SV Molecular Markers Related to Cassava Tuberization Concentration and Their Applications

Abstract

The present invention provides an SV molecular marker related to the tuberization concentration of cassava and its application, belonging to the field of molecular biotechnology. The SV molecular marker is Chr17_30202368_30202617, which is used to predict the tuberization concentration of cassava. The primer set for amplifying the SV molecular marker includes: the sequence of the upstream primer is 5'-AACAAGAAACAAACTGTGCAT-3'; the sequence of the downstream primer is 5'-CTGCCACTTGGCTCATCT-3'. A kit is prepared using this primer set. The DNA of the cassava to be tested is subjected to PCR amplification using the above primer set or the above kit to predict the tuberization concentration of cassava. The SV molecular marker of the present invention can accurately and efficiently predict the tuberization concentration of cassava without waiting for the cassava to grow into a mature plant by planting, greatly improving the breeding selection efficiency.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to an SV molecular marker related to the tuberization concentration of cassava and its application, solving the problems of long breeding time and high breeding cost of new cassava varieties related to the tuberization concentration index in the prior art. Background Art

[0002] Cassava, also known as manioc, tree potato, woody root, etc., is a tropical and subtropical perennial shrub crop widely cultivated in tropical and subtropical regions around the world. Cassava has thick and fleshy roots rich in starch. Its appearance is rough and simple. The root tuber has various shapes and a rough epidermis, but the internal starch content is extremely high, with a delicate texture, white powder, and a soft taste. It is an important food and industrial raw material, and has elegant names such as "king of starch", "treasure of tropical crops", and "energy crop". Mature cassava root tubers are rich in starch, with large and pure starch granules, excellent processing performance, and important edible and industrial values. Therefore, the development of cassava production will greatly promote the development of related industries such as food processing, bioenergy, papermaking, textile, and feed, which is of great significance.

[0003] The tuberization concentration of cassava refers to the degree of concentration of cassava root tubers distributed on the plant. This trait is of great significance in the cultivation and utilization of cassava. For cassava varieties with high tuberization concentration, their root tubers are usually more concentrated, which is convenient for management and harvesting, and helps to improve the stability of yield. The concentrated root tubers can more effectively utilize nutrients and water in the soil, reduce competition, thereby increasing the overall yield. The concentrated root tubers are convenient for mechanical harvesting, reducing labor costs and labor intensity. Mechanical harvesting can improve the harvesting efficiency, reduce losses during harvesting, and improve the overall economic benefits.

[0004] In traditional cassava molecular breeding, farmers or breeders mainly select individual plants with excellent traits and fix the excellent traits through hybridization or backcrossing. Currently, to obtain cassava varieties with high tuberization concentration, it is necessary to wait for the plants to reach maturity and then investigate the distribution of root tubers to screen for excellent plants. This breeding method has a long breeding time and high breeding cost. Summary of the Invention

[0005] In view of the above problems, the present invention provides an SV molecular marker related to the tuberization concentration of cassava and its application.

[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] An SV molecular marker related to the tuber formation concentration in cassava, where the SV molecular marker is a large fragment deletion occurring at positions 30202368 - 30202617 on chromosome 17 (Chr17) of the cassava genome. The sequence deletion length is 250 bp, named Chr17_30202368_30202617, and the sequence is as shown in SEQ ID NO: 1;

[0008] In the cassava population carrying the SV molecular marker, the proportion of plants with a dispersed tuber formation concentration trait is less than that in the cassava population lacking this SV molecular marker (i.e., the large fragment deletion occurring at positions 30202368 - 30202617 on chromosome 17);

[0009] The tuber formation concentration trait of cassava carrying the SV molecular marker shows concentration;

[0010] The tuber formation concentration of cassava lacking this SV molecular marker shows dispersion.

[0011] An application of the above - mentioned SV molecular marker related to the tuber formation concentration in cassava, where the application is to predict the tuber formation concentration of cassava by detecting whether the cassava carries the SV molecular marker.

[0012] A primer set for amplifying the above - mentioned SV molecular marker related to the tuber formation concentration in cassava. The primer set is designed with a pair of primers upstream and downstream of the above - mentioned SV molecular marker. That is, the upstream primer is designed according to the sequence upstream of nucleotide 30202368 on chromosome 17 of the cassava genome, and the downstream primer is designed according to the sequence downstream of nucleotide 30202617 on chromosome 17 of the cassava genome, including:

[0013] The sequence of the upstream primer is 5'-AACAAGAAACAAACTGTGCAT-3';

[0014] The sequence of the downstream primer is 5'-CTGCCACTTGGCTCATCT-3'.

