Application of ClVDAC1 gene in regulating watermelon growth and development, fruit quality, seed quality, low temperature resistance and fusarium wilt resistance

Abstract

The present application relates to the technical field of plant genetic engineering. The present application provides application of ClVDAC1 gene in regulating watermelon growth and development, fruit quality, seed quality, low temperature resistance and fusarium wilt resistance. The present application constructs watermelon ClVDAC1 gene overexpression and gene silencing materials through transgenic means, and finds that ClVDAC1 gene overexpression increases stem diameter, vine length, seed weight, fruit weight, fruit vitamin C content and the like of watermelon plants, reduces fruit organic acid content, and improves sugar acid ratio, that is, ClVDAC1 gene overexpression can not only promote watermelon growth and development, improve watermelon yield, and fruit taste quality and nutritional quality, but also improve watermelon seed quality and storage and transportation resistance, thereby laying a foundation for preparing high-quality and high-yield storage and transportation resistant watermelon materials; ClVDAC1 gene silencing improves the low temperature resistance of watermelon plants.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to application of the ClVDAC1 gene in regulating watermelon growth and development, fruit quality, seed quality, low temperature resistance and wilt disease resistance. Background Art

[0002] Watermelon is an important horticultural crop in my country and even globally. Due to its short production cycle, rapid results, and stable profitability, it has rapidly developed within the agricultural sector, becoming a leading industry in some regions. However, environmental stresses such as low temperatures in winter and spring and wilt caused by continuous cropping can affect the growth and development of watermelon plants, leading to plant wilt and even death, which in turn affects yield and quality. This severely restricts the development of high-quality watermelon production and branding, as well as the sustainable and healthy development of the watermelon industry. Furthermore, with improving living standards, people have higher expectations for watermelon fruit quality. The breeding and application of high-quality, multi-resistant watermelon varieties is fundamental to increasing farmers' incomes and developing the watermelon industry. However, conventional hybrid breeding is time-consuming, phenotypic uncontrollable, and environmentally limited, hindering the development of high-quality, multi-resistant watermelon varieties.

[0003] Molecular breeding technology is a key technology in the transition from "empirical breeding" to targeted, efficient "precision breeding." Uncovering superior genes is a prerequisite for molecular breeding. Therefore, uncovering superior genes is crucial for accelerating the selection and breeding of new watermelon varieties using molecular technology.

[0004] Therefore, providing excellent genes for regulating watermelon resistance and fruit quality and their application in regulating plant resistance and fruit quality is an urgent problem to be solved by those skilled in the art.

[0005] VDAC (voltage-dependent anion-selective channel) is a highly abundant protein in the outer membrane of mitochondria in animals and plants. It plays a key role in facilitating the transport of ions and metabolites between mitochondria and the cytoplasm and regulating energy conversion. VDAC's role in animals, particularly in immune responses to pathogens, has been extensively reported. VDAC's role in regulating plant reproductive development and stress responses has also been reported. In Arabidopsis, AtVDAC3 negatively regulates seed germination under cold stress by interacting with HSP70-16 and kinase-like protein 1. AtVDAC1 also negatively regulates cold responses during seed germination and seedling development in Arabidopsis. Overexpression of Pennisetum VDAC enhances salt tolerance in rice. Overexpression of Arabidopsis VDAC2 confer drought tolerance in an ABA-dependent manner. However, the role of VDAC in regulating plant growth and fruit development is rarely reported, and the sequence of VDACs varies greatly among different plant species, leading to significant functional variations. Summary of the Invention

[0006] The object of the present invention is to provide an application of the ClVDAC1 gene in regulating watermelon growth and development, light energy utilization efficiency, watermelon yield, fruit taste quality and nutritional quality, fruit storage and transportation tolerance, seed quality, watermelon plant low temperature resistance and wilt disease resistance.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides an application of the ClVDAC1 gene in regulating the growth and development of watermelon. The sequence of the ClVDAC1 gene is shown in SEQ ID NO.12. Overexpression of the ClVDAC1 gene increases the stem diameter, vine length, leaf number and internode length of watermelon plants.

[0009] The present invention provides an application of the ClVDAC1 gene in regulating the yield and quality of watermelon fruit. Overexpression of the ClVDAC1 gene improves the yield, taste quality and nutritional quality of watermelon.

[0010] The present invention provides an application of the ClVDAC1 gene in regulating the storage and transportation resistance of watermelon. Overexpression of the ClVDAC1 gene increases the thickness of the watermelon peel.

[0011] The present invention provides an application of the ClVDAC1 gene in regulating watermelon seed quality, and overexpression of the ClVDAC1 gene increases watermelon seed weight.

[0012] The present invention provides a system for overexpressing the ClVDAC1 gene, comprising an overexpression vector pCambia1305.4-ClVDAC1.

[0013] Preferably, the structure of the pCambia1305.4 vector in the overexpression vector pCambia1305.4-ClVDAC1 is (CaMV 35S)-(MCS)-(NOS terminator)-(CaMV 35S)-(GFP).

