SNP loci for identifying upland cotton germplasm resistant to high temperature and application thereof

By designing SNP sites and PCR primers for high-temperature-resistant upland cotton germplasm, the problem of difficulty in identifying high-temperature-resistant upland cotton germplasm in the existing technology was solved, rapid identification and screening were achieved, and the breeding process was promoted.

CN119859707BActive Publication Date: 2025-10-21HUAZHONG AGRI UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510218218.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-26
Publication Date
2025-10-21
Estimated Expiration
2045-02-26

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and effectively identify high-temperature-resistant germplasm of upland cotton, which limits the cotton breeding process.

Method used

The authors provide SNP sites for identifying high-temperature-resistant germplasm in upland cotton and their applications, design the upstream expression regulatory sequence of the GhKPHMT gene, and develop PCR primers for detection. Through amplification and genotyping, they achieve rapid identification of the high-temperature-resistant phenotype of upland cotton powder.

Benefits of technology

The rapid identification and screening of high-temperature-resistant germplasm of upland cotton has been achieved, which has improved breeding efficiency and enriched high-temperature-resistant gene resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119859707B_ABST
    Figure CN119859707B_ABST
Patent Text Reader

Abstract

The application discloses SNP sites for identifying upland cotton high-temperature-resistant germplasm and application thereof, belongs to the technical field of molecular biology detection, and provides SNP sites for identifying upland cotton high-temperature-resistant germplasm, wherein the SNP sites are SNP1 and SNP2; SNP1 is located at the 42577154th position on the D12 chromosome of upland cotton, and the nucleotide is T / C; and SNP2 is located at the 42577814th position on the D12 chromosome of upland cotton, and the nucleotide is A / T. The application also provides application of the SNP sites in preparation of products for identifying upland cotton high-temperature-resistant germplasm. The application provides two SNP sites linked with the pollen high-temperature-resistant phenotype of upland cotton and PCR primers for detection, enriches high-temperature-resistant gene resources of upland cotton, and accelerates the breeding process of upland cotton.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular biological detection technology, and in particular relates to SNP sites for identifying high-temperature-resistant germplasm of upland cotton and applications thereof. Background Art

[0002] Upland cotton (Gossypium hirsutum.L) produces more than 90% of natural textile fibers. Cotton production is affected by frequent extreme high temperatures exceeding 35°C in summer, which leads to high-temperature male sterility and causes a large number of buds and bolls to fall off during the concentrated boll-forming period. However, due to the complex characteristics of cotton's high-temperature resistance and the difficulty in genetic identification and germplasm screening, there is a real bottleneck in the current breeding of cotton for high-temperature resistance. In order to solve the above-mentioned industry problems, a scheme for rapid identification of cotton pollen vitality under high temperature was established, and four high-temperature resistance loci were identified in the upland cotton breeding population, namely qPV-A01, qPV-D01, qPV-D05 and qPV-D12. It is hoped that the genetic variation and effects in the high-temperature resistance loci will be analyzed to determine the high-temperature resistance gene (CN118186135A). The invention has disclosed a high-temperature resistance gene in the qPV-D12 block, with the gene ID Ghir_D12G013040. The Ghir_D12G013040 gene encodes a 3-methyl-2-oxobutyrate hydroxymethyltransferase gene, named GhKPHMT based on its abbreviation and species origin. The GhKPHMT gene positively regulates pollen heat resistance and has been used to generate heat-tolerant genetic material and germplasm in upland cotton, rice, and model plants. However, loss of this gene results in developmental defects. Therefore, using it to generate heat-tolerant upland cotton germplasm requires genetic engineering, which presents challenges in experimental implementation and widespread application. Summary of the Invention

[0003] To solve the above technical problems, the present invention proposes SNP sites and their applications for identifying high-temperature-resistant germplasm of upland cotton, provides an upstream expression regulatory sequence of the GhKPHMT gene, two SNP sites linked to the high-temperature-resistant phenotype of upland cotton powder and PCR primers for detection, enriching the high-temperature-resistant gene resources of upland cotton and accelerating the breeding process of high-temperature-resistant upland cotton.

