Camellia sinensis tlp30 gene and application thereof in enhancing resistance to anthracnose

Abstract

The application discloses a tea tree CsTLP30 gene and application thereof in enhancing resistance of the tea tree to anthracnose, and belongs to the technical field of genetic engineering. The tea tree CsTLP30 gene has a CDS region whose nucleotide sequence is shown as SEQ ID NO. 1, and the encoded protein has an amino acid sequence shown as SEQ ID NO. 2. The tea tree CsTLP30 gene has different expression amounts at different time points of anthracnose infection of the tea tree, can respond to pathogen infection at different time points, and can verify the biological function of the tea tree CsTLP30 gene in mediating resistance of the tea tree to anthracnose, thereby providing a key gene resource for disease resistance breeding of the tea tree.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a tea plant CsTLP30 gene and an application thereof in enhancing the anthracnose resistance of tea plants. Background Art

[0002] Tea is a major cash crop in my country. Rich in nutrients such as flavonoids, theanine, and purine alkaloids, tea leaves are one of the world's most popular non-alcoholic beverages, providing numerous health benefits. However, with economic development and changes in tea plantation management practices, tea plantations are facing a significant threat from diseases. Tea anthracnose is a major foliar fungal disease that primarily affects mature and older leaves, causing significant economic losses to tea production.

[0003] At present, research on tea anthracnose mainly focuses on differential expression analysis based on transcriptomics and proteomics. However, in the tea genome, many genes involved in defense have yet to be discovered, and their biological functions in mediating tea disease resistance are still unclear.

[0004] Chinese patent application publication number CN118440954A discloses a tea plant CsLAC23 gene and its use in anthracnose resistance. The patent also proposes the use of the CsLAC23 gene in regulating anthracnose infection in tea plants and in breeding new anthracnose-resistant tea varieties. It also proposes an antisense oligonucleotide for inhibiting CsLAC23 gene expression. After inhibiting CsLAC23 gene expression and infecting with anthracnose, tissue staining and reactive oxygen species (ROS) content were measured. The results showed that the DAB and NBT staining effects of tea leaves after CsLAC223 gene inhibition were more pronounced than those in the control group, and the activities of POD and SOD, key enzymes in the ROS scavenging system, were lower than those in the control group. This indicates that inhibiting CsLAC23 gene expression makes tea plants more susceptible to infection by the pathogen and anthracnose, indicating that CsLAC23 mediates the regulation of tea plant resistance to anthracnose. However, there are no reports on whether other tea tree genes also have the effect of resisting anthrax infection. Summary of the Invention

[0005] The technical problem to be solved by the present invention is how to propose a new tea tree gene that can resist anthrax fungus and apply it to resist anthrax fungus infection.

[0006] The present invention solves the above technical problems through the following technical means:

[0007] The first aspect of the present invention provides a tea plant CsTLP30 gene, the nucleotide sequence of which CDS region is shown in SEQ ID NO.1.

[0008] The second aspect of the present invention provides a protein encoded by the tea plant CsTLP30 gene, the amino acid sequence of which is shown in SEQ ID NO.2.

[0009] The third aspect of the present invention proposes the use of the above-mentioned tea plant CsTLP30 gene in regulating the sensitivity of tea plants to anthracnose.

[0010] The fourth aspect of the present invention proposes the use of the above-mentioned tea plant CsTLP30 gene in breeding to improve tea plant anthracnose resistance.

[0011] A fifth aspect of the present invention provides an anthracnose-susceptible tea plant model comprising a product that inhibits the expression of the CsTLP30 gene.

[0012] Preferably, the product comprises an antisense oligonucleotide having a sequence as shown in SEQ ID NO.3.

[0013] A sixth aspect of the present invention provides a tobacco model resistant to anthrax, the model comprising a product of overexpressing the tea plant CsTLP30 gene in tobacco.

[0014] In a seventh aspect, the present invention provides a tea plant expression vector pCAMBIA1305-CsTLP30, which is obtained by enzymatically cleaving the fragment shown in SEQ ID NO: 1 into the pCAMBIA1305 vector.