[0014] The present invention provides a method for preparing a pCambia1305.4 vector, comprising the following steps:

[0015] (1) Using the pCambia1305 vector as the original vector, the GUSPlus sequence was removed and the GFP sequence was connected to obtain the pCambia1305-GFP vector;

[0016] (2) The lac promoter sequence on the pCambia1305-GFP vector was removed and ligated to the CaMV 35S promoter sequence to obtain the pCambia1305-35S-GFP vector;

[0017] (3) The NOS terminator sequence was ligated to the pCambia1305-35S-GFP vector to obtain the pCambia1305.4 vector.

[0018] Preferably, the GFP sequence is shown as SEQ ID NO.3, the CaMV 35S promoter sequence is shown as SEQ ID NO.6, and the NOS terminator sequence is shown as SEQ ID NO.9.

[0019] The present invention provides an application of the ClVDAC1 gene in regulating the low-temperature resistance of watermelon plants, and inhibits the expression of the ClVDAC1 gene to improve the low-temperature resistance of watermelon plants.

[0020] The present invention provides an application of the ClVDAC1 gene in regulating the wilt resistance of watermelon plants. Overexpression of the ClVDAC1 gene inhibits the wilt resistance of watermelon plants.

[0021] The present invention also provides a system for silencing the ClVDAC1 gene, comprising a pTRSV1 plasmid, a recombinant plasmid pTRSV2-ClVDAC1 and a p19 virus.

[0022] The present invention also provides an application of the system for silencing the ClVDAC1 gene, comprising the following steps:

[0023] (1) The pTRSV1 plasmid, the recombinant plasmid pTRSV2-ClVDAC1, and the p19 virus were transformed into Agrobacterium, and cultured to obtain Agrobacterium culture liquid 1, Agrobacterium culture liquid 2, and p19 virus Agrobacterium culture liquid;

[0024] (2) mixing Agrobacterium solution 1, Agrobacterium solution 2, and p19 virus Agrobacterium solution in a volume ratio of (0.8-1.2):1:(0.8-1.2) and injecting the mixture into tobacco leaves to obtain an infection solution;

[0025] (3) Treating crop plants with the infection solution described in step (2) to obtain crop plants with silenced ClVDAC1 gene.

[0026] As a preference, the OD of the Agrobacterium solution 1 in step (1) 600 The OD of the Agrobacterium solution 2 is 0.8-1.2. 600 The OD of the p19 virus Agrobacterium solution is 0.9-1.2. 600 It is 0.9-1.1.

[0027] By adopting the above technical solution, the present invention has the following beneficial effects:

[0028] The technical solution of the present invention constructs watermelon ClVDAC1 overexpression and gene silencing materials through transgenic means, and regulates the expression level of the ClVDAC1 gene to study its regulatory effect on watermelon plant growth, resistance, yield, fruit quality, fruit storage and transportation resistance, and seed quality. It is found that ClVDAC1 overexpression increases the stem diameter, vine length, leaf number, internode length, seed weight, fruit weight, peel thickness, and vitamin C content of the watermelon plant, reduces the organic acid content of the fruit, improves the sugar-acid ratio, and reduces the number of seeds per melon; ClVDAC1 gene silencing improves the resistance of watermelon plants to low temperature and physiological subspecies 1 of the wilt pathogen. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is the overexpression vector pCambia1305.4-ClVDAC1 structure;

[0030] Figure 2 The expression of ClVDAC1 gene in overexpressing transgenic plants #1, #2, #4 and control group plants;

[0031] Figure 3 The results of stem diameter, vine length, leaf number and internode length measurement of wild-type plants and overexpression transgenic plants #2 and #4 are shown in Figure 2. Figure 3 A represents stem diameter, B represents vine length, C represents number of leaves, and D represents internode length);

[0032] Figure 4 The results of single fruit weight and fruit skin thickness measurement of wild-type plants, overexpression transgenic plants #2 and #4 ( Figure 4 A represents the weight of a single melon, and B represents the thickness of the peel);

[0033] Figure 5 Results of the determination of vitamin C content, organic acid content, total soluble sugar content and sugar-acid ratio of fruits of wild-type plants and overexpression transgenic plants #2 and #4 ( Figure 5 A represents vitamin C content, B represents organic acid content, C represents total soluble sugar content, and D represents sugar-acid ratio);

[0034] Figure 6 The results of the determination of the number of seeds and seed weight of single melon in the wild-type plants and the overexpression transgenic plants #2 and #4 are shown in Figure 2. Figure 6 A represents the number of seeds in a single melon, and B represents the weight of the seeds);

[0035] Figure 7 The results of low temperature resistance test of WT plants and ClVDAC1 gene overexpression plants ( Figure 7 A represents the wilting condition of different plants, B represents the Fv / Fm value of different plants, and C represents the relative conductivity of different plants);

[0036] Figure 8 The resistance of WT plants and ClVDAC1 gene overexpressing plants to FON1 ( Figure 8 A represents the wilting condition of different plants, B represents the incidence rate of different plants, and C represents the disease index of different plants);

[0037] Figure 9 The structure of ClVDAC1 gene silencing plasmid pTRSV2-ClVDAC1;

[0038] Figure 10 The expression of ClVDAC1 gene in ClVDAC1 gene silenced plants and control plants;

[0039] Figure 11 The resistance of ClVDAC1 gene silenced plants and control plants to low temperature ( Figure 11 A represents the wilting condition of different plants, B represents the Fv / Fm value of different plants, and C represents the relative conductivity of different plants). DETAILED DESCRIPTION

[0040] The present invention provides application of the ClVDAC1 gene in regulating the growth and development of watermelon.

