Preparation method and application of amide plasmalogen compound

Abstract

The invention relates to the technical field of plasmalogen, and discloses a preparation method and application of an amide plasmalogen compound, and the preparation method comprises the following steps: (1) reacting a compound 1 and a compound 2 in an HEPES buffer solution to obtain a compound 3; (2) reacting the compound 3 in an ethyl acetate phase and a water phase by using phospholipase D under the assistance of Ca < 2 + > ions to obtain a compound 4; (3) expression and purification of CarF protein from myxobacteria; and (4) reacting the compound 4 and CarF protein in a Tris-HCl buffer solution under the assistance of NADH (Nicotinamide Adenine Dinucleotide) and catalase to obtain a compound 5. According to the invention, the purified recombinant myxobacteria CarF protein and the chemically synthesized CarF protein reaction substrate are adopted to finally synthesize the amide plasmalogen, and the amide plasmalogen can show the effect similar to that of natural plasmalogen.

Description

Technical Field

[0001] The present invention relates to the technical field of plasmalogens, and in particular to a preparation method and application of an amide plasmalogen compound. Background Art

[0002] Plasmalogens are a special type of phospholipids, accounting for about 10% of the total phospholipids in cells. They are glycerophospholipids containing olefinic ether bonds, such as olefinic phosphatidylethanolamine, olefinic phosphatidylcholine, olefinic phosphatidylserine, etc. The main feature is that they contain olefinic ether bonds at the sn-1 position, and are usually connected to fatty alcohols of c16:0; 18:0 or 18:1 in mammals, and are mostly polyunsaturated fatty acids of n-3 and n-6 ​​at sn-2. Most of the olefinic phospholipids are concentrated in the "lipid raft" structure of biological membranes, participating in cell fusion, ion transport and cholesterol transport. They are abundant in organs such as the brain and heart, and can also serve as important antioxidants on the plasma membrane to prevent damage to nerve cells.

[0003] At present, the results of many studies have shown that the decrease in plasmalogens content is related to many diseases, such as Alzheimer's disease, Parkinson's disease, Zellweger syndrome, etc. Among them, Alzheimer's disease (AD) is a progressive neurodegenerative disease and the most common dementia. There is a positive correlation between the severity of Alzheimer's disease and the degree of reduction of plasmalogens. Many animal experiments and clinical experiments have also confirmed that plasmalogens can improve the learning ability and memory of patients with mild cognitive impairment, mild Alzheimer's disease and mouse models.

[0004] Plasmalogens are obtained by chemical synthesis or extraction from animal tissues. For example, the invention patent with publication number CN110621683B discloses cyclic acetal phosphatidylethanolamine and its chemical synthesis method, but the application of chemical synthesis methods is limited due to the large amount of chemicals required and the generation of potential hazardous wastes during the chemical synthesis process. Plasmalogens can also be prepared from marine animals or animal tissues, and to date, most of them still rely on lipids extracted from organisms rich in plasma hormones, but the content of plasma phospholipids in these natural materials is very low, accounting for less than 10% of the phospholipids of the tissue cell membrane used, thereby limiting its wide application. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a preparation method and application of an amide acetal phospholipid compound, by using the purified recombinant myxobacterial CarF protein and the substrate (compound 4) of the chemical synthesis of CarF protein reaction, and using alkyl phosphatidylethanolamine with a fatty acid chain to generate the corresponding acetal phosphatidylethanolamine, finally an amide acetal phospholipid is synthesized, which can show similar effects to natural acetal phospholipids.

[0006] The purpose of the present invention is achieved through the following technical solutions: In a first aspect, the present invention provides a method for preparing an amide acetal phospholipid compound, comprising the following steps: (1) Compound 1 and compound 2 are reacted in HEPES buffer to obtain compound 3; (2) Compound 3 was treated with phospholipase D in ethyl acetate phase and water phase, Ca 2+ ions to obtain compound 4; (3) Expression and purification of CarF protein from myxobacteria; (4) Compound 4 and CarF protein were reacted in Tris-HCl buffer with the assistance of NADH and catalase to obtain compound 5; The structural formula of compound 1-5 is as follows: .