[0015] The eighth aspect of the present invention provides a method for cultivating anthracnose-resistant plant varieties, wherein the tea plant CsTLP30 gene is introduced into the target plant to obtain a transgenic plant with improved anthracnose resistance.

[0016] Preferably, the method specifically includes the following steps:

[0017] (1) Cloning of the CsTLP30 gene from tea plant;

[0018] (2) Construction of tea plant CsTLP30 gene overexpression vector;

[0019] (3) The target plants were transformed with the tea plant CsTLP30 gene overexpression vector, and transgenic plants with improved anthracnose resistance were obtained after identification.

[0020] Preferably, the plants include tea trees and tobacco.

[0021] The beneficial effects of the present invention are:

[0022] 1. The present invention proposes the role of the tea tree CsTLP30 gene in regulating anthracnose infection of tea trees. Its expression level is different at different time points when anthracnose infects tea trees, and it can respond to pathogen infection at different time points, thereby verifying its biological function of mediating tea tree resistance to anthracnose, providing key gene resources for disease-resistant breeding of tea trees.

[0023] 2. The present invention inhibited the expression of the CsTLP30 gene in tea plants and infected them with anthrax fungi, and found that the area of ​​lesions was significantly larger than that of the control group; after NBT and DAB staining, it was found that the staining effect of tea leaves after inhibiting the expression of the CsTLP30 gene was more obvious; the key enzymes POD and SOD for ROS scavenging activity were significantly lower than those in the control group, and the hydrogen peroxide content was significantly increased.

[0024] 3. The present invention transiently overexpressed the CsTLP30 gene in Nicotiana benthamiana and infected it with anthracnose fungi, and found that compared with the control, the area of ​​leaf yellowing and necrosis was significantly reduced; the key enzymes POD and SOD for ROS scavenging activity were significantly higher than those in the control group, and the hydrogen peroxide content was significantly reduced. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a diagram showing the expression pattern of the tea plant CsTLP30 gene at different time points of anthrax infection in Example 1 of the present invention;

[0026] Figure 2 This is a diagram showing the expression pattern of the CsTLP30 gene in different tissues of tea plants in Example 1 of the present invention;

[0027] Figure 3 This is a subcellular localization map of the tea tree CsTLP30 protein in tobacco in Example 1 of the present invention;

[0028] Figure 4 Figures 1 and 2 are histochemical staining, lesion area, and antioxidant enzyme activity of leaves infected with anthrax and antisense inhibition of the CsTLP30 gene in Example 1 of the present invention, wherein a is a phenotypic diagram of leaves under different treatment conditions after pathogen infection, b is a diagram of lesion area of ​​leaves in the treatment group (AsODN) and the control group (H2O and sODN), c is a diagram of H2O2 content in leaves in the treatment group (AsODN) and the control group (H2O and sODN), d is a diagram of POD enzyme activity in leaves in the treatment group (AsODN) and the control group (H2O and sODN), and e is a diagram of SOD enzyme activity in leaves in the treatment group (AsODN) and the control group (H2O and sODN);

[0029] Figure 5 Figure 1 is a graph showing the phenotype, lesion area, and antioxidant enzyme activity of tobacco leaves after transient overexpression of the CsTLP30 gene and infection with anthrax in Example 1 of the present invention, wherein a is a graph showing the location of the tobacco leaves injected with the vector bacterial solution in the treatment group and the control group, b is a graph showing the leaf phenotype under natural light conditions, c is a graph showing the leaf phenotype under fluorescence irradiation, d is a statistical graph showing the lesion area of ​​tobacco leaves injected with the fusion expression vector (treatment group) and the empty vector (control), e is a graph showing the H2O2 content in the tobacco leaves of the treatment group and the control group, f is a graph showing the POD enzyme activity in the tobacco leaves of the treatment group and the control group, and g is a graph showing the SOD enzyme activity in the tobacco leaves of the treatment group and the control group. DETAILED DESCRIPTION

[0030] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0031] Unless otherwise specified, the test materials and reagents used in the following examples can be obtained from commercial sources.