[0041] In the present invention, the sequence of the ClVDAC1 gene is shown in SEQ ID NO.12, and the specific sequence is

[0042] .

[0043] In the present invention, overexpression of the ClVDAC1 gene promotes the growth and development of watermelon, and increases the stem diameter, vine length, leaf number and internode length of the watermelon plant.

[0044] The present invention provides an application of the ClVDAC1 gene in regulating the yield and quality of watermelon fruit. Overexpression of the ClVDAC1 gene improves the yield, taste quality and nutritional quality of watermelon.

[0045] In the present invention, improving the taste quality of watermelon preferably includes reducing the organic acid content of watermelon fruit, increasing the sugar-acid ratio of watermelon fruit, and reducing the number of seeds and grains.

[0046] In the present invention, improving the nutritional quality of watermelon preferably includes increasing the vitamin C content of the watermelon fruit.

[0047] The present invention also provides an application of the ClVDAC1 gene in regulating the storage and transportation resistance of watermelon, and overexpression of the ClVDAC1 gene increases the thickness of the watermelon peel.

[0048] The present invention also provides an application of the ClVDAC1 gene in regulating watermelon seed quality, and overexpression of the ClVDAC1 gene increases watermelon seed weight.

[0049] The present invention provides a system for overexpressing the ClVDAC1 gene, comprising an overexpression vector pCambia1305.4-ClVDAC1.

[0050] In the present invention, the structure of the pCambia1305.4 vector in the overexpression vector pCambia1305.4-ClVDAC1 is (CaMV 35S)-(MCS)-(NOS terminator)-(CaMV 35S)-(GFP).

[0051] The present invention also provides a method for preparing the pCambia1305.4 vector, comprising the following steps:

[0052] (1) Using the pCambia1305 vector as the original vector, the GUSPlus sequence was removed and the GFP sequence was connected to obtain the pCambia1305-GFP vector;

[0053] (2) The lac promoter sequence on the pCambia1305-GFP vector was removed and ligated to the CaMV35S promoter sequence to obtain the pCambia1305-35S-GFP vector;

[0054] (3) The NOS terminator sequence was ligated to the pCambia1305-35S-GFP vector to obtain the pCambia1305.4 vector.

[0055] In the present invention, the GFP sequence is as shown in SEQ ID NO.3, and the specific sequence is atgggtaagggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaagcttcctgttccttggccaacacttgtcactactcttacttatggtgttcaatgcttttcaagatacccagatcatatgaagcggcacgacttcttcaagagcgccatgcctgagggatacgtgcaggaaaggaccatcttcttcaaggacgacgggaactacaagacacgtgctgaagtcaagtttgagggagacacccttgtcaacaggatcgagcttaagggaatcgatttcaaggaggacggaaacatcctcggccacaagttggaatacaactacaactcccacaacgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataa。

[0056] In the present invention, the CaMV 35S promoter sequence is as shown in SEQ ID NO.6, and the specific sequence is agattagccttttcaatttcagaaagaatgctaacccacagatggttagagaggcttacgcagcaggtctcatcaagacgatctacccgagcaataatctccaggaaatcaaataccttcccaagaaggttaaagatgcagtcaaaagattcaggactaactgcatcaagaacacagagaaagatatatttctcaagatcagaagtactattccagtatggacgattcaaggcttgcttcacaaaccaaggcaagtaatagagattggagtctctaaaaaggtagttcccactgaatcaaaggccatggagtcaaagattcaaatagaggacctaacagaactcgccgtaaagactggcgaacagttcatacagagtctcttacgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacgacacacttgtctactccaaaaatatcaaagatacagtctcagaagaccaaagggcaattgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagctatctgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatataaggaagttcatttcatttggagagaacacgggggactctagaggatcc。

[0057] In the present invention, the NOS terminator sequence is as shown in SEQ ID NO.9, and the specific sequence is

[0058] ccatcacgtgtgaattggtgaccagctcgaatttccccgatcgttcaaacatttggcaataaagtttcttaagattgaatc

[0059] ctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacg

[0060] ttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttatactagatc.

[0061] The present invention also provides an application of the ClVDAC1 gene in regulating the low-temperature resistance of watermelon plants, and inhibits the expression of the ClVDAC1 gene to improve the low-temperature resistance of watermelon plants.