[0007] Wherein, compound 1 is Dodecanoyl-AMP; Compound 2 is 1-O-hexadecyl-2-(β-Ala)-sn-glycero-3-phosphocholine, C 27 H8N2O7P,[M+H] + ; Compound 3 is 1-O-hexadecyl-2-[β-Ala-(dodecanoyl)]-sn-glycero-3-phosphocholine, C 39 H 79 N2O8PNa,[M+Na] + ; Compound 4 is 1-O-hexadecyl-2-[β-Ala-(dodecanoyl)]-sn-glycero-3-phosphoethanolamine, C 36 H 73 N2O8PNa,[M+Na] + ; Compound 5 is 1-(1-hexadecenyl)-2-[β-Ala-(dodecanoyl)]-sn-glycero-3-phosphoethanolamine, C 36 H 71 N2O8PNa,[M+Na] + .

[0008] Preferably, the preparation method of compound 1 comprises the following steps: dissolving 5'-AMP in a mixed solution of sodium hydroxide, pyridine and water to obtain a 5'-AMP solution; then adding a tetrahydrofuran solution containing dodecanoic anhydride to the 5'-AMP solution, stirring for reaction, and performing extraction and post-treatment after the reaction to obtain compound 1.

[0009] Preferably, the volume ratio of pyridine to water is 1:1; the concentration of sodium hydroxide in the mixed solution is 0.4-0.6 mM; the concentration of 5'-AMP in the 5'-AMP solution is 17-19 mg / mL; the concentration of dodecanoic anhydride in the tetrahydrofuran solution containing dodecanoic anhydride is 30-50 mg / mL; the volume ratio of the tetrahydrofuran solution containing dodecanoic anhydride to the 5'-AMP solution is 1:1; and the stirring reaction is stirred at room temperature for 20-30 min.

[0010] Preferably, the preparation method of compound 2 comprises the following steps: adding 1-O-hexadecyl-sn-glyceryl-3-phosphocholine, Bco-β-alanine, 4-dimethylaminopyridine and triethylamine to chloroform, then adding 2,4,6-trichlorobenzoyl chloride and stirring to react, adding water to remove the solvent to obtain a solid; stirring the solid and trifluoroacetic acid in dichloromethane again to react, and removing the solvent to obtain compound 2.

[0011] Preferably, the molar ratio of 1-O-hexadecyl-sn-glyceryl-3-phosphocholine, Bco-β-alanine, 4-dimethylaminopyridine, triethylamine and chloroform is 9-11:23-26:55-65:0.5-2:450; the molar ratio of 2,4,6-trichlorobenzoyl chloride and 1-O-hexadecyl-sn-glyceryl-3-phosphocholine is 1:1; the stirring reaction time is 12-15h; the ratio of the added amount of the solid and the mixed solution is 150-200mg:5mL; and the time for stirring the reaction again is 20-30min.

[0012] Preferably, in step (1), the molar ratio of compound 1 to compound 2 is 1:0.8-1.3; the reaction conditions are pH 7-8, 37° C., and stirring for 3-5 hours.

[0013] Preferably, step (2) specifically comprises the following steps: dissolving compound 3 in ethyl acetate to obtain an ethyl acetate phase; adding phospholipase D and ethanolamine to water to obtain an aqueous phase; mixing the ethyl acetate phase and the aqueous phase, and adding CaCl2 to react, and after the reaction is completed, taking the ethyl acetate phase and drying it to obtain compound 4.

[0014] Preferably, the concentration of compound 3 in the ethyl acetate phase is 2-4 mg / mL; the concentration of phospholipase D in the aqueous phase is 3-10 mg / mL; the mass ratio of phospholipase D to ethanolamine is 1:5-10; the volume ratio of the ethyl acetate phase to the aqueous phase is 1.5-3:1; the amount of CaCl2 added is such that the concentration of CaCl2 in the solution after addition is 3-10 mM; and the reaction is stirred at 30-40°C for 7-8h.