[0032] If no specific techniques or conditions are specified in the examples, they can be carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the quantitative tests in the following examples were repeated three times and the results were averaged.

[0033] Example 1:

[0034] 1. Cloning of the Camellia sinensis CsTLP30 gene

[0035] (1) Quickly transfer the fresh or frozen Shucha tea tree samples at -85℃~-65℃ into a centrifuge tube with steel balls added in advance, and grind them into powder using a ball mill. RNA was extracted using the Universal Plant Total RNA Isolation Kit (Novagen) according to its instructions.

[0036] (2) Reverse transcription to generate the first strand: According to the instructions of the PrimeScript II 1st Strand cDNA Synthesis Kit (Takara Biotech, China), 1 μg of RNA was used as the template, 1 μL of random 6mers, 1 μL of dNTP Mixture, and RNase-Free H2O were added to make up to 10 μL. The mixture was denatured at 65°C for 5 min and immediately placed on ice for 2 min. Then, 4 μL of 5× PrimerScript buffer, 0.5 μL of RNase Inhibitor, 1 μL of PrimerScript RTase, and ddH2O were added to the above reaction solution to make up to 20 μL. The mixture was incubated at 30°C for 10 min, 42°C for 1 h, 95°C for 5 min, and 70°C for 15 min. An appropriate amount of reverse transcription product (i.e., cDNA) was used for subsequent PCR amplification.

[0037] (3) Using the first strand of cDNA as a template, the CsTLP30 gene was amplified by PCR.

[0038] The upstream primer is: 5'-TCCCAATATTGCTCCCAATCCA-3' (SEQ ID NO. 4),

[0039] Downstream primer: 5'-GTGCACATCACTACATGTGCTT-3' (SEQ ID NO. 5).

[0040] A 25 μL reaction system consisted of 12.5 μL of LA Taq premix, 1 μL of upstream and downstream primers, 1 μL of template, and 9.5 μL of ddH2O. The PCR amplification program was as follows: 94°C for 3 min, 94°C for 30 sec, 60°C for 30 sec, 72°C for 45 sec, and 72°C for 10 min, for 30 cycles.

[0041] (4) The PCR product obtained in (3) was recovered using a gel recovery kit and ligated to a pEASY-T1 vector (Promega, Shanghai, China) to obtain a recombinant plasmid (denoted as pEASY-T1::CsTLP30). The recombinant plasmid was transformed into Escherichia coli competent cells Trans1-T1 and sent to Universal Biotechnology for sequencing to obtain the nucleotide sequence of the CsTLP30 gene, as shown in SEQ ID NO.1. The amino acid sequence encoded by the CsTLP30 gene was as shown in SEQ ID NO.2.

[0042] 2. Expression pattern of CsTLP30 gene under anthrax infection

[0043] Two-year-old 'Longjing 43' cuttings with uniform growth and no diseases and insect pests were selected and cultured in the artificial climate chamber of Anhui Agricultural University (temperature 25°C, humidity 70%, 16h light, 8h dark). Use an inoculation needle to carefully inoculate the anthrax mycelium block on the PDA plate and culture it in the dark at 28°C for 7 to 10 days. The whole process was performed aseptically. ddH2O was added to the plate, and the pathogen spores on the plate were scraped with a sterile coating stick, filtered with sterilized gauze, and then transferred to a sterile conical flask. The vortex was vortexed to evenly distribute the fungal spores in the liquid. Counting was performed under an optical microscope using a hemocytometer, and sterile water was added for dilution to prepare 10 7Use a spore suspension containing 100 CFU / mL of spores. Wipe the second leaf of the tea seedling with 75% ethanol, then wipe it again with ddH2O, and let it sit until the moisture on the leaves evaporates. Use a pin to poke plum blossom-shaped holes in the leaves, add 50ul of spore suspension to each side, and use sterile water for the control group. Then, wrap the leaves with plastic wrap, cover the entire tea seedling with a large plastic bag, and culture in an artificial climate chamber, maintaining humidity above 70%. Take samples at 1, 4, 7, 10, and 13 days, immediately freeze them in liquid nitrogen, and store at -80°C until needed.