[0062] The present invention also provides an application of the ClVDAC1 gene in regulating the wilt resistance of watermelon plants. Overexpression of the ClVDAC1 gene inhibits the wilt resistance of watermelon plants.

[0063] The present invention also provides a system for silencing the ClVDAC1 gene, comprising a pTRSV1 plasmid, a recombinant plasmid pTRSV2-ClVDAC1 and a p19 virus.

[0064] The present invention also provides an application of the system for silencing the ClVDAC1 gene, comprising the following steps:

[0065] (1) The pTRSV1 plasmid, the recombinant plasmid pTRSV2-ClVDAC1, and the p19 virus were transformed into Agrobacterium, and cultured to obtain Agrobacterium culture liquid 1, Agrobacterium culture liquid 2, and p19 virus Agrobacterium culture liquid;

[0066] (2) mixing Agrobacterium solution 1, Agrobacterium solution 2, and p19 virus Agrobacterium solution in a volume ratio of (0.8-1.2):1:(0.8-1.2) and injecting the mixture into tobacco leaves to obtain an infection solution;

[0067] (3) Treating crop plants with the infection solution described in step (2) to obtain crop plants with silenced ClVDAC1 gene.

[0068] In the present invention, the OD of the Agrobacterium solution 1 in step (1) is 600Preferably, it is 0.8-1.2, more preferably 0.9-1.1, and further preferably 1.0; the OD of the Agrobacterium solution 2 600 Preferably, it is 0.9-1.2, more preferably 0.92-1.1, and even more preferably 1.0; the OD of the p19 virus Agrobacterium solution is 600 It is preferably 0.9-1.1, more preferably 0.95-1.05, and further preferably 1.0.

[0069] In the present invention, the volume ratio of the Agrobacterium solution 1, Agrobacterium solution 2 and p19 virus Agrobacterium solution mixed in step (2) is preferably (0.8-1.2):1:(0.8-1.2), further preferably (0.9-1.1):1:(0.9-1.1), and further preferably 1:1:1.

[0070] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0071] Example 1 Construction of ClVDAC1 gene overexpression vector

[0072] (1) Preparation of pCambia1305.4 vector

[0073] The pCambia1305.4 vector is modified based on the pCambia1305 vector. The specific modification process is as follows:

[0074] 1. Obtain pCambia1305-GFP vector

[0075] The original GUSPlus tag was replaced with a GFP tag, where the GFP sequence came from the PBI221-GFP vector (provided by the Muskmelon Research Group of Northwest Agriculture and Forestry University). Specific primers were designed, and the homology arm sequences of the pCambia1305 vector (provided by Professor Li Dawei of Northwest Agriculture and Forestry University; Jingjing Chang, Yanliang Guo, Jingyi Yan, Zixing Zhang, Li Yuan, Chunhua Wei, Yong Zhang, Jianxiang Ma, Jianqiang Yang, Xian Zhang, and Hao Li. The role of watermelon caffeic acid O-methyltransferase (ClCOMT1) in melatonin biosynthesis and abiotic stress tolerance. Horticulture Research (2021) 8: 210) were added to the 5' end of the primers, respectively. They were named GFP-F and GFP-R. The sequence of the GFP-F is shown in SEQ ID NO. 1, and the specific sequence is 5'-acgggggactcttgaccatggatgggtaagggagaagaacttt-3'; the sequence of the GFP-R is shown in SEQ ID NO. 2, and the specific sequence is 5'-gagctggtcaccaattcacacttatttgtatagttcatccatgcc-3'.

[0076] Then, PCR amplification was performed using the PBI221-GFP vector as a template. The PCR reaction system was: Primer START MaxPremix (2x) 25 μL, PBI221-GFP 2 μL, GFP-F 1 μL, GFP-R 1 μL, ddH2O 21 μL; the PCR reaction program was: 98°C for 10 s, 55°C for 5 s, 72°C for 10 s, 30 cycles; 72°C for 5 min.

[0077] After purification and recovery, a GFP fragment containing the homology arms of the pCambia1305 vector was obtained. The purified product was ligated with the pCambia1305 linearized vector (GUSPlus removed) digested with Nco I and Pml I restriction endonucleases to obtain the pCambia1305-GFP vector containing a GFP tag.

[0078] The nucleotide sequence of GFP is shown in SEQ ID NO.3, and the specific sequence is atgggtaagggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaagcttcctgttccttggccaacacttgtcactactcttacttatggtgttcaatgcttttcaagatacccagatcatatgaagcggcacgacttcttcaagagcgccatgcctgagggatacgtgcaggaaaggaccatcttcttcaaggacgacgggaactacaagacacgtgctgaagtcaagtttgagggagacacccttgtcaacaggatcgagcttaagggaatcgatttcaaggaggacggaaacatcctcggccacaagttggaatacaactacaactcccacaacgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataa。

[0079] 2. Obtain the pCambia1305-35S-GFP vector

[0080] Based on the pCambia1305-GFP vector, the lac promoter was replaced with the CaMV 35S promoter. The CaMV 35S promoter sequence was derived from the PBI121 vector (provided by the Muskmelon Research Group at Northwest Agriculture and Forestry University). Specific primers were designed, and the pCambia1305 homology arms were added to the 5' ends of the primers, designated 35S-F and 35S-R. The sequence of 35S-F is shown in SEQ ID NO. 4, specifically: 5'-acgagagtgtcgtgctccaccatgagattagccttttcaatttcag-3'; the sequence of 35S-R is shown in SEQ ID NO. 5, specifically: 5'-cttgcatgcctgcaggtcgacggatcctctagagtcccccgtg-3'.

