Preparation method and application of lymphoma autologous tumor vaccine with high expression of TRIM-21

Abstract

The invention provides a preparation method of a lymphoma autologous tumor vaccine with high expression of TRIM-21, which comprises the following steps: amplifying a TRIM-21 gene from EL-4 cells through a PCR (Polymerase Chain Reaction) method, cloning the TRIM-21 gene into a lentiviral vector to construct a recombinant lentivirus, infecting the EL-4 cells with the recombinant lentivirus to obtain a lymphoma cell line with high expression of TRIM-21, and carrying out irradiation inactivation to obtain the lymphoma autologous tumor vaccine with high expression of TRIM-21. The lymphoma autologous tumor vaccine is obtained. The lymphoma cell line with high expression of TRIM-21 is prepared for the first time, and the lymphoma autologous tumor vaccine is prepared from the lymphoma cell line. A mouse tumor model verifies that the vaccine efficiently activates CD8 + T cell immune response and has an obvious tumor immunoprophylaxis effect, so that the vaccine can be applied to the field of preparation of tumor immunoprophylaxis drugs.

Description

Technical Field

[0001] The present invention relates to the technical field of vaccines, and in particular to the preparation and application of an autologous lymphoma tumor vaccine with high expression of TRIM-21. Background Art

[0002] Lymphoma is a malignant tumor originating from lymphoid tissue. Its etiology and pathogenesis are not yet fully understood. It is generally believed to be related to infection, immunity, physical and chemical factors, and genetic factors. The number of new cases of lymphoma is increasing worldwide. Data show that there were more than 500,000 new cases of lymphoma worldwide in 2018. TRIM-21 is an E3 ubiquitin ligase that can specifically degrade proteins and participate in tumor occurrence, development, and drug resistance. T cells are the main force of anti-tumor immune response, and E3 ubiquitin ligases play an important role in the development and response of T cells. Studies have found that TRIM-21 can exert its effect of promoting lymphoma apoptosis by negatively regulating the anti-apoptotic protein Bcl-2. Therefore, TRIM-21 is likely to play an important role in the fight against lymphoma; lymphoma cells with high expression of TRIM-21 may be more likely to stimulate anti-tumor immune response and have the potential to become autologous lymphoma vaccines. Summary of the invention

[0003] Technical problem to be solved: The purpose of the present invention is to provide a method for preparing an autologous lymphoma tumor vaccine that highly expresses TRIM-21. The tumor vaccine prepared in this way can stimulate a high level of immune cell response in the body and can be used to prepare tumor immunoprevention drugs.