[0044] The RNA was extracted and reverse transcribed into cDNA. The reverse transcription product was diluted 9 times as a template and quantified using 2×AceQUniversal qPCR. Master Mix (Vazyme, Nanjing, China) was used to prepare a 10 μL reaction system: 5 μL 2×AceQ Universal qPCR Master Mix, 1.2 μL diluted reverse transcription product, 0.3 μL each of upstream and downstream primers, 3.2 μL ddH2O, three biological replicates and three technical replicates were performed for each sample. Quantitative analysis was then performed on a Bio-rad CFX instrument using the following program: 95°C for 3 minutes, 95°C for 10 seconds, 54°C for 30 seconds, 65°C for 5 seconds, and 95°C for 5 seconds, for 39 cycles. qRT-PCR was used to detect changes in CsTLP30 gene expression at different time points of anthrax infection. Figure 1 As shown in the figure, compared with the control group (clean water treatment), the expression level of CsTLP30 gene in the treatment group (anthracnose infection treatment) was significantly increased at 4, 7, 10 and 13 days, among which the expression level of the treatment group increased most significantly at 7 days.

[0045] 3. Expression pattern and subcellular localization of CsTLP30 gene in different tissues of tea plant

[0046] (1) Expression pattern of the CsTLP30 gene in different tissues of tea plants

[0047] Different tissues, including buds, leaves, two leaves, three leaves, mature leaves, stems, flowers, and roots, were collected from the national tea variety 'Shucha Zao'. Samples from all eight organs were used for total RNA extraction and first-strand cDNA synthesis. Quantitative analysis was performed as described above, and the results were as follows. Figure 2 As shown, the CsTLP30 gene was expressed in eight organs, with the highest expression in fruit and stem and the lowest expression in root.

[0048] The upstream primer is: 5'-TCCCAATATTGCTCCCAATC-3' (SEQ ID NO. 6),

[0049] Downstream primer: 5′-GTCAAGTTGTCGACCACCA-3′ (SEQ ID NO. 7).

[0050] (2) Subcellular localization of tea plant CsTLP30 protein

[0051] ①Construct target gene expression vector

[0052] The pCAMBIA1305 vector was double-digested with SpeI and BamHI restriction endonucleases. The reaction was allowed to proceed at 37°C for 30 min, followed by agarose gel electrophoresis and gel recovery to obtain a linearized vector with restriction sites. The target gene plasmid was used as a template and primers containing restriction sites were used to amplify the plasmid to obtain a target gene fragment with restriction sites. The upstream primer was 5'-GACAGCCCAGATCACTAGTATGAACTTCTTTAAATCTCTTTCC-3' (SEQ ID NO. 8), and the downstream primer was 5'-CTTGCTCACCATGGATCCAGGGCAAAACACAACCTT ATA-3' (SEQ ID NO. 9). The product containing the restriction site adapter sequence and the linearized vector were recombined using a recombinase. The reaction mixture consisted of 4 μL of the linearized pCAMBIA1305 vector, 3 μL of the product containing the restriction site adapter sequence, 1 μL of recombinase Eppendorf II, and 2 μL of 5× CE II buffer in a 10 μL PCR tube. The reaction was incubated at 37°C for 40 min. The recombinant product was transformed into competent E. coli Trans1-T1 cells and sent to General Biotech for sequencing to obtain the pCAMBIA1305-CsTLP30 plasmid.

[0053] ② Agrobacterium transformation and tobacco infection

[0054] 1uL of the above recombinant plasmid was added to the EHA105 Agrobacterium competent medium, placed on ice for 5 minutes, incubated at 37°C for 5 minutes, and then placed on ice for 5 minutes. 400uL of liquid LB medium was added, and then shaken at 28°C for 2 hours. Finally, 200uL of bacterial liquid was applied to the solid LB medium containing Kan+ resistance and cultured in the dark at 28°C for 48 hours. Single colonies were picked for PCR verification, and the colonies with the verification band position consistent with the target band position were added to 400uL of liquid LB medium containing Kan+ resistance. + Liquid LB medium with resistance was cultured at 28℃ on a shaker for 8h. 100uL of bacterial solution was pipetted into 50mL of Kan +Culture in liquid LB medium at 28°C on a shaker for 12 hours, until the OD value reaches 0.8-1. Centrifuge the culture (5000 rpm for 10 minutes), discard the supernatant, and resuspend the cells in Agrobacterium resuspension solution. Measure the OD value of the resuspended culture at 600 nm to 0.4-0.6 using a UV spectrophotometer. Let stand at room temperature for 1 hour. Inject the culture solution into the tobacco leaves using a syringe, ensuring that it completely fills the leaves. Place in a dark climatic chamber for 48 hours.