[0015] A kit including the above - mentioned primer set.

[0016] Furthermore, the kit includes conventional reagents for PCR amplification.

[0017] Furthermore, the kit includes: 2× Rapid Taq Master Mix and ddH 2 O.

[0018] A method for identifying the tuber formation concentration in cassava, where the method is to perform PCR amplification on the DNA of the cassava to be tested using the above - mentioned primer set to predict the tuber formation concentration of cassava;

[0019] Alternatively, the DNA of the cassava to be tested is subjected to PCR amplification using the above kit to predict the tuberization concentration of the cassava.

[0020] Furthermore, predicting the tuberization concentration of cassava is to sequence the PCR amplification product to determine whether it carries the SV molecular marker, so as to predict the tuberization concentration of cassava.

[0021] When the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 2, with a length of 543 bp, and the bases at positions 149 - 398 from the 5' end (i.e., the front end of the sequence) are the SV molecular marker fragment, at this time the test product carries this SV molecular marker, then the tuberization concentration trait of the cassava to be tested shows concentration.

[0022] Otherwise, the cassava to be tested lacks this SV molecular marker, that is, a large - fragment deletion occurs at positions 30202368 - 30202617 on chromosome 17 in the sample genome, and the length of the PCR amplification product is 293 bp, then the tuberization concentration of the cassava to be tested shows dispersion.

[0023] Furthermore, predicting the tuberization concentration of cassava is to perform electrophoresis detection on the PCR amplification product and interpret the electrophoresis detection result to predict the tuberization concentration of cassava.

[0024] When only a 543 - bp band appears in the electrophoresis detection result, then the cassava to be tested carries this SV molecular marker, and the tuberization concentration trait of the cassava to be tested shows concentration.

[0025] When only a 293 - bp band appears in the electrophoresis detection result, then the cassava to be tested lacks this SV molecular marker, and the tuberization concentration of the cassava to be tested shows dispersion.

[0026] Furthermore, the PCR amplification system includes: 12.5 μL of 2× Rapid Taq Master Mix, 1 μL of the upstream primer with a concentration of 10 μM, 1 μL of the downstream primer with a concentration of 10 μM, 1 μL of the DNA template of the cassava to be tested, and 9.5 μL of ddH 2 O.

[0027] The PCR amplification reaction program is: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 5 min.

[0028] The beneficial effects of the SV molecular marker related to the tuberization concentration of cassava and its application in the present invention are:

[0029] The present invention has developed an SV molecular marker related to the tuber formation concentration of cassava, which can accurately and efficiently predict the tuber formation concentration status in a cassava population without waiting for the cassava plants to grow into adults by planting, greatly improving the selection efficiency of cassava breeding, and can efficiently assist the breeding selection of cassava, with extremely high economic value;

[0030] The present invention has developed an SV molecular marker related to the tuber formation concentration of cassava, and established a method for accurately and rapidly identifying the tuber formation concentration of cassava, providing a more effective theoretical and practical basis for molecular marker-assisted cultivation of new cassava varieties with high tuber formation concentration; by using this molecular marker-assisted breeding technology, it is possible to accelerate the investigation of the tuber formation concentration of cassava, facilitate the screening of excellent plants, shorten the breeding cycle, and improve the breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 is the Manhattan plot of the genome-wide chromosome association analysis and localization of the tuber formation concentration trait data of 337 cassava samples in Example 1 of the present invention;

[0032] Figure 2 is the genotyping detection result of the tuber formation concentration of 256 cassava samples in Example 5 of the present invention; among them, REF represents cassava carrying the SV molecular marker, n = 53 represents the sample size of 53; DEL represents cassava lacking the SV molecular marker, n = 203 represents the sample size of 203. DETAILED DESCRIPTION OF THE INVENTION

[0033] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Many specific details are set forth in the following description in order to fully understand the present invention, but the present invention can also be implemented in other ways different from those described herein. Those skilled in the art can make similar generalizations without departing from the connotation of the present invention, so the present invention is not limited by the specific embodiments disclosed below. The present invention will be further described in detail below with reference to specific embodiments for the understanding of those skilled in the art.