[0015] Preferably, in step (3), the expression of CarF protein comprises the following steps: culturing myxobacteria and Bacillus subtilis, extracting genomes, and amplifying CarF and Mistic target genes. Plasmids pet28a, CarF and Mistic are reacted with recombinase to obtain pet28a-Mistic-CarF recombinant plasmid. The pet28a-Mistic-CarF recombinant plasmid is co-expressed with Mistic-CarF in Escherichia coli OverExpreessC43 (DE3) cells.

[0016] Preferably, in step (3), the purification of CarF protein comprises the following steps: the Mistic molecular chaperone and CarF protein are purified by Ni 2+ CarF protein was obtained by cutting and purifying.

[0017] Preferably, in step (4), the mass ratio of the compound 4 to the CarF protein is 1:100-1000; the molar ratio of the compound 4 to NADH is 1:1-5; the mass ratio of the compound 4 to catalase is 100:1-10; the pH of the Tris-HCl buffer is 7-7.5; the reaction temperature is 30-37°C, and the reaction time is 16-24h.

[0018] In a second aspect, the present invention also provides a use of an amide acetal phospholipid compound in the manufacture of a drug for increasing the level of acetal phospholipids.

[0019] Compared with the prior art, the present invention has the following beneficial effects: the present invention uses the recombinant myxobacterial CarF protein expressed by Escherichia coli to be purified in vitro, and the protein is derived from myxobacteria ( Myxococcus xanthus)'s CarF membrane protein can utilize alkyl phosphatidylethanolamine with fatty acid chains to generate the corresponding acetal phosphatidylethanolamine, and then compound 5 (amide acetal phospholipid) is synthesized by using amine-functionalized compound 4 substrate and purified CarF membrane protein. This method can make up for the gap in the chemoenzymatic synthesis of acetal phospholipids, and has the advantages of being simple and controllable, highly efficient and energy-saving, and environmentally friendly. The synthesized acetal phospholipid has a super strong ability to scavenge reactive oxygen in neural cells and can be used in therapeutic drugs for neurological diseases, so as to prevent or improve various diseases caused by the lack of acetal phospholipids by increasing the reduced level of acetal phospholipids. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the synthetic route for synthesizing compound 1 in the present invention.

[0021] Figure 2 This is the synthetic route for synthesizing compound 4 in the present invention.

[0022] Figure 3 These are the CarF and Mistic genes used in the present invention.

[0023] Figure 4 LC-MS charts of Compound 2, Compound 3 and Compound 4 of the present invention.

[0024] Figure 5 For the purified CarF protein and Ni 2+ Cutting result diagram.

[0025] Figure 6 It is the mass spectrum of compound 5 (amide acetal phospholipid) in the present invention.

[0026] Figure 7 It is the GC-MS chart of compound 5 (amide acetal phospholipid) in the present invention.

[0027] Figure 8 These are detection diagrams of the amide phospholipids of the present invention for clearing ROS in two types of neural cells in vivo (Figure A is PC12 neuronal cells, and Figure B is BV2 microglial cells). DETAILED DESCRIPTION

[0028] The technical solution of the present invention is described below with specific embodiments, but the protection scope of the present invention is not limited thereto.

[0029] The preparation of amide acetal phospholipid compounds comprises the following steps: (1) Compound 1 and Compound 2 were added to HEPES buffer (final concentration of 100 mM), with the molar ratio of Compound 1 to Compound 2 being 1:0.8-1.3. The mixture was stirred at pH 7-8 and temperature of 37°C for 3-5 h, and the solution was removed to obtain Compound 3.