[0055] Carefully cut the infected tobacco leaves with a blade, make a slide with the back facing up, and observe the GFP signal under laser confocal microscope. Figure 3 As shown, the bright field shows the outline of tobacco cells, the GFP signal shows the cellular location of the CsTLP 30 protein, and DAPI is a positive control. The merging of the bright field, DAPI, and GFP signal images shows that the luminescent position of the CsT LP30 recombinant protein is consistent with that of the positive control, indicating that CsTLP30 is localized in the cell nucleus.

[0056] 4. Antisense Inhibition Verification of CsTLP30's Anti-Anthrax Function

[0057] (1) Design of antisense inhibition probes

[0058] Three antisense oligonucleotides and a control sense oligonucleotide were designed based on the gene sequence of CsLAC23. The specific names and sequences are as follows:

[0059] AsODN1: 5'-TGTTCCATCAAAAGTGCAGC-3'; (SEQ ID NO.3)

[0060] AsODN2: 5'-GTTGTTGAATTGGTTTAGTG-3'; (SEQ ID NO.10)

[0061] AsODN3: 5'-AGTCTGATCATCCTTGGGGT-3'; (SEQ ID NO. 11)

[0062] sODN:5'-CTATGCACGGGAAGAGGTGG-3'. (SEQ ID NO.12)

[0063] The designed probe was sent to Shanghai Sangon Biotechnology Co., Ltd. for synthesis and diluted to a concentration of 100 μM with ddH2O.

[0064] (2) Antisense inhibition and anthrax infection

[0065] ① Select one-year-old 'Longjing 43' cuttings with consistent growth potential and no pests or diseases. Inject the diluted probe into the second leaf using a 1mL syringe. Use water and random strands as controls. After 12 hours, remove the second leaf and quick-freeze it in liquid nitrogen. Extract RNA and perform qPCR using the reverse-transcribed cDNA as a template to screen for the optimal probe (SEQ ID NO. 3). Inject the tea seedlings with the optimal probe selected in the previous step, along with water and random strand primers. Samples are taken at 8, 12, and 24 hours for RNA extraction. After reverse transcription, perform quantitative PCR to identify the time point with the best inhibitory effect.

[0066] ② Treat tea seedlings with the optimal antisense probe, while water and random strands serve as controls. Twelve hours later, infect tea leaves with a suspension of Colletotrichum spores. Determine the Fv / Fm ratio of leaves taken 3 days after infection and leaves from the control group using an IMAGE-PAM modulated fluorimeter (WALZ, Germany).

[0067] ③ Histochemical staining of tea leaves after antisense inhibition

[0068] Tea leaves whose CsTLP30 gene was suppressed for 12 hours were taken and infected with anthrax spore suspension. After 3 days, the infected leaves were carefully removed to analyze the degree of damage. The specific steps are as follows: prepare 50mM sodium phosphate buffer (16mL 1M sodium dihydrogen phosphate, 84mL 1M sodium dihydrogen phosphate, pure water to 2L, pH adjusted to 7.5), nitro blue tetrazolium (NBT) staining solution (0.1g NBT dissolved in 50mL sodium phosphate buffer), 3,3'-diaminobenzidine (DAB) staining solution (0.05g DAB dissolved in 45mL sodium phosphate buffer, pH adjusted to 3.8, and finally fixed to 50mL with sodium phosphate buffer); take the inoculated leaves and put them into NBT and DAB staining solutions respectively, where NBT staining was incubated at 37℃ for 3h and DAB staining was incubated at 37℃ for 8h; the stained leaves were placed in 95% alcohol to remove chlorophyll and observe the leaf phenotype. According to Figure 4 It can be seen that the color of the lesions on tea leaves treated with AsODN1 solution is darker than that of the control group (sODN) and the blank group (ddH2O), and the area of ​​the lesions is significantly higher than that of the control group and the blank group.