[0034] Example 1 Obtaining an SV Molecular Marker Related to the Tuber Formation Concentration of Cassava

[0035] Collect the genome re-sequencing data of 337 cassava samples planted in Danzhou City, Hainan Province, China (109.5° east longitude, 19.5° north latitude), align the quality-controlled sequencing data to the cassava reference gene to obtain the cassava whole-genome SV molecular marker map, and perform genome-wide association analysis in combination with the cassava phenotype data. The results are as Figure 1 shown. It can be seen that there is an SV molecular marker on the cassava genome that is significantly associated with the tuber formation concentration trait of cassava ( Figure 1 indicated by the arrow in).

[0036] The SV molecular marker related to the tuber formation concentration of cassava is a large fragment deletion occurring at positions 30202368 - 30202617 on chromosome 17 (Chr17) of the cassava genome. The length of the sequence deletion is 250 bp, named Chr17_30202368_30202617, and the sequence is as shown in SEQ ID NO: 1.

[0037] Using this SV molecular marker to detect cassava breeding materials, the proportion of cassava populations with a dispersed tuber formation concentration trait in the cassava population carrying the SV molecular marker is less than that in the cassava population lacking this SV molecular marker (i.e., the large fragment deletion occurring at positions 30202368 - 30202617 on chromosome 17). That is to say, the tuber formation concentration trait of cassava carrying the SV molecular marker shows concentration; the tuber formation concentration of cassava lacking this SV molecular marker shows dispersion.

[0038] Therefore, using this SV molecular marker can accurately and efficiently predict the tuber formation concentration of cassava without waiting for the cassava to grow into adult plants by planting, greatly improving the selection efficiency of cassava breeding, and can efficiently assist in the breeding selection of cassava, with extremely high economic value.

[0039] Example 2 Primer set and kit for identifying the tuber formation concentration of cassava

[0040] Based on the characteristics of the SV molecular marker related to the tuber formation concentration of cassava in Example 1 on the cassava genome, a set of primers was designed upstream and downstream of this SV molecular marker. That is, the upstream primer was designed according to the sequence upstream of nucleotide 30202368 on chromosome 17 of the cassava genome, and the downstream primer was designed according to the sequence downstream of nucleotide 30202617 on chromosome 17 of the cassava genome.

[0041] The sequence of the upstream primer is 5'-AACAAGAAACAAACTGTGCAT-3';

[0042] The sequence of the downstream primer is 5'-CTGCCACTTGGCTCATCT-3';

[0043] Among them, the sequence upstream of nucleotide 30202368 on chromosome 17 of the cassava genome on which the upstream primer is based is:

[0044] 5'-TTAACAAGAAACAAACTGTGCATATTGTTTTATATTTAGGAAATATGTTTTCATGTTTTTATGTACATATATAATTATATATACACGTTTTAAATTTTCATATTTTTTTATAATATTATAGATAATTTATATAAGAAATATTTAATATAA-3';

[0045] The sequence downstream of the 30,202,617th nucleotide on chromosome 17 of the cassava genome on which the downstream primer is based is:

[0046] 5'-TTAATAAAAATACTCTTTTTTTTTTCTAACAGAATAAATTGTTTTTTATTGCAAGATGGAGCGAATTGCAGCTTTTTTGCCGCATTTTCAAATATTATATTATAAAATTACCTAATTGTTTGGAATAAGATGAGCCAAGTGGCAGTTATG-3'.

[0047] When designing primers, in order to enhance the applicability and sensitivity of the primers, the designed primers have a length between 18 and 25 bp, and the primers do not interfere with each other. The above two primers can be obtained by artificial synthesis.

[0048] This example also provides a kit for identifying the tuberization concentration of cassava. The kit includes the above primer set.

[0049] The kit also includes conventional reagents for PCR amplification, such as 2× Rapid Taq Master Mix and ddH 2 O.

[0050] The primer set designed by the present invention has strong specificity and can accurately amplify the sequence carrying / deleting the SV molecular marker of the present invention.

[0051] Using the primer set or kit of the present invention, the tuberization concentration of cassava can be accurately and efficiently predicted without waiting for the cassava to grow into a mature plant by planting.