[0004] Technical solution: A method for preparing an autologous lymphoma tumor vaccine that highly expresses TRIM-21, comprising the following steps: S1. Construction of a Venus vector carrying the TRIM-21 gene: A pair of specific primers with BamH1 and Xho1 restriction sites were designed, and the target fragment was amplified by PCR. The TRIM-21 gene was amplified using EL-4 cell cDNA as a template, and BamH1 and Xho1 were used for restriction digestion, and then the product was recovered; the recovered product was connected with the Venus vector fragment double-digested by amH1 and Xho1, and the ligation product was transformed into DH10B competent cells. After a single bacterium was selected for expansion culture, restriction digestion identification was performed to obtain the positive plasmid Venus-TRIM-21; S2. Packaging and acquisition of lentivirus: The positive plasmid Venus-TRIM-21 obtained in step S1 was co-transfected with auxiliary plasmids ΔR, REV and VSVG into 293T cells to obtain recombinant lentivirus; S4. Construction of lymphoma cell line with high expression of TRIM-21 gene: The obtained recombinant lentivirus is used to infect lymphoma cells EL-4, and then EL-4 cells overexpressing TRIM-21 are screened out, and EL-4 cells overexpressing TRIM-21 are identified by quantitative PCR, hereinafter referred to as EL-4-TRIM-21 cells; S5. Preparation of autologous lymphoma vaccine with high expression of TRIM-21: EL-4-TRIM-21 cells with a culture density of 75%-85% were collected, the cells were suspended in phosphate buffer, irradiated, and the supernatant was removed by centrifugation. The cell pellet collected by centrifugation was resuspended in phosphate buffer to 10 5 -10 6 / mL, and then centrifugally collect the cell precipitate to obtain the lymphoma autologous tumor vaccine with high expression of TRIM-21; The pair of specific primers with BamH1 and Xho1 restriction sites in step S1 are: Primer 1Seq NO.1: ggatccatgcaagtgccaaa; Primer 2Seq NO.2: ctcgagttaacttccatcttc. Preferably, in step S1, the conditions for amplifying the TRIM-21 gene using EL-4 cell cDNA as a template are: Pre-denaturation at 94°C for 3 min; Denaturation at 94°C for 20 s, annealing at 61°C for 45 s, and extension at 72°C for 90 s, 2 cycles; Denaturation at 94°C for 20 s, annealing at 59°C for 45 s, and extension at 72°C for 90 s, for 4 cycles; Denaturation at 94°C for 20 s, annealing at 57°C for 45 s, and extension at 72°C for 90 s, for 4 cycles; Denaturation at 94°C for 20 s, annealing at 55°C for 45 s, and extension at 72°C for 90 s, for 4 cycles; Denaturation at 94°C for 20 s, annealing at 53°C for 45 s, and extension at 72°C for 90 s, for 25 cycles; Extension at 72°C for 5 min; Cool at 10℃ for 30min. Preferably, in step S2, the mixing ratio of the positive plasmid Venus-TRIM-21, the auxiliary plasmid ΔR, the auxiliary plasmid REV and the auxiliary plasmid VSVG is 11.5:7.5:3:2.5 by mass. Preferably, the irradiation treatment in step S3 adopts γ-ray irradiation, and the irradiation dose is 30-45Gy. The lymphoma autologous tumor vaccine prepared by the preparation method of the lymphoma autologous tumor vaccine with high expression of TRIM-21 is used in the preparation of tumor prevention and treatment drugs. Beneficial effects: The lymphoma autologous tumor vaccine with high expression of TRIM-21 of the present invention has the following advantages: 1. The TRIM-21 gene was amplified from EL-4 cells by PCR, cloned into a lentiviral vector to construct a recombinant lentivirus, and the recombinant lentivirus was used to infect EL-4 cells to obtain a lymphoma cell line that highly expressed TRIM-21. After irradiation inactivation, an autologous lymphoma tumor vaccine was obtained. The vaccine has been shown to have tumor immune prevention effects in vivo; 2. The EL-4 cells (vaccine) with high expression of TRIM-21 constructed by the present invention significantly increase the expression level of TRIM-21; after the EL-4-TRIM-21 cells treated with radiation were inoculated into mice, the expression of CD8 + T cell response; EL-4-TRIM-21 cells treated with radiation have a significant inhibitory effect on the growth of EL-4 cells and activate CD8 + T cell response; suggesting that EL-4-TRIM-21 cells can be used as autologous tumor vaccine for the prevention of lymphoma. The present invention is the first to construct a lymphoma stable cell line that highly expresses TRIM-21, and conducts relevant research on its activated T cell response and lymphoma prevention effect, thus providing direct evidence for its application in the prevention of lymphoma; 3. The present invention is the first to prepare a lymphoma cell line that highly expresses TRIM-21, and to prepare an autologous lymphoma tumor vaccine based on it. The mouse tumor model was used to verify that the vaccine efficiently activated CD8 + T cell immune response has obvious tumor immune prevention effect, so it can be used in the preparation of tumor immune prevention drugs, especially lymphoma; BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 The construction of lymphoma cells highly expressing TRIM-21 in Example 2; Figure 2 is a graph showing the relationship between tumor volume and time in Example 3; Figure 3 The autologous tumor vaccine in Example 4 is used to treat CD8 + Effect diagram of T cell ratio; Figure 4 The autologous tumor vaccine in Example 4 is used to treat CD8 + Diagram of the promotion of IFN-γ secretion by T cells; In the above figures, * indicates significant difference: *p<0.05, **p<0.001, ***p<0.0001. DETAILED DESCRIPTION The present invention is further described below in conjunction with embodiments and drawings. The following embodiments are explanations of the present invention and the present invention is not limited to the following embodiments: Example 1 A method for preparing an autologous lymphoma tumor vaccine that highly expresses TRIM-21 comprises the following steps: S1. Construction of Venus vector carrying TRIM-21 gene: A pair of specific primers with BamH1 and Xho1 restriction