3×10 5 Fed-batch fermentation was carried out in a 125 mL shake flask with an inoculum concentration of 1.50 μg / L. L-glutamine was not required to be added to the culture medium. Feeding began on the third day. Every other day, 4% Feed A and 0.4% Feed B were added according to the initial fermentation volume of 30 mL. Glucose was added every other day from the fifth day until the glucose was supplemented to 5 g / L. The viability of the sample was required to be >70%, and the sample was collected after a maximum of 13 days of culture.

[0157] 2. Determination of Anti-HCG Antibody Production

[0158] In order to determine whether the site-directed insertion cell line efficiently expresses Anti-HCG antibodies, the antibody expression yield was measured by a biochemical analyzer.

[0159] The experimental process is as follows:

[0160] Sample pretreatment: Take 1 mL of the fermentation broth, centrifuge at 10,000 rpm for 2 minutes at 15-25°C, remove the precipitate, and collect the supernatant as the sample to be tested;

[0161] Reagent preparation: reagent R1, reagent R2, 1× PBS (pH 7.4), goat anti-mouse secondary antibody, calibrator (concentrations are 1000 μg / mL, 500 μg / mL, 200 μg / mL, 50 μg / mL, 10 μg / mL, 0 μg / mL), quality control (concentrations are 1000 μg / mL, 200 μg / mL, 50 μg / mL);

[0162] Refer to the instructions for use of the Zhongyuan Huiji EXC800 biochemical analyzer to set parameters and place reagents, calibration, quality control and samples in the corresponding trays;

[0163] Start calibration and measure quality control. If the deviation between the quality control value and the target value is within 20%, start testing the sample to be tested and repeat the measurement three times.

[0164] The test results showed that the three test results were 1201 mg / L, 1210 mg / L, and 1197 mg / L respectively, with a test deviation of 3.29%. The results were reliable, and it was finally determined that the fermentation yield of the 2H11-Anti-HCG cell line was approximately 1203 mg / L.

[0165] The above description is only a preferred embodiment of the present invention, and does not limit the patent scope of the present invention. All equivalent structural changes made by using the contents of the present invention specification and drawings under the inventive concept of the present invention, or directly / indirectly applied in other related technical fields are included in the patent protection scope of the present invention.

Claims

1. A DNA vector for site-specific insertion of exogenous gene sequences, characterized in that: The DNA vector comprises: An infrastructure DNA vector, comprising an infrastructure DNA expression unit, wherein the infrastructure DNA expression unit comprises, from 5' to 3' direction, a 5' end homology sequence, a first promoter gene sequence, a replaceable gene sequence, a second selection marker gene sequence, a second terminator gene sequence, and a 3' end homology sequence; A target gene DNA vector, comprising a target gene DNA expression unit, wherein the target gene DNA expression unit comprises FRT3, a target gene sequence, a first terminator gene sequence, a second promoter gene sequence, and FRT in order from 5' to 3' direction; The replaceable gene sequence includes FRT3, a first screening marker gene sequence, a first terminator gene sequence, and FRT in order from 5' to 3', and the replaceable gene sequence can be replaced by the target gene DNA expression unit.

2. The DNA vector according to claim 1, characterized in that The first screening marker gene sequence and the second screening marker gene sequence are respectively selected from one of a hygromycin gene sequence and a glutamine synthetase gene sequence; and / or, The first promoter gene sequence and the second promoter gene sequence are respectively selected from one of a CMV promoter gene sequence and a SV40 promoter gene sequence; and / or, The first terminator gene sequence and the second terminator gene sequence are respectively selected from one of a β-globin polyA gene sequence and a SV40 polyA gene sequence.

3. The DNA vector according to claim 2, characterized in that The first promoter gene sequence is a CMV promoter gene sequence, the infrastructure DNA expression unit further comprises a CMV enhancer gene sequence, and the CMV enhancer gene sequence is arranged between the 5' end homology sequence and the first promoter gene sequence; and / or, The infrastructure DNA expression unit further comprises an intron A gene sequence and an intron B gene sequence, wherein the intron A gene sequence is arranged between the first promoter gene sequence and FRT3, and the intron B gene sequence is arranged between FRT3 and the first screening marker gene sequence.

4. The DNA vector according to claim 1, characterized in that The basic framework DNA vector is obtained by transforming the pUC19 plasmid, the basic framework DNA expression unit is constructed on the pUC19 plasmid for replication and amplification, and a large number of linearized fragments are obtained by plasmid enzyme digestion to obtain the basic framework DNA vector; and / or, The target gene DNA vector is obtained by transforming the pUC19 plasmid, and the target gene DNA vector is constructed by inserting the target gene DNA expression unit into the pUC19 plasmid.

5. The DNA vector according to claim 1, characterized in that The nucleotide sequence of the basic framework DNA expression unit is shown in SEQ ID NO: 1; and / or, The nucleotide sequence of the target gene DNA expression unit is shown in SEQ ID NO:

2.

6. A method for site-specific insertion of an exogenous gene sequence, using the DNA vector according to any one of claims 1 to 5, characterized in that: The following steps are involved: S10, selecting a cell line and a genomic site to be modified for site-specific insertion, designing sgRNA according to the site and the gene editing protein used, and constructing the sgRNA on a plasmid to obtain an sgRNA plasmid; S20, using the sgRNA plasmid to electroporate the infrastructure DNA expression unit into the cell line to be transformed, and obtaining an intermediate recombinant cell line through the first resistance screening; S30, inserting the target gene DNA expression unit constructed with the target gene into the intermediate recombinant cell strain using the FLP / FRT recombinase system, and obtaining a cell strain with a fixed-site single-copy insertion of the target gene through a second resistance screening; Wherein, the cell line to be transformed is a cell line that does not contain the second resistance screening gene.

7. The method for site-specific insertion of an exogenous gene sequence according to claim 6, characterized in that: The step of "obtaining an intermediate recombinant cell strain through first resistance screening and monoclonal screening" comprises: Determine whether the basic framework DNA expression unit is inserted into the genome through the first resistance screening; determine whether the basic framework DNA expression unit is correctly inserted at the gene locus by extracting the genome sequencing; determine whether a single copy of the basic framework DNA expression unit is inserted by simultaneous electroporation of red and green fluorescent genes and flow cytometry of the red-green light ratio; and obtain an intermediate recombinant cell line.

8. The method for site-specific insertion of an exogenous gene sequence according to claim 6, characterized in that: The second screening marker is glutamine synthetase, and the cell line to be transformed is a Chinese hamster ovary cell in which glutamine synthetase bi-allelic genes are knocked out.

9. The method for site-specific insertion of an exogenous gene sequence according to claim 6, characterized in that: The sgRNA is one of sgRNA1, sgRNA2 and sgRNA3: Wherein, the sgRNA1 includes sgRNA1-F and sgRNA1-R, the gene sequence of the sgRNA1-F is shown in SEQ ID NO: 3, and the gene sequence of the sgRNA1-R is shown in SEQ ID NO: 4; The sgRNA2 includes sgRNA2-F and sgRNA2-R, the gene sequence of the sgRNA2-F is shown in SEQ ID NO: 5, and the gene sequence of the sgRNA2-R is shown in SEQ ID NO: 6; The sgRNA3 includes sgRNA3-F and sgRNA3-R, the gene sequence of the sgRNA3-F is shown in SEQ ID NO: 7, and the gene sequence of the sgRNA3-R is shown in SEQ ID NO:

8.

10. Use of the DNA vector according to any one of claims 1 to 5 in recombinant protein expression or gene function research.

Images