[0004] To achieve the above object, the present invention provides SNP sites for identifying high temperature resistant germplasm of upland cotton, wherein the SNP sites are SNP1 and SNP2;

[0005] The SNP1 is located at position 42577154 on chromosome D12 of upland cotton, and the nucleotide sequence is T / C;

[0006] The SNP2 is located at position 42577814 on chromosome D12 of upland cotton, and the nucleotide sequence is A / T.

[0007] The present invention also provides primers for detecting the SNP site, wherein the primers include a forward primer and a reverse primer for amplifying the SNP1 site, and a forward primer and a reverse primer for amplifying the SNP2 site;

[0008] The nucleotide sequence of the forward primer for amplifying the SNP1 site is shown in SEQ ID NO.5;

[0009] The nucleotide sequence of the reverse primer for amplifying the SNP1 site is shown in SEQ ID NO.7;

[0010] The nucleotide sequence of the forward primer for amplifying the SNP2 site is shown in SEQ ID NO.8;

[0011] The nucleotide sequence of the reverse primer for amplifying the SNP2 site is shown in SEQ ID NO.10.

[0012] The present invention also provides the use of the SNP site in the preparation and identification of high-temperature-resistant upland cotton germplasm products.

[0013] Preferably, the product includes reagents, kits and chips.

[0014] The present invention also provides the use of the primers in preparing and identifying high-temperature-resistant upland cotton germplasm products.

[0015] Preferably, the product includes reagents, kits and chips.

[0016] The present invention also provides a method for identifying high-temperature-resistant upland cotton germplasm using the SNP site, comprising the following steps:

[0017] (1) obtaining the whole genomic DNA of the upland cotton to be tested, and performing PCR amplification using the whole genomic DNA as a template;

[0018] (2) After PCR amplification, agarose gel electrophoresis is performed to determine the genotype of the corresponding SNP based on whether the amplification is successful or not. Preferably, the PCR amplification uses the primers described above.

[0019] Preferably, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 53-56°C for 30 s, extension at 72°C for 30 s, 32-35 cycles; extension at 72°C for 5 min.

[0020] Compared with the prior art, the present invention has the following advantages and technical effects:

[0021] Based on the results of candidate gene and haplotype analysis, the present invention determined the natural variation information at the GhKPHMT gene locus and the pollen viability of the corresponding genotypes in the core upland cotton germplasm. Based on the information of the TM-1 (HZAUv1.1) reference genome, amplification primers were designed to amplify two potential regulatory sequences, and the location and authenticity of SNP1 and SNP2 were determined. Based on the SNP variation information, targeted annealing competitive KASP markers were developed and random selection experiments were conducted to perform genotyping in heat-resistant and heat-sensitive upland cotton germplasm.

[0022] The present invention discloses annealing-specific markers SNP1 and SNP2 targeting the natural variation of the upstream regulatory sequence of the GhKPHMT gene. The two markers are highly linked and can be used for the rapid identification and screening of high-temperature-resistant germplasm. The high-temperature resistance of upland cotton germplasm can be preliminarily judged based on the typing results of any one SNP. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 The results of the analysis of natural variations in the GhKPHMT gene locus;

[0025] Figure 2 The results of amplification, cloning, and sequence analysis of the GhKPHMT upstream regulatory sequence in Example 1 are shown, wherein A is the result of PCR amplification, lane 1 is the banding pattern of the fragment amplified using the primers shown in SEQ ID NO.1 and SEQ ID NO.3, lane 2 is the banding pattern of the fragment amplified using the primers shown in SEQ ID NO.2 and SEQ ID NO.3, and B shows the assembly errors and cloned sequences in the reference genome;

[0026] Figure 3 The optimal annealing temperature for SNP1 and SNP2 site mutations was determined for Example 2;

[0027] Figure 4 The statistical results of genotyping and pollen viability of SNP1 C / T and SNP2 T / A markers for different high-temperature-resistant germplasms were detected, where A represents genotyping and B represents pollen viability determination. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0033] Example 1