[0081] Then, PCR amplification was performed using the PBI121 vector as a template. The PCR reaction system was: Primer START MaxPremix (2x) 25 μL, PBI12 12 μL, 35S-F 1 μL, 35S-R 1 μL, ddH2O 21 μL; the PCR reaction program was: 98°C 10 s, 55°C 5 s, 72°C 10 s, 30 cycles; 72°C 5 min.

[0082] After purification and recovery, the CaMV 35S fragment containing the homology arms of the pCambia1305 vector was obtained. The purified product was ligated with the pCambia1305-GFP linearized vector (lac promoter removed) digested with BstXI and Sal I restriction endonucleases to obtain the pCambia1305-35S-GFP vector containing the CaMV 35S promoter and GFP tag.

[0083] The nucleotide sequence of CaMV 35S is shown in SEQ ID NO.6, and the specific sequence is agattagccttttcaatttcagaaagaatgctaacccacagatggttagagaggcttacgcagcaggtctcatcaagacgatctacccgagcaataatctccaggaaatcaaataccttcccaagaaggttaaagatgcagtcaaaagattcaggactaactgcatcaagaacacagagaaagatatatttctcaagatcagaagtactattccagtatggacgattcaaggcttgcttcacaaaccaaggcaagtaatagagattggagtctctaaaaaggtagttcccactgaatcaaaggccatggagtcaaagattcaaatagaggacctaacagaactcgccgtaaagactggcgaacagttcatacagagtctcttacgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacgacacacttgtctactccaaaaatatcaaagatacagtctcagaagaccaaagggcaattgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagctatctgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatataaggaagttcatttcatttggagagaacacgggggactctagaggatcc。

[0084] 3. Obtain the pCambia1,305.4 vector

[0085] Based on the pCambia1305-35S-GFP vector, the NOS terminator was added after the CaMV 35S promoter. The NOS terminator sequence was derived from the pCambia1305 vector. Specific primers were designed, and the pCambia1305 homology arm sequences were added to the 5' ends of the primers, respectively. These primers were named NOS-F and NOS-R. The sequence of NOS-F is shown in SEQ ID NO. 7, specifically 5'-gactctagaggatccgtcgactcaccatcacgtgtgaattggt-3'; the sequence of NOS-F is shown in SEQ ID NO. 8, specifically 5'-aacgacggccagtgccaagctgatctagtaacatagatgacaccg-3'.

[0086] Then, PCR amplification was performed using the pCambia1305 vector as a template. The PCR reaction system was: Primer START MaxPremix (2x) 25 μL, pCambia1305 2 μL, NOS-F 1 μL, NOS-R 1 μL, ddH2O 21 μL; the PCR reaction program was: 98°C for 10 s, 55°C for 5 s, 72°C for 10 s, 30 cycles; 72°C for 5 min.

[0087] After purification and recovery, the NOS terminator fragment containing the homology arms of the pCambia1305 vector was obtained. This purified product was ligated with the linearized pCambia1305-35S-GFP vector digested with Sal I and Hind III restriction enzymes to obtain the pCambia1305 vector containing the CaMV 35S promoter and GFP tag, designated pCambia1305.4. The structure of pCambia1305.4 is: (CaMV 35S)-(MCS)-(NOS terminator)-(CaMV 35S)-(GFP).

[0088] The nucleotide sequence of NOS terminator is shown in SEQ ID NO.9, and the specific sequence is ccatcacgtgtgaattggtgaccagctcgaatttccccgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatc.

[0089] (II) Construction of ClVDAC1 gene overexpression vector

[0090] The ClVDAC1 gene was cloned from the cDNA of the wild-type watermelon material YL (Zhang Yueqiao, Ge Jie, Tian Shujuan, Yuan Li. 2020. Detection of target sites of the watermelon CRISPR / Cas9 system using the Agrobacterium rhizogenes system. Chinese Vegetables, 33(4): 7-11.).

[0091] Specific primers were designed based on the coding region sequence of the ClVDAC1 (Cla97C08G151760) reference sequence provided in the Cucurbit Genomics Database. Homology arm sequences from the pCambia1305.4 vector were added to the 5' ends of the primers, respectively. These primers were named ClVDAC1-F and ClVDAC1-R. The sequence of ClVDAC1-F is shown in SEQ ID NO. 10, specifically 5'-acgggggactctagaggatccatggggaaaggtccaggtctc-3'; the sequence of ClVDAC1-R is shown in SEQ ID NO. 11, specifically 5'-ctggtcaccaattcacacgtgttagtggtggtggtggtggtgaggcttgagagccaaggccag-3'.