sites were designed, and the specific primer sequences were as follows: Primer 1 Seq NO.1: ggatccatgcaagtgccaaa; Primer 2 Seq NO.2: ctcgagttaacttccatcttc; The target fragment was amplified by PCR, and the TRIM-21 gene was amplified using EL-4 cell cDNA as a template, and BamH1 and Xho1 were used for restriction digestion, and then the product was recovered; The recovered product was connected with the Venus vector fragment double-digested by amH1 and Xho1, and the connection product was transformed into DH10B competent cells, and a single bacterium was picked for expansion culture and restriction digestion identification was performed to obtain the positive plasmid Venus-TRIM-21, wherein the conditions for amplifying the TRIM-21 gene using EL-4 cell cDNA as a template are: Pre-denaturation at 94°C for 3 min; Denaturation at 94°C for 20 s, annealing at 61°C for 45 s, and extension at 72°C for 90 s, 2 cycles; Denaturation at 94°C for 20 s, annealing at 59°C for 45 s, and extension at 72°C for 90 s, for 4 cycles; Denaturation at 94°C for 20 s, annealing at 57°C for 45 s, and extension at 72°C for 90 s, for 4 cycles; Denaturation at 94°C for 20 s, annealing at 55°C for 45 s, and extension at 72°C for 90 s, for 4 cycles; Denaturation at 94°C for 20 s, annealing at 53°C for 45 s, and extension at 72°C for 90 s, for 25 cycles; Extension at 72°C for 5 min; Cool at 10℃ for 30min. S2. Lentivirus packaging and acquisition: The positive plasmid Venus-TRIM-21 obtained in step S1 was co-transfected with auxiliary plasmids ΔR, REV and VSVG into 293T cells by CaCl2 transfection method. The transfection system was a 1000ul mixed system, including 7.5ug ΔR, 3ug REV, 2.5ug VSVG, 11.5ug Venus-TRIM-21, 500ul 2×HBSS, and the balance was ultrapure water. The positive plasmid Venus-TRIM-21 and auxiliary plasmids ΔR, REV and VSVG were allowed to stand for 10 minutes and added to 293T cells, mixed, and cultured for 6 hours before replacing the culture medium and continuing to culture for 48 hours. The cell state was observed under blue light conditions using a fluorescence microscope. When green fluorescence was observed, the culture medium was collected and filtered with a 0.45um filter to obtain the recombinant lentivirus. S3. Construction of lymphoma cell line with high expression of TRIM-21 gene: 150,000 lymphoma EL-4 cells were added to a 6-well plate, 2 ml of DMEM culture medium and 1 ml of recombinant lentivirus solution were added, centrifuged at 1800 rpm for 1 hour at room temperature, and infected for 14 hours to obtain recombinant lentivirus-infected lymphoma cells EL-4, and the cell state was observed using a fluorescence microscope. EL-4 cells overexpressing TRIM-21 were screened out using a flow sorting instrument with green fluorescent protein as a marker, and the purity was detected using flow cytometry, RNA of EL-4 cells overexpressing TRIM-21 was extracted, and EL-4 cells with high expression of TRIM-21 were identified by quantitative PCR, hereinafter referred to as EL-4-TRIM-21 cells; S4. Preparation of autologous lymphoma vaccine with high expression of TRIM-21: EL-4-TRIM-21 cells with a culture density of 75%-85% are collected, the cells are suspended in phosphate buffer, and then irradiated with gamma rays at a dose of 40 Gy. The supernatant is removed by centrifugation, and the cell precipitate collected by centrifugation is resuspended in phosphate buffer to 106 cells / mL, and then the cell precipitate is collected by centrifugation to obtain the lymphoma autologous tumor vaccine with high expression of TRIM-21. Example 2 A method for preparing an autologous lymphoma tumor vaccine that highly expresses TRIM-21 comprises the following steps: S1. Construction of Venus vector carrying TRIM-21 gene: A pair of specific primers with BamH1 and Xho1 restriction sites were designed, and the specific primer sequences were as follows: Primer 1 Seq NO.1: ggatccatgcaagtgccaaa; Primer 2 Seq NO.2: ctcgagttaacttccatcttc; The target fragment was amplified by PCR, and the TRIM-21 gene was amplified using EL-4 cell cDNA as a template, and BamH1 and Xho1 were used for restriction digestion, and then the product was recovered; The recovered product was connected with the Venus vector fragment double-digested by amH1 and Xho1, and the connection product was transformed into DH10B competent cells, and a single bacterium was picked for expansion culture and restriction digestion identification was performed to obtain the positive plasmid Venus-TRIM-21, wherein the conditions for amplifying the TRIM-21 gene using EL-4 cell cDNA as a template are: Pre-denaturation at 94°C for 3 min; Denaturation at 94°C for 20 s, annealing at 61°C for 45 s, and extension at 72°C for 90 s, 2 cycles; Denaturation at 94°C for 20 s, annealing at 59°C for 45 s, and extension at 72°C for 90 s, for 4 cycles; Denaturation at 94°C for 20 s, annealing at 57°C for 45 s, and extension at 72°C for 90 s, for 4 cycles; Denaturation at 94°C for 20 s, annealing at 55°C for 45 s, and extension at 72°C for 90 s, for 4 cycles; Denaturation at 94°C for 20 s, annealing at 53°C for 45 s, and extension at 72°C for 90 s, for 25 cycles; Extension at 72°C for 5 min; Cool at 10℃ for 30min. S2. Lentivirus packaging and acquisition: The positive plasmid Venus-TRIM-21 obtained in step S1 was co-transfected with auxiliary plasmids ΔR, REV and VSVG into 293T cells by CaCl2 transfection method. The transfection system was a 1000ul mixed system, including 7.5ug ΔR, 3ug REV, 2.5ug VSVG, 11.5ug Venus-TRIM-21, 500ul 2×HBSS, and the balance was ultrapure water. The positive plasmid Venus-TRIM-21 and auxiliary plasmids ΔR, REV and VSVG were allowed to stand for 10 minutes and added to 293T cells, mixed, and cultured for 6 hours before replacing the culture medium and continuing to culture for 48 hours. The cell state was observed under blue light conditions using a fluorescence microscope. When green fluorescence was observed, the culture medium was collected and filtered with a 0.45um filter to obtain the recombinant lentivirus. S3. Construction