[0034] Natural variation mining and analysis of the GhKPHMT gene locus

[0035] Among more than 3,000 publicly available upland cotton germplasms (He, S., G. Sun, X. Geng, W. Gong, P. Dai, Y. Jia, W. Shi, Z. Pan, J. Wang, L. Wang, S. Xiao, B. Chen, S. Cui, C. You, Z. Xie, F. Wang, J. Sun, G. Fu, Z. Peng, D. Hu, L. Wang, B. Pang & X. Du (2021) The genomic basis of geographic differentiation and fiber improvement in cultivated cotton. Nat Genet, 53, 916-924.), 517 were selected, and four high-temperature resistance gene loci (CN118186135A) were identified using pollen viability under high-temperature stress. They were named qPV-A01, qPV-D01, qPV-D05 and qPV-D12 according to the chromosome names. The causal genes at the qPV-A01 and qPV-D12 loci have been publicly identified: GhHRKs (CN118345099A) and GhKPHMT (linked to the GhKPHMT gene). Molecular markers have been developed for genotyping and screening for heat-resistant germplasm (CN116790806A) targeting natural variation associated with heat resistance at the GhHRKs locus. To broaden the methods for screening heat-resistant genetic lineage and phenotypes, the present invention analyzed natural variation in the GhKPHMT gene and investigated the GhKPHMT upstream regulatory sequence (SEQ ID NO. 4) to develop molecular markers associated with the heat-resistant phenotype.

[0036] SEQ ID NO.4: ACGGTCCGTAATAACCGGTAAGAAGCCGTTGAACGAGCACCTAAAAAACGGCACCGTTCAAAGGATGATGATGGAGCGGTGACACTGGTTTGAGTTTGCAAAGATAA CAGATCGGAGGTGAAAGAAAATTTTTGAATACACTCGCGGGTTTTACAGTTGAAGAGCTTTTTGTTTCTTTAAATAAATAATTAATTATAATTATAATTATAATTATTGTTGCCTGTTGGGCATATAGCCGGTGGTGGTCGGAAATGAGGAGAGAAGAGTAAGGGGCCGGTGGTAAGTATACTTTGGATAAGGAAATTTGGCTTGGCCCAGTATTGTTTGAATTTATCGCTTTCTTTCTTTTTTTTTTTAAGGAATCGCTTTATTTTCTTGGTTGTTAATAATTTGTAATTTTAATGTTTCGTCTAAAATTAAAATATATACATATTGCAGTCTTGATGCCACGTCGTTTTAATATAACT GTGAATATTATTTTTTCAATAAATTTAAATTGAAAATTTATTGAAAATAATAAAATTAAAGGTAAACTATTAAAATAGTCACTTTTATTTATCTTAAATTATATTTTAGTCACTTATGTTTTGAAATGTTGCGTTTTAGTCACTTACATTATCACATTGTAACATTTTAGTCATTGAGCCGTTAATTGTCGGTGTAACGGTAAGCTGACGTGGCACGTTAAATCATCATTTCAAACAAAAATTTTAGATTAATTTATACAACCGGTCCCCATGTTTTTTCGTTTTAAGCAATTTAATTTTTTTTTCTTTTATGTTCTTTTAACTTCATTTTTTCTTTATTTTTCACTCTCTTCTGCATC CCCTCTGTTTTTCTCCCTTCTTTATTTCTTTTAATGTAAATTTTCTATGTTTTCCATTTGTTAAAACTAATCCCTATACTTTTATTTTCTTGAACAATTTAATTTTTTCGAGTGAGGCGAGCTTAGTCCAAGCCATGTGGAATGGCCCAGCTCGTGTGGCTCCTGTAACTAGTTTTGATTTTTCAGTTTTCGCTCCTTTTACTCCCAAATGCTCTCCTAAGTATAAAAACATGAATTTAAAGGATTAGGAGCATAAAATTCACTATTAACCTTGAATAATCACCCAAAAATGCATTAAGAATGAGACTAAAAACATGTTATTTTTAACACCTACCATATATATATTATTT TTAA AATTTCAATCCTATCCAAATTGCAATAGTTAAATGCATTTGGTTAAATTTTGCCAATAGTCCTATTCCATCAGTAAAATTGTATATTTAGTTTATATTTTT TAAT TTTTTTCATTATTAATTTTTATATTTTTTGAATTTTTAGAAATTTTGATTTTTATGCAACAACAATCATTAAATTCATTAATTTTTTTTTGTGAATGTTATTTGAAAACAACAAATTAACATGACCCTCCCAAATTTGGAAATTTAAAATTTGGCCCTTTAAAATTTATGATTTTTTAAATTAGTACATGATAAAATTACACTTT GCCCCTAAAATGAT AAAAA。