[0052] Example 3 Method for Identifying the Tuberization Concentration of Cassava

[0053] This example provides a method for identifying the tuberization concentration of cassava. The specific method includes the following steps:

[0054] S1. Extract the DNA of the cassava to be tested as a DNA template;

[0055] S2. Use the primer set in Example 2 to perform PCR amplification on the DNA template of the cassava to be tested;

[0056] The reaction system for PCR amplification is as follows: 12.5 μL of 2× Rapid Taq Master Mix, 1 μL of the upstream primer with a concentration of 10 μM, 1 μL of the downstream primer with a concentration of 10 μM, 1 μL of DNA template, and 9.5 μL of ddH 2 O. Among them, Mix (amplification buffer) was purchased from Novoprotein Scientific Inc., and the primer set was synthesized by Beijing Aoke Dingsheng Biotechnology Co., Ltd.

[0057] The reaction program for PCR amplification is: 5 min at 95°C; 30 s at 95°C, 30 s at 60°C, 30 s at 72°C, for 35 cycles; 5 min at 72°C.

[0058] S3. Sequence the obtained PCR amplification product to determine whether it carries the SV molecular marker fragment.

[0059] When the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 2, with a length of 543 bp, the bases at positions 149 - 398 from the 5' end (i.e., the front end of the sequence) are the SV molecular marker fragment. At this time, the test product carries this SV molecular marker, and the tuber setting concentration trait of the tested cassava shows concentration.

[0060] Otherwise, the tested cassava lacks this SV molecular marker, that is, a large - fragment deletion occurred at positions 30202368 - 30202617 on chromosome 17 of the sample genome, and the length of the PCR amplification product is 293 bp. Then, the tuber setting concentration of the tested cassava shows dispersion.

[0061] Alternatively, electrophoretically detect the PCR amplification product and interpret the electrophoresis detection result;

[0062] When only a 543 - bp band appears in the electrophoresis detection result, the tested cassava carries this SV molecular marker, and the tuber setting concentration trait of the tested cassava shows concentration;

[0063] When only a 293 - bp band appears in the electrophoresis detection result, the tested cassava lacks this SV molecular marker, and the tuber setting concentration of the tested cassava shows dispersion.

[0064] Among them, the tuber setting concentration trait showing concentration means that the tubers are mainly concentrated in a certain area of the plant, usually showing a large number of tubers and dense distribution.

[0065] The tuber setting concentration showing dispersion means that the tubers are distributed relatively dispersedly on the plant, with fewer tubers and sparse distribution.

[0066] Example 4 Detection and Verification of SV Molecular Marker in Cassava

[0067] To verify the practicability of the SV molecular marker, in the cassava planting area of Danzhou City, Hainan Province, China (109.5° east longitude, 19.5° north latitude), several cassava plants (excluding the 337 cassava plants used for the development of the SV molecular marker) were randomly selected. Using the method in Example 3, PCR amplification was carried out to determine whether they carried the SV molecular marker, and the tuber formation concentration of these cassava samples was investigated. The results are shown in Tables 1 to 2 below.

[0068] Table 1 Whether 20 cassava plants carry the SV molecular marker and the tuber formation concentration (cm)

[0069]

[0070] Table 2 Statistical table of the proportion (%) of 20 cassava plants that carry the SV molecular marker and have a concentrated tuber formation concentration

[0071]

[0072] As can be seen from Tables 1 to 2, the method of the present invention can identify whether cassava carries the SV molecular marker, so as to predict the tuber formation concentration of cassava; the tuber formation concentration trait of cassava carrying the SV molecular marker shows concentration; the tuber formation concentration of cassava lacking the SV molecular marker shows dispersion.

[0073] Since the traits of cassava are not only regulated by cassava-related genes, but also affected by other factors such as the environment. For example, environmental conditions such as soil fertility, water supply, and temperature will all affect the tuber formation concentration. Therefore, there will be a small number of individual cassava plants carrying the SV molecular marker whose tuber formation concentration shows a dispersed phenotype. However, based on the fact that in the cassava population carrying the SV fragment, the tuber formation concentration has a tendency to be concentrated, that is, a relatively high proportion of cassava plants in this population show concentrated tuber formation. Therefore, it can be shown that the method of the present invention can be used to identify the concentration or dispersion of the tuber formation concentration of cassava.