[0092] Then, PCR amplification was performed using the cDNA of watermelon YL material as a template. The PCR reaction system was: Primer STARTMax Premix (2x) 25 μL, cDNA 2 μL, ClVDAC1-F 1 μL, ClVDAC1-R 1 μL, ddH2O 21 μL; the PCR reaction program was: 98°C 10 s, 55°C 5 s, 72°C 10 s, 30 cycles; 72°C 5 min.

[0093] After purification and recovery, the ClVDAC1 fragment containing the homology arms of the pCambia1305.4 vector was obtained. The purified product was ligated with the pCambia1305.4 linearized vector digested with BamHI and PmlI restriction endonucleases to obtain the overexpression vector pCambia1305.4-ClVDAC1 (e.g. Figure 1The nucleotide sequence of ClVDAC1 gene is shown in SEQ ID NO.12, and the specific sequence is.

[0094] The results showed that the cloned ClVDAC1 cDNA sequence was consistent with the cDNA sequence (Cla97C08G151760) and amino acid sequence of 97103 whole-genome sequenced materials published in the Cucurbit Genomics Database.

[0095] Example 2 Construction and detection of ClVDAC1 gene overexpression plants

[0096] The overexpression vector pCambia1305.4-ClVDAC1 prepared above was transformed into Agrobacterium tumefaciens EHA105 (purchased from Shanghai Weidi Biotechnology Co., Ltd.). Explants prepared from YL watermelon cotyledons were then infected and calli were induced on M519 solid medium containing 2,4-D. Explants transformed with the overexpression vector were selected using hygromycin, while those transformed with the editing vector were selected using the herbicide BASTA. Subcultures were performed every two weeks, and positive transgenic tissue was detected at 6-8 weeks.

[0097] Transgenic plants overexpressing ClVDAC1 (ClVDAC1-OE) were validated by RT-qPCR. A 20 μL reaction system contained 10 μL SYBR Premix ExTaq, 0.8 μL Primer F + 0.8 μL Primer R (10 μM), 6 μL ddH₂O, 0.4 μL R OXⅡ, and 2 μL cDNA template (100 ng). The reaction was performed using a two-step method with 40 cycles of initial denaturation at 95°C for 30 s, denaturation at 95°C for 5 s, and annealing at 60°C for 30 s. Specific primers for RT-PCR analysis were designed using Primer Premier 6.0 software, with β-actin serving as an internal control.

[0098] The sequence of the ClVDAC1-qRTPCR-F is shown in SEQ ID NO.13, and the specific sequence is 5'-atgccctcactgcctcctacta-3'; the sequence of the ClVDAC1-qRTPCR-R is shown in SEQ ID NO.14, and the specific sequence is 5'-tcgtgctggattagaccgcttg-3'; the sequence of the β-actin-F is shown in SEQ ID NO.15, and the specific sequence is 5'-ccatgtatgttgccatccag-3'; the sequence of the β-actin-R is shown in SEQ ID NO.16, and the specific sequence is 5'-ggatagcatggggtagagca-3'.

[0099] RT-qPCR test results are as follows Figure 2 The results showed that the expression levels of ClVDAC1 gene in overexpressing transgenic plants #1, #2 and #4 were 18.26 times, 19.22 times and 24.99 times that of wild-type tissues, respectively.

[0100] Example 3 Detection of Growth, Fruit and Seed Characteristics of ClVDAC1 Gene Overexpressing Plants

[0101] Wild-type YL (WT) and ClVDAC1-overexpressing plants were planted in early April at the Rougu Watermelon Experimental Base in Yangling, Shaanxi Province. Four growth indicators, stem diameter, vine length, leaf number, and internode length, were measured during the vine extension phase. Eight fruit characteristics, including single fruit weight, pericarp thickness, vitamin C content, total soluble sugar content, organic acid content, sugar-acid ratio, number of seeds per fruit, and seed weight, were measured after fruit ripening.

[0102] like Figure 3 It can be seen that the stem diameter, vine length, leaf number and internode length of the overexpressing transgenic plant #2 (ClVDAC1-OE#2) and the overexpressing transgenic plant #4 (ClVDAC1-OE#4) were all higher than those of the wild type YL, indicating that overexpression of the ClVDAC1 gene promoted the growth and light energy utilization efficiency of YL watermelon plants.

[0103] like Figure 4 It can be seen that the single fruit weight and peel thickness of the overexpressing transgenic plant #2 and the overexpressing transgenic plant #4 are greater than those of the wild type YL, indicating that overexpression of the ClVDAC1 gene improves the yield and storage and transportation resistance of watermelon fruit.