[0037] The bold and underlined portion of SEQ ID NO. 4 is the start codon "CAT", the shaded and bold "T" is the SNP1 site (C / T), and the shaded and bold "A" is the SNP2 site (T / A).

[0038] The analysis results are as follows Figure 1 As shown in Figure 2, three mutations were identified at the GhKPHMT locus through the genetic map of 517 upland cotton accessions, including a thymine insertion (+12-CT / C) 12 bp downstream of the stop codon (the insertion of thymine is downstream of the stop codon and the effect was not evaluated, it is not within the scope of SEQ ID NO. 4, and it is an clarification of the results of the big data analysis); a C / T single base mutation is located 716 bp upstream of the start codon, which is the SNP1 site (-716-C / T); 1376 bp upstream of the start codon (according to Figure 2 The actual cloned regulatory sequences of B and SEQ.ID.NO.4 show three assembly errors in the reference genome sequence, resulting in a five-base difference. Therefore, in all subsequent results, a T / A single-base variant at 1381 bp (SNP2) was used, corresponding to the aforementioned situation. These three natural variants constitute distinct haplotypes within the germplasm collection. Comparison of pollen viability across these haplotypes revealed that variation in the regulatory region upstream of the start codon contributed significantly to pollen viability. Among these accessions, 123 haplotypes with the -716-C / -1376-T haplotype at both the SPN1 and SNP2 loci exhibited generally higher pollen viability. A rank sum test yielded a significant P value of 7.12E-10, leading to the design of an experiment to clone the upstream regulatory sequence of the GhKPHMT gene and develop a marker.

[0039] To ensure correct amplification of the regulatory sequence, two forward primers, SEQ ID NO. 1 and SEQ ID NO. 2, were designed in this example, along with the reverse primer SEQ ID NO. 3 for amplification. SEQ ID NO. 2 is located 1 bp before the start codon of the GhKPHMT upstream regulatory sequence and is used to directly amplify the upstream regulatory sequence, with an expected product pattern of 2000 bp. Sequence ID NO. 1, on the other hand, is located 110 bp after the start codon of the GhKPHMT upstream regulatory sequence. The amplified product will span the start codon, which, when combined with the cloned sequence of SEQ ID NO. 2, ensures the correctness of the cloned sequence.

[0040] SEQ ID NO. 1: ACGGTCCGTAATAACCGGTAAGAA.

[0041] SEQ ID NO. 2: CAGATCGGAGGTGAAAGAAAATT.

[0042] SEQ ID NO. 3: CCAAAACAAATTTATGCTAAGGGTATTC.

[0043] After designing the primers, the genomic DNA of upland cotton TM-1 was used as a template, the PCR system was configured according to the formula in Table 1, and two amplification experiments were performed using the PCR program in Table 2. The results are shown in FIG. Figure 2 As shown in Figure A, the product fragment obtained using SEQ ID NO. 1 is greater than 2000 bp, while the product fragment amplified using SEQ ID NO. 2 is approximately 2000 bp. Because the PCR product had a single and specific banding pattern, the PCR products were ligated and sequenced using the system described in Table 3 to obtain the cloned sequence, as shown in SEQ ID NO. 3.

[0044] In the TM-1 genome, the haplotype formed by the SNP1 and SNP2 sites is T / A. At the same time, compared with the actual clone, the upstream regulatory sequence of the GhKPHMT gene in the reference genome has an assembly error at positions -1068bp, -1171bp, and -1391bp, respectively, which are 2bp missing (TTAA assembled to TA), 2bp missing (TAAT assembled to AA), and 1bp missing (AAAAA assembled to AAAA). The specific results are as follows: Figure 2 As shown in B.