[0074] Example 5 Detection of SV molecular marker in cassava

[0075] Furthermore, using the method in Example 3, 256 cassava samples were genotyped, and the results are as Figure 2As shown, among them, 53 samples carry the SV molecular marker, and 203 samples lack the SV molecular marker. In the cassava sample population carrying this SV molecular marker, the proportion of the tuber formation concentration showing dispersion is 33.96%, and the proportion showing concentration is 66.04%; in the cassava sample population lacking this SV molecular marker, the proportion of the tuber formation concentration showing dispersion is 68.47%, and the proportion showing concentration is 31.53%; that is, the proportion of the tuber formation concentration trait showing dispersion in the cassava population carrying this SV molecular marker is less than that in the cassava population lacking this SV molecular marker, and there is a significant difference.

[0076] Other parts not described in detail are all prior arts. Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. Those of ordinary skill in the art can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An SV molecular marker related to cassava tuber concentration, characterized in that: The sequence of the SV molecular marker is shown in SEQ ID NO: 1; The tuber concentration trait of cassava carrying SV molecular markers is concentrated.

2. Use of a reagent for detecting the SV molecular marker associated with cassava tuber concentration according to claim 1, characterized in that: The application is to detect whether cassava carries SV molecular markers through the reagent to predict the tuber concentration of cassava.

3. A primer set for detecting the SV molecular marker associated with cassava tuber concentration according to claim 1, characterized in that: The primer set comprises: The sequence of the upstream primer was 5′-AACAAGAAACAAACTGTGCAT-3′; The sequence of the downstream primer was 5'-CTGCCACTTGGCTCATCT-3'. A kit comprising the primer set according to claim 3.

5. The kit according to claim 4, characterized in that The kit includes reagents for PCR amplification.

6. The kit according to claim 5, characterized in that The kit includes: 2× Rapid TaqMaster Mix and ddH2O.

7. A method for identifying cassava tuber concentration, characterized in that: The method comprises using the primer set of claim 3 to perform PCR amplification on the DNA of the cassava to be tested, sequencing the PCR amplification product, and determining whether the SV molecular marker is carried to predict the tuber concentration of the cassava; Alternatively, the DNA of the cassava to be tested is amplified by PCR using the kit according to any one of claims 4 to 6, and the PCR amplification product is sequenced to determine whether it carries the SV molecular marker, so as to predict the tuber concentration of the cassava; When the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 2, and the length is 543 bp, the product to be tested carries the SV molecular marker, and the cassava tuber concentration trait to be tested is concentrated; Otherwise, the cassava to be tested lacks the SV molecular marker, the length of the PCR amplification product is 293 bp, and the tuber concentration of the cassava to be tested is dispersed.

8. The method for identifying cassava seeding concentration according to claim 7, characterized in that: The PCR amplification system includes: 2× Rapid Taq Master Mix, the upstream primer, the downstream primer, the DNA template of cassava to be tested and ddH2O; The reaction program of PCR amplification was: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, 35 cycles; 72°C for 5 min.

9. A method for identifying cassava tuber concentration, characterized in that: The method comprises using the primer set of claim 3 to perform PCR amplification on the DNA of the cassava to be tested, performing electrophoresis detection on the PCR amplification product, and interpreting the electrophoresis detection result to determine whether the SV molecular marker is carried, so as to predict the tuber concentration of the cassava; Alternatively, the DNA of the cassava to be tested is amplified by PCR using the kit described in any one of claims 4 to 6, the PCR amplification product is detected by electrophoresis, and the electrophoresis detection result is interpreted to determine whether the SV molecular marker is carried, so as to predict the tuber concentration of the cassava; When only a 543 bp band appears in the electrophoresis detection result, the cassava to be tested carries the SV molecular marker, and the tuber concentration trait of the cassava to be tested is concentrated; When only a 293 bp band appears in the electrophoresis detection result, the cassava to be tested lacks the SV molecular marker, and the tuber concentration of the cassava to be tested is dispersed.

10. The method for identifying cassava tuber concentration according to claim 9, characterized in that: The PCR amplification system includes: 2× Rapid Taq Master Mix, the upstream primer, the downstream primer, the DNA template of cassava to be tested and ddH2O; The reaction program of PCR amplification was: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, 35 cycles; 72°C for 5 min.

Images