[0104] like Figure 5 It can be seen that the vitamin C content and sugar-acid ratio of the fruits of the overexpression transgenic plant #2 and the overexpression transgenic plant #4 were higher than those of the wild type YL, and the organic acid content was lower than that of the wild type YL, indicating that overexpression of the ClVDAC1 gene improved the taste and nutritional quality of the fruit.

[0105] like Figure 6 It can be seen that the number of seeds per fruit of the overexpression transgenic plant #2 and the overexpression transgenic plant #4 is less than that of the wild-type YL, indicating that overexpression of the ClVDAC1 gene improves the taste quality of the fruit and can be used to create low-seed watermelon materials; the seed weight of the overexpression transgenic plant #2 and the overexpression transgenic plant #4 is higher than that of the wild-type YL, indicating that overexpression of the ClVDAC1 gene improves seed quality.

[0106] Example 4 Evaluation of low temperature and wilt resistance in plants overexpressing the ClVDAC1 gene

[0107] (I) Evaluation of low temperature resistance of ClVDAC1 gene overexpressing plants

[0108] WT plants and ClVDAC1 gene overexpressing plants were sown in nutrient pots. When the plants grew to 4 leaves and 1 heart, they were treated with 4°C low temperature, with 25°C as the normal temperature control, for 48 hours.

[0109] The results are as follows Figure 7As shown in the results, plants overexpressing the ClVDAC1 gene wilted more significantly after low-temperature stress than WT plants, with lower Fv / Fm values ​​and higher relative conductivity than WT plants, indicating that ClVDAC1 overexpression reduced the cold resistance of watermelon plants. Given the ClVDAC1 gene's negative regulation of cold resistance in watermelon, gene editing could be used to create cold-tolerant watermelon varieties.

[0110] (II) Evaluation of Fusarium wilt resistance in plants overexpressing the ClVDAC1 gene

[0111] When WT plants and plants overexpressing the ClVDAC1 gene grew to two leaves and one heart, they were artificially inoculated with Fusarium wilt pathogen race 1 (FON1, isolated and preserved by the Muskmelon Research Group, College of Horticulture, Northwest Agriculture and Forestry University, Xuan CQ, Feng MJ, Li X, Hou YJ, Wei CH, Zhang X. 2024. Genome-wide identification and expression analysis of chitinase genes in watermelon under abiotic stimulation and Fusarium oxysporum infection. Int J Mol Sci, 25:638.). Artificial inoculation was performed using the root immersion method. The seedlings were removed from the nutrient pots, and the roots were rinsed with water to minimize root damage and dried. The tip of the main root was cut off 1-2 cm with scissors, and the treated plants were immersed in the prepared spore suspension (10 6 The seedlings were incubated in a sterilized soil (sieved) for 15 min, and the growth of the plants was observed after the seedlings had recovered. The incidence rate and disease index of Fusarium wilt were calculated on the 7th day after inoculation.

[0112] The results are as follows Figure 8 As shown in the results, after artificial inoculation with FON1, ClVDAC1-overexpressing plants wilted more significantly than WT plants, with both disease incidence and disease index higher than WT plants, indicating that ClVDAC1 overexpression reduced watermelon plants' resistance to FON1. Based on the ClVDAC1 gene's negative regulation of FON1 resistance in watermelon, gene editing technology could be used to create watermelon materials resistant to Fusarium wilt.

[0113] Example 5 Construction and detection of ClVDAC1 gene silenced plants

[0114] Refer to Fang et al. (Fang L, Wei XY, Liu LZ, Zhou LX, Tian YP, Geng C, LiXD. 2021. Atobacco ringspot virus-based vector system for gene and microRNA function studies in cucurbits. Plant Physiology, 186: 853–864). Virus-induced gene silencing (VIGS) experiments were performed using Agrobacterium-mediated transformation. A 434 bp cDNA fragment of the target ClVDAC1 gene was amplified by PCR and inserted into the pTRSV2 (PT) vector containing the SnaB I restriction site to obtain the recombinant plasmid pTRSV2-ClVDAC1 (as Figure 9 The recombinant plasmid pTRSV2-ClVDAC1, pTRSV1 plasmid, and p19 virus were transformed into Agrobacterium tumefaciens GV3101 strain, respectively, to obtain GV3101 carrying the pTRSV1 gene, GV3101 carrying pTRSV2-ClVDAC1, and GV3101 carrying the p19 virus. These cultures were then used to obtain GV3101 Agrobacterium culture solution 1, GV3101 Agrobacterium culture solution 2, and the p19 virus Agrobacterium culture solution.

[0115] GV3101 Agrobacterium tumefaciens liquid 1, GV3101 Agrobacterium tumefaciens liquid 2 and p19 virus Agrobacterium tumefaciens liquid were mixed in a 1:1:1 volume ratio (OD 600 = 1.0) and injected into Nicotiana benthamiana leaves through the lower epidermis. After the viral phenotype was manifested, the infected leaves were collected, ground into a homogenate, and centrifuged to obtain the supernatant (i.e., the infection fluid). This was gently injected into the cotyledons of YL watermelon (YL-pT-ClVDAC1). An empty pTRSV2 vector was used as a control (YL-pT). The relative expression of ClVDAC1 was analyzed by RT-qPCR, using the same operating conditions as in Example 2.