[0045] The upstream regulatory sequence of the GhKPHMT gene was successfully cloned, the haplotypes of the SNP1 and SNP2 sites in the TM-1 genome were confirmed to be T / A, and three reference genome errors were corrected.

[0046] Table 1 PCR amplification system

[0047] Components Dosage DNA template (75-100 ng / μL) 1 μL 2×Buffer 20 μL Forward primer F (10 mM) 0.5μL Reverse primer R (10 mM) 0.5μL dNTP (10mM) 0.6μL DNA polymerase (10 U / μL) 0.4μL Double distilled water Make up to 40 μL

[0048] Note: In Table 1, the reagents used were Vazyme Phanta DNA Polymerase Kit #P505, purchased from Nanjing Novozymes Biotech Co., Ltd.

[0049] Table 2 PCR amplification program

[0050]

[0051] Table 3 PCR product ligation system

[0052] Components volume 5×Ultra-UniversalTOPOCloningMix 1 μL PCR products 1.5 μL Double distilled water Make up to 5 μL (react at 25℃ for 10-15 minutes)

[0053] Note: In Table 3, the reagents used were the Ultra Universal Topoisomerase Cloning Kit #C603, purchased from Nanjing Novozymes Biotech Co., Ltd.

[0054] Example 2

[0055] Development of molecular markers for upstream regulatory sequence variations of the GhKPHMT gene and their application in screening high-temperature-resistant upland cotton germplasm

[0056] After determining that the genotypes of -716 (SNP1) and -1381 (SNP2) in the TM-1 genome were T / A, six primers were designed in this example for annealing competitive molecular marker development. The six primer sequences are shown in SEQ ID NOs. 5 to 10. The primer sequences shown in SEQ ID NOs. 5 to 7 are used for -716-C / T typing, with SEQ ID NO. 5 containing a C at the 3' end and SEQ ID NO. 6 containing a T at the 3' end. SEQ ID NO. 7 is a specific reverse primer. The primer sequences shown in SEQ ID NOs. 8 to 10 are used for -1381-T / A typing, with SEQ ID NO. 8 containing a T at the 3' end and SEQ ID NO. 9 containing an A at the 3' end. SEQ ID NO. 10 is a specific reverse primer.

[0057] Primer F for GhKPHMT-716 genotype C SEQ ID NO. 5: ATTTTTCACTCTCTTCTGCATCC.

[0058] Primer F for GhKPHMT-716 typing T SEQ ID NO. 6: ATTTTTCACTCTCTTCTGCATCT.

[0059] Primer R for GhKPHMT-716 typing: SEQ ID NO. 7: TGATGGAATAGGACTATTGGCAAAA.

[0060] Primer F for GhKPHMT-1381 typing T: SEQ ID NO. 8: AATTAGTACATGATAAAATTACACT TTT.

[0061] Primer F for GhKPHMT-1381 genotype A: SEQ ID NO. 9: AATTAGTACATGATAAAATTACACT TTA.

[0062] Primer R for GhKPHMT-1381 typing: SEQ ID NO. 10: CAAAGCCCTTCAACTGCTAAAATCA.

[0063] After synthesizing the primers, the PCR system shown in Table 1 of Example 1 was configured, and the PCR program shown in Table 2 of Example 1 was used. 12 PCR amplification experiments were performed using TM-1 genomic DNA as a template and an annealing temperature option of 50-61°C.

[0064] Amplification results such as Figure 3 As shown in the figure, according to the amplification results, at an annealing temperature of 56°C, the forward primer with a C base at the 3' end was unable to properly bind to the A base on the antisense strand at position -716 on the genomic DNA of TM-1, while the forward primer with a T base at the 3' end was able to bind normally. Therefore, the optimal annealing temperature for detection at position -716 was determined to be 56°C. At an annealing temperature of 53°C, the forward primer with a T base at the 3' end was unable to properly bind to the T base on the antisense strand at position -1381 on the genomic DNA of TM-1, while the forward primer with an A base at the 3' end was able to bind normally. Therefore, the optimal annealing temperature for detection at position -1381 was determined to be 53°C.