[0030] (2) Compound 3 was treated with phospholipase D in ethyl acetate phase and water phase, Ca 2+ ions, specifically: weigh compound 3, add it to ethyl acetate and dissolve it under stirring to obtain an ethyl acetate phase, and the concentration of compound 3 in the ethyl acetate phase is 2-4 mg / mL; weigh phospholipase D, add it to water, and add ethanolamine to dissolve it, the mass ratio of phospholipase D to ethanolamine is 1:5-10, and obtain an aqueous phase, and the concentration of phospholipase D in the aqueous phase is 3-10 mg / mL; mix the ethyl acetate phase and the aqueous phase at a volume ratio of 1.5-3:1, add CaCl2 solution, the concentration of CaCl2 in the solution is 3-10 mM, start stirring at 30-40°C, and react for 7-8h. After the reaction is completed, take the ethyl acetate phase and blow dry it under nitrogen to obtain compound 4.

[0031] (3) Expression and purification of CarF protein.

[0032] (4) Compound 4 and CarF protein were added to a Tris-HCl buffer at pH 7-7.5, with the mass ratio of compound 4 to CarF protein being 1:100-1000; NADH solution and catalase solution were then added, with the molar ratio of compound 4 to NADH being 1:1-5, and the mass ratio of compound 4 to catalase being 100:1-10, and the reaction was carried out at 30-37°C for 16-24h to obtain compound 5.

[0033] Wherein, the preparation of compound 1 comprises the following steps: (a) using anhydrous ether to dissolve solid dodecanoic acid to obtain a dodecanoic acid solution with a dodecanoic acid concentration of 34-36 mg / mL, then adding dropwise a dichloromethane solution containing 1M dicyclohexylcarbodiimide (DCC) (previously diluted with anhydrous ether for 10-15 minutes, the volume ratio of the dichloromethane solution containing dicyclohexylcarbodiimide to anhydrous ether is 2-3:8-10), the volume ratio of the dodecanoic acid solution to the dichloromethane solution containing 1M dicyclohexylcarbodiimide (DCC) is 14-15:2-3; the generated white suspension is continuously stirred at room temperature for 12-16 hours, and the obtained white solid is dried to obtain dodecanoic anhydride.

[0034] (b) After 5'-AMP is dissolved in a mixed solution of sodium hydroxide, pyridine and water (the volume ratio of water to pyridine is 1:1, and the concentration of sodium hydroxide in the mixed solution is 0.4-0.6 mM), a 5'-AMP solution with a concentration of 17-19 mg / mL of 5'-AMP is obtained; a tetrahydrofuran solution (THF) containing 30-50 mg / mL of dodecanoic anhydride is added to the 5'-AMP solution twice, and the volume ratio of the tetrahydrofuran solution containing dodecanoic anhydride to the 5'-AMP solution is 1:1. After the addition is completed, a white suspension is formed, and the suspension is continuously stirred at room temperature for 20-30 minutes, and the suspension becomes an almost clear solution.

[0035] (c) Post-extraction treatment: Anhydrous ether was added, the two-phase mixture was stirred vigorously, and then the upper phase was removed and the step was repeated twice. Distilled water was added, and the pH of the solution was reduced to 3-3.5 by dropwise addition of hydrochloric acid solution. Anhydrous ether was then added for extraction, and the step was repeated once. The upper layer was separated, transferred to a Buchner funnel, and washed with ether to obtain the final product, which was dried to obtain compound 1.

[0036] The preparation of compound 2 comprises the following steps: adding 1-O-hexadecyl-sn-glycero-3-phosphocholine, Bco-β-alanine (Bco-β-Ala-OH), 4-dimethylaminopyridine (DMAP) and triethylamine (Et3N) to chloroform (CHCl3), wherein the molar ratio of 1-O-hexadecyl-sn-glycero-3-phosphocholine, Bco-β-alanine, 4-dimethylaminopyridine, triethylamine and chloroform is 9-11:23-26: 55-65:0.5-2:450; then add 2,4,6-trichlorobenzoyl chloride (TCBC), the molar ratio of 2,4,6-trichlorobenzoyl chloride and 1-O-hexadecyl-sn-glyceryl-3-choline phosphate is 1:1, stir and react for 12-15h, add water to remove the solvent to obtain a solid; the solid is stirred again in a mixed solution of trifluoroacetic acid (TFA) and dichloromethane (CH2Cl2) (volume ratio of 1:1) for 20-30min, the ratio of the added amount of the solid to the mixed solution is 150-200mg:5mL, after removing the solvent, a colorless oil is obtained to obtain compound 2.