[0069] ④Determination of peroxidase activity and hydrogen peroxide content

[0070] The activities of peroxidase (POD) and superoxide dismutase (SOD) were determined on tea leaves after antisense inhibition and infection with pathogens for 3 days. The specific steps are as follows: extract the total protein of the sample, weigh 0.06g of the sample and grind it into powder with liquid nitrogen, then transfer it to a mortar pre-cooled on ice, add 540uL 10×PBS, and grind it into a homogenate on ice; centrifuge at 12,000g for 10 minutes, and take the supernatant for testing; detect the activity of POD and SOD enzymes according to the instructions of the POD and SOD test kit (Nanjing Jiancheng). The results are as follows Figure 4 As shown in the results, after anthracnose fungi infect tea leaves, POD and SOD enzyme activities were significantly reduced after inhibiting CsTLP30 gene expression, compared with ddH2O and sODN treatments, and H2O2 content was significantly reduced. It is speculated that after the CsTLP30 gene is inhibited, tea leaves accumulate more ROS, making them more sensitive to pathogen infection and more susceptible to anthracnose infection, indicating that CsTLP30 mediates the regulation of tea plants' resistance to anthracnose stress.

[0071] 5. Verification of the Anti-anthracnose Function of CsTLP30 by Transient Expression in Tobacco

[0072] (1) Transform the pCAMBIA1305-CsTLP30 plasmid into Agrobacterium and shake it after verification. Select Nicotiana benthamiana plants that have grown for about 3 weeks and have consistent growth. Divide the tobacco leaves into 4 parts, namely:

[0073] ①pCAMBIA1305-CsTLP30+Blank②pCAMBIA1305+Blank

[0074] ③pCAMBIA1305-CsTLP30+Cg ④pCAMBIA1305+Cg. Use a syringe to inject the bacterial solutions of pCAMBIA1305 and pCAMBIA1305-CsTLP30 into the tobacco plants, ensuring that the injection volumes of the two bacterial solutions are equal.

[0075] (2) After 48 hours, a plum blossom-shaped hole was pierced at the injection site with a pin, and then the leaves were infected with anthrax hyphae blocks, wrapped in plastic wrap, and a blank culture medium was used as a control. After 2 days, the tobacco phenotype was observed and photographed. The results showed that tobacco leaves that were not infected with anthrax hyphae blocks had no obvious phenotype, and the corresponding chlorophyll fluorescence did not change significantly; however, after infection with anthrax hyphae blocks, the tobacco leaves turned significantly yellow, and the leaves in the control area were extremely dark yellow and had begun to necrotize. Chlorophyll fluorescence showed that compared with the pCAMBIA-1305 empty vector, the lesion area of ​​tobacco leaves after overexpressing CsTLP30 was smaller, the lesion degree was milder, and the yellow area was less. Calculation of the lesion area found that the lesion area of ​​tobacco leaves after overexpressing CsTLP30 was significantly reduced compared with the control group.

[0076] (3) Determination of peroxidase activity and hydrogen peroxide content

[0077] Tobacco leaves were sampled from different areas and immediately frozen in liquid nitrogen. The contents of active oxygen and hydrogen peroxide were then determined according to the method in step 5 above. Figure 5 Compared with the control, anthrax treatment significantly increased the activities of POD, SOD, and H2O2. Compared with the pCAMBIA-1305 empty vector, tobacco leaves overexpressing CsTLP30 suffered less damage, with significantly increased peroxidase (POD) and superoxide dismutase (SOD) activities and a significant decrease in H2O2 content. This suggests that CsTLP30 mediates tea plant resistance to anthrax infection.