[0065] Furthermore, among the 517 core germplasms, 24 each of high-temperature-resistant germplasms and high-temperature-sensitive germplasms were randomly selected based on the pollen viability data after high-temperature stress. The PCR system shown in Table 1 of Example 1 and the PCR program shown in Table 2 of Example 1 were used to perform genotyping of the -716 and -1381 haplotypes, respectively. The sources of the selected germplasms to be tested and the pollen viability data are shown in Table 4 below.

[0066] Table 4 Related information of selected upland cotton germplasm

[0067]

[0068]

[0069]

[0070] Genotyping results are as follows Figure 4 China A and Figure 4 As shown in Figure B, among 24 heat-resistant upland cotton germplasms, 21 amplified the -716-C / -1381-T heat-resistant genotype, and 3 amplified the -716-T / -1381-A heat-sensitive genotype. Among 24 heat-sensitive upland cotton germplasms, 5 amplified the -716-C / -1381-T heat-resistant genotype, and 19 amplified the -716-T / -1381-A heat-sensitive genotype. The chi-squared P value was 3.57E-6, reaching a significant level. These results indicate that the C / T and T / A haplotypes at the -716 / -1381 position are highly linked and can be used as molecular markers for screening heat-resistant upland cotton germplasm.

[0071] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Application of a reagent for detecting SNP molecular markers in the preparation and identification of high-temperature-resistant upland cotton germplasm products, characterized in that: The SNP molecular markers are SNP1 and SNP2; The SNP1 is located at position 42577154 on chromosome D12 of upland cotton, and the nucleotide sequence is T / C; The SNP2 is located at position 42577814 on chromosome D12 of upland cotton, the nucleotide is A / T, and the reference genome is TM-1HZAUv1.

1.

2. The application according to claim 1, characterized in that The products include kits.

3. Use of the primers for detecting the SNP molecular markers of claim 1 in the preparation and identification of high temperature resistant germplasm products of upland cotton, characterized in that: The primers include a forward primer and a reverse primer for amplifying the SNP1, and a forward primer and a reverse primer for amplifying the SNP2; The nucleotide sequences of the forward primers for amplifying the SNP1 are shown in SEQ ID NO.5 and SEQ ID NO.6; The nucleotide sequence of the reverse primer for amplifying the SNP1 is shown in SEQ ID NO.7; The nucleotide sequences of the forward primers for amplifying the SNP2 are shown in SEQ ID NO.8 and SEQ ID NO.9; The nucleotide sequence of the reverse primer for amplifying the SNP2 is shown in SEQ ID NO.

10.

4. The application according to claim 3, characterized in that The products include kits.

5. A method for identifying high temperature resistant germplasm of upland cotton using the SNP molecular marker as claimed in claim 1, characterized in that: The following steps are involved: (1) Obtaining the whole genome DNA of the upland cotton to be tested, and performing PCR amplification using the whole genome DNA as a template; (2) After PCR amplification, agarose gel electrophoresis is performed to determine the genotype of the corresponding SNP based on whether the amplification is successful or not; When the SNP molecular marker is SNP1, the annealing temperature for PCR amplification is 56°C; when the SNP molecular marker is SNP2, the annealing temperature for PCR amplification is 53°C; The PCR amplification uses the primers as claimed in claim 3.

6. The method for identifying high temperature resistant germplasm of upland cotton according to claim 5, characterized in that: The reaction procedure of the PCR amplification was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 53-56°C for 30 s, extension at 72°C for 30 s, 32-35 cycles; and extension at 72°C for 5 min.

Citation Information

Patent Citations

  • SNP variation located in upstream regulation region of GhHRK1 gene of upland cotton and application of SNP variation

    CN116790806A

  • Group of QTLs (quantitative trait loci) related to high temperature resistance of upland cotton, molecular marker and application of QTLs

    CN118186135A

  • Cotton S-locus protein kinase gene and application thereof in regulation and control of high temperature stress response

    CN118345099A