of lymphoma cell line with high expression of TRIM-21 gene: 200,000 lymphoma EL-4 cells were added to a 6-well plate, 2 ml of DMEM culture medium and 1 ml of recombinant lentivirus solution were added, centrifuged at 1800 rpm for 1 hour at room temperature, and infected for 12 hours to obtain recombinant lentivirus-infected lymphoma cells EL-4, and the cell state was observed using a fluorescence microscope. EL-4 cells overexpressing TRIM-21 were screened out using a flow sorting instrument with green fluorescent protein as a marker, and the purity was detected using flow cytometry, RNA of EL-4 cells overexpressing TRIM-21 was extracted, and EL-4 cells with high expression of TRIM-21 were identified by quantitative PCR, hereinafter referred to as EL-4-TRIM-21 cells; S4. Preparation of autologous lymphoma vaccine with high expression of TRIM-21: EL-4-TRIM-21 cells with a culture density of 75%-85% are collected, the cells are suspended in phosphate buffer, and then irradiated with gamma rays at a dose of 40 Gy. The supernatant is removed by centrifugation, and the cell precipitate collected by centrifugation is resuspended in phosphate buffer to 106 cells / mL, and then the cell precipitate is collected by centrifugation to obtain the lymphoma autologous tumor vaccine with high expression of TRIM-21. Comparative Example 1 Venus was used to replace the positive plasmid Venus-TRIM-21 in Example 2 as a control, and other process conditions were the same as in Example 2, and the comparative cell (vaccine) obtained was EL-4-V cell. Comparative Example 2 Lymphoma cells not infected with the virus were used as a control, and the comparative cells (vaccine) obtained were EL-4 cells. Figure 1 The results in A show that both Venus and Venus-TRIM-21 viruses can efficiently infect EL-4 cells to obtain EL-4-Venus and EL-4-TRIM-21 cell lines. Figure 1 The results of quantitative PCR in B show that the expression level of the TRIM-21 gene in EL-4-TRIM-21 cells is 10,000 times that of the control cells EL-4 and EL-4-Venus. These results show that the lymphoma cell line EL-4-TRIM-21 with high expression of TRIM-21 is obtained by the construction method of the present invention. Animal Experimentation: Experiment 1: Evaluation of the effect of vaccines on tumor prevention: Experimental grouping: The experiment was divided into three groups, namely EL-4 cells irradiated with gamma rays (Comparative Example 2), EL-4-Venus cells (Comparative Example 1) and EL-4-TRIM-21 cells (Example 2). C57BL / 6 mice were treated with 1×10 6Two weeks after the last immunization, mice were subcutaneously inoculated with 5×10 4 EL-4 cells were used to observe the tumor growth. Figure 2 Figure 2 is the relationship between tumor volume and time. It can be seen that the tumor growth rate in the EL-4-TRIM-21 group was significantly lower than that in the other groups, and the difference was significant. This result shows that the lymphoma autologous tumor vaccine with high expression of TRIM-21 disclosed in the present invention has a good tumor immune prevention effect. Experiment 2: Effect of vaccine on T cell response: The mice in Experiment 1 were killed 17 days after tumor inoculation, and spleen cells were collected. CD8 + The proportion of T cells. Figure 3 The above autologous tumor vaccine is used to treat CD8 + The effect of T cell ratio on the IFN-γ positive CD8 T cells in the spleen of mice inoculated with autologous lymphoma vaccine with high expression of TRIM-21 + The T cells were significantly higher than those in other groups. Figure 4 The above autologous tumor vaccine is used to treat CD8 + The promotion of IFN-γ secretion by T cells shows that the results of intracellular staining show that IFN-γ positive CD8 + The above results show that the autologous lymphoma vaccine with high expression of TRIM-21 disclosed in the present invention can induce high levels of CD8 + T cell anti-tumor immune response and significant protection against lymphoma. The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for preparing an autologous lymphoma tumor vaccine that highly expresses TRIM-21, characterized in that: The preparation method comprises the following steps: S1. Construction of Venus vector carrying TRIM-21 gene: A pair of specific primers with BamH1 and Xho1 restriction sites were designed, and the target fragment was amplified by PCR. The TRIM-21 gene was amplified using EL-4 cell cDNA as a template, and BamH1 and Xho1 were used for restriction digestion, and then the product was recovered; the recovered product was connected with the Venus vector fragment double-digested with BamH1 and Xho1, and the ligation product was transformed into TOP-10 competent cells, and a single bacterium was picked for expansion culture and restriction digestion identification was performed to obtain the positive plasmid Venus-TRIM-21; S2. Lentivirus packaging and acquisition: The positive plasmid Venus-TRIM-21 obtained in step S1 was co-transfected with auxiliary plasmids ΔR, REV and VSVG into 293T cells to obtain recombinant lentivirus; S4. Construction of lymphoma cell line with high expression of TRIM-21 gene: The obtained recombinant lentivirus is used to infect lymphoma cells EL-4, and then EL-4 cells overexpressing TRIM-21 are screened out, and EL-4 cells overexpressing TRIM-21 are identified by quantitative PCR, hereinafter referred to as EL-4-TRIM-21 cells; S4. Preparation of autologous lymphoma vaccine with high expression of TRIM-21: EL-4-TRIM-21 cells with a culture density of 70%-80% were collected, the cells were suspended in phosphate buffer, irradiated, and the supernatant was removed by centrifugation. The cell pellet collected by centrifugation was resuspended in phosphate buffer to 10 5 -10 6 / mL, and then centrifugally collect the cell precipitate to obtain the lymphoma autologous tumor vaccine with high expression of TRIM-21; The pair of specific primers with BamH1 and Xho1 restriction sites in step S1 are: Primer 1Seq NO.1: ggatccatgcaagtgccaaa; Primer 2Seq NO.2: ctcgagttaacttccatcttc.