[0116] The results are as follows Figure 10 As shown in Figure 3, the expression of ClVDAC1 gene in ClVDAC1 gene silenced plants decreased by 65.49% compared with the control.

[0117] Example 6 Evaluation of low temperature resistance of ClVDAC1 gene silenced plants

[0118] When the control plants and ClVDAC1 gene silenced plants grew to 4 leaves and 1 heart, they were treated with 4℃ low temperature, with 25℃ as the control, for 48 hours.

[0119] like Figure 11As shown in the data, after low temperature stress, the wilting degree of ClVDAC1 gene-silenced plants was lighter than that of the control plants, and their Fv / Fm value was higher than that of the control plants, but their relative conductivity was lower than that of the control plants, indicating that ClVDAC1 gene silencing improved the low temperature resistance of watermelon plants, further providing theoretical support for the creation of low-temperature-tolerant watermelon materials by knocking out ClVDAC1 through gene editing.

[0120] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of ClVDAC1 gene in regulating the growth and development of watermelon, characterized in that: The sequence of the ClVDAC1 gene is shown in SEQ ID NO.12; Overexpression of the ClVDAC1 gene increased the stem diameter, vine length, leaf number and internode length of watermelon plants.

2. Application of ClVDAC1 gene in regulating watermelon fruit yield and quality, characterized in that: The sequence of the ClVDAC1 gene is shown in SEQ ID NO. 12; overexpression of the ClVDAC1 gene improves watermelon yield, taste quality and nutritional quality.

3. Application of ClVDAC1 gene in regulating storage and transportation tolerance of watermelon fruit, characterized in that: The sequence of the ClVDAC1 gene is shown in SEQ ID NO. 12; overexpression of the ClVDAC1 gene increases the thickness of watermelon peel.

4. Application of ClVDAC1 gene in regulating watermelon seed quality, characterized in that: The sequence of the ClVDAC1 gene is shown in SEQ ID NO. 12; overexpression of the ClVDAC1 gene increases watermelon seed weight.

5. A system for overexpressing the ClVDAC1 gene, characterized in that: The invention comprises an overexpression vector pCambia1305.4-ClVDAC1, wherein the structure of the pCambia1305.4 vector in the overexpression vector pCambia1305.4-ClVDAC1 is (CaMV35S)-(MCS)-(NOS terminator)-(CaMV 35S)-(GFP); The sequence of the ClVDAC1 gene is shown in SEQ ID NO.

12.

6. A method for preparing a pCambia1305.4 vector, characterized in that: The steps include: (1) Using the pCambia1305 vector as the original vector, the GUSPlus sequence was removed and the GFP sequence was connected to obtain the pCambia1305-GFP vector; (2) The lac promoter sequence on the pCambia1305-GFP vector was removed and ligated to the CaMV 35S promoter sequence to obtain the pCambia1305-35S-GFP vector; (3) Ligate the NOS terminator sequence to the pCambia1305-35S-GFP vector to obtain the pCambia1305.4 vector; The GFP sequence is shown as SEQ ID NO.2, the CaMV 35S promoter sequence is shown as SEQ ID NO.3, and the NOS terminator sequence is shown as SEQ ID NO.

4.

7. Application of the ClVDAC1 gene in regulating low temperature resistance of watermelon plants, characterized in that: The sequence of the ClVDAC1 gene is shown in SEQ ID NO. 12; inhibiting the expression of the ClVDAC1 gene improves the low temperature resistance of watermelon plants.

8. A system for silencing the ClVDAC1 gene, characterized in that: Including pTRSV1 plasmid, recombinant plasmid pTRSV2-ClVDAC1 and p19 virus; The sequence of the ClVDAC1 gene is shown in SEQ ID NO.

12.

9. Use of the system for silencing the ClVDAC1 gene according to claim 8, characterized in that: The steps include: (1) The pTRSV1 plasmid, the recombinant plasmid pTRSV2-ClVDAC1, and the p19 virus were transformed into Agrobacterium, and cultured to obtain Agrobacterium culture liquid 1, Agrobacterium culture liquid 2, and p19 virus Agrobacterium culture liquid; (2) mixing Agrobacterium solution 1, Agrobacterium solution 2, and p19 virus Agrobacterium solution in a volume ratio of (0.8-1.2):1:(0.8-1.2) and injecting the mixture into tobacco leaves to obtain an infection solution; (3) treating crop plants with the infection solution of step (2) to obtain crop plants with silenced ClVDAC1 gene; OD of the Agrobacterium solution 1 in step (1) 600 The OD of the Agrobacterium solution 2 is 0.8-1.

2. 600 The OD of the p19 virus Agrobacterium solution is 0.9-1.

2. 600 It is 0.9-1.1.

Images