[0078] The nucleotide sequence shown in SEQ ID NO.1 of the present invention is specifically:

[0079] 5’-ATGAACTTCTTTAAATCTCTTTCCCTTCCCATTTTCTTTTTCATTGCTCTCCTC TCCACCTACAGCCATGCAGCCACTATCAACATCATAAACAATTGCCCTTTTACTGTTTGGGCTGCTGCCGTACCCGGTGGTGGTCGACAACTTGACCGCGGCCAAACATGGGCCATCAACCCTCCTGCAGGCACAAAGGGAGCCCGGGTATGGGCCCGGACCGGCTGCACCTTTGATGGAACAGGTCGGGGCAGGTGCCAGACCGGTGACTGTAACGGGCTCCGCGAGTGCCAAGCTTATGGTGCACCCCCTAACACACTAGCTGAATATGCACTAAACCAATTCAACAACTTAGACTTCTTTGACATATCCCTGGTGGACGGGTTCAATGTGCCGATGGATTTTAGCCCTACCTCCAATGGGTGCACCCGGGGTATCAAATGTACTGTGGATATAAAAGGGCAGTGCCCGAATGAGTTGCGGGCACCGGGCGGGTGTAATAACCCGTGTACCGTATTTAAGACCGATCAGTATTGTTGCAATTCTGGAAACTGTGGACCCACAAATTATTCAAGGTTTTTCAAGGATAGATGCCCAGATGCATATAGTTACCCTAAGGATGATCAGACAAGCACATTTACTTGCAATGGGGGAACCAACTATAAGGTTGTGTTTTGCCCTTAA-3’

[0080] The amino acid sequence shown in SEQ ID NO.2 according to the present invention is specifically: MNFFKSLSLPIFFFIALLSTYSHAATINIINNCPFTVWAAAVPGGGRQLDRGQTWAINPPAGTKGARVWARTGCTFDGTGRGRCQTGDCNGLRECQAYGAPPNTLAEYALNQFNNLDFFDISLVDGFNVPMDFSPTSNGCTRGIKCTVDIKGQCPNELRAPGGCNNPCTVFKTDQYCCNSGNCGPTNYSRFFKDRCPDAYSYPKDDQTSTFTCNGGTNYKVVFCP

[0081] The nucleotide sequence shown in SEQ ID NO.3 of the present invention is specifically: 5'-TGTTCCATCAAAGGTGCAGC-3'

[0082] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. Tea Tree CsTLP30 A gene characterized by The nucleotide sequence of its CDS region is shown in SEQ ID NO.

1.

2. The tea tree according to claim 1 CsTLP30 The protein encoded by the gene is characterized in that Its amino acid sequence is shown in SEQ ID NO.

2.

3. The tea tree according to claim 1 CsTLP30 The application of the gene in regulating the sensitivity of tea trees to anthracnose is characterized in that: Inhibit tea tree CsTLP30 The expression of the gene will reduce the anthracnose resistance of tea plants.

4. A tea tree model susceptible to anthrax, characterized in that: The model contains the tea tree that inhibits the CsTLP30 Products of gene expression.

5. The anthrax-sensitive tea tree model according to claim 4, characterized in that The product includes an antisense oligonucleotide having a sequence as shown in SEQ ID NO.

3.

6. A tobacco model resistant to anthrax, characterized in that: The model contains the tea tree of claim 1 overexpressed in tobacco CsTLP30 Gene products.

7. A tea plant expression vector pCAMBIA1305-CsTLP30, characterized in that The protein is obtained by enzymatically cutting the fragment shown in SEQ ID NO: 1 into the pCAMBIA1305 vector.

8. A method for cultivating anthracnose-resistant plant varieties, characterized in that: The tea tree according to claim 1 CsTLP30 The gene is introduced into a target plant to obtain a transgenic plant with improved anthracnose resistance, wherein the plant is tobacco.

9. The cultivation method according to claim 8, characterized in that The specific steps include: (1) Cloning tea trees CsTLP30 Gene; (2) Building tea trees CsTLP30 Gene overexpression vector; (3) Tea tree CsTLP30 The target plant was transformed with the gene overexpression vector, and transgenic plants with improved anthracnose resistance were obtained through identification.

Images