2. The method for preparing an autologous lymphoma tumor vaccine that highly expresses TRIM-21 according to claim 1, characterized in that: In step S1, the conditions for amplifying the TRIM-21 gene using EL-4 cell cDNA as a template are: Pre-denaturation at 94°C for 3 min; Denaturation at 94°C for 20 s, annealing at 61°C for 45 s, and extension at 72°C for 90 s, 2 cycles; Denaturation at 94°C for 20 s, annealing at 59°C for 45 s, and extension at 72°C for 90 s, for 4 cycles; Denaturation at 94°C for 20 s, annealing at 57°C for 45 s, and extension at 72°C for 90 s, for 4 cycles; Denaturation at 94°C for 20 s, annealing at 55°C for 45 s, and extension at 72°C for 90 s, for 4 cycles; Denaturation at 94°C for 20 s, annealing at 53°C for 45 s, and extension at 72°C for 90 s, for 25 cycles; Extension at 72°C for 5 min; Cool at 10℃ for 30min.

3. The method for preparing an autologous lymphoma tumor vaccine that highly expresses TRIM-21 according to claim 1, characterized in that: In the step S2, the positive plasmid Venus-TRIM-21, the auxiliary plasmid ΔR, the auxiliary plasmid REV and the auxiliary plasmid VSVG are mixed in a mass ratio of 11:7:3:

2.

4. The method for preparing an autologous lymphoma tumor vaccine that highly expresses TRIM-21 according to claim 1, characterized in that: In step S3, the irradiation treatment adopts gamma ray irradiation, and the irradiation dose is 30-45Gy.

5. The lymphoma autologous tumor vaccine prepared by the method for preparing the lymphoma autologous tumor vaccine with high expression of TRIM-21 as claimed in claim 1.

6. Use of the lymphoma autologous tumor vaccine according to claim 5 in the preparation of tumor prevention and treatment drugs.

Images