[0037] The expression of CarF protein includes the following steps: Bacterial culture: Myxobacteria and Bacillus subtilis were cultured in vitro, with the culture temperature of Myxobacteria at 30°C and that of Bacillus subtilis at 37°C; the genome was extracted, and the CarF and Mistic target genes were amplified. Plasmids pet28a, CarF and Mistic were treated with recombinase to obtain the pet28a-Mistic-CarF recombinant plasmid.

[0038] The pet28a-Mistic-CarF recombinant plasmid was co-expressed in E. coli OverExpressC43 (DE3) cells, and the cells were cultured at 37°C until OD 600 Between 0.8 and 1.0. Before induction with isopropyl-β-thiogalactoside (IPTG), the culture was placed in an ice bath for 30-40 minutes. Isopropyl-β-thiogalactoside (IPTG) was added to make the final concentration of IPTG 0.2mM to induce T7-dependent gene expression. The culture was shaken at 37°C for 4-5 hours. Finally, the bacteria were collected and washed.

[0039] Among them, the myxobacterium used in the expression of CarF protein ( Myxococcus xanthus )、Bacillus subtilis( Bacillus subtilis ) were purchased from China General Microbiological Culture Collection Center, with the accession numbers CGMCC1.3865 and CGMCC1.8886 respectively. The E. coli Overexpress C43 (DE3) and DH5α used in the expression of CarF protein were preserved in this laboratory.

[0040] The culture medium used for myxobacteria: 5g yeast powder, 1.36g CaCl2 and 0.5mg vitamin B12 are dissolved in 1L water and then sterilized in an autoclave at 121℃ for 20min.

[0041] The culture medium used for Bacillus subtilis and Escherichia coli was as follows: 10 g NaCl, 5 g yeast extract, and 10 g peptone were dissolved in 1 L water and then sterilized in an autoclave at 121°C for 20 min.

[0042] The purification of CarF protein includes the following steps: The collected bacteria were resuspended in buffer A (20 mM Tris / HCl (pH 8.0) and 150 mM NaCl) and then disrupted by sonication on ice to produce a lysate.

[0043] The cell lysate was then freed of cell debris (4000×g, 4°C, 15 min) and added to buffer A containing 1wt% dodecylphosphocholine (DPC) to dissolve the protein in the insoluble fraction for 2-3 h. Then, insoluble impurities in E. coli were removed (15,000×g, 4°C, 90 min), and the detergent DPC-soluble fraction was filtered using a syringe on a 0.45μm filter membrane. Finally, the target protein was obtained by AKTA and HisTrapHP affinity chromatography purification and washing with buffer B (20mMTris / HCl (pH8.0), 150mM NaCl, 700mM imidazole and 0.02wt% DPC).

[0044] Example 1: Preparation of Compound 1 (a) Weigh 482 mg of dodecanoic acid and dissolve it in 14 mL of anhydrous ether, and stir at room temperature for 10 min to obtain a dodecanoic acid solution. Dilute 2.4 mL of a 1M dicyclohexylcarbodiimide (DCC) solution in dichloromethane with 8 mL of ether for 12 min, and then add it dropwise to the dodecanoic acid solution. Stir the resulting white suspension at room temperature for 14 h, and dry the resulting white solid to obtain dodecanoic anhydride.

[0045] (b) 295 mg of 5'-AMP was dissolved in 16 mL of a mixed solution of sodium hydroxide, pyridine and water (the volume ratio of water to pyridine was 1:1, and the mixed solution contained 40 mg of sodium hydroxide) to obtain a 5'-AMP solution. Then, 480 mg of dodecanoic anhydride was dissolved in 16 mL of tetrahydrofuran solution and added to the 5'-AMP solution twice. After the addition was completed, a white suspension was formed, and the suspension was continuously stirred at room temperature for 20 minutes, and the suspension became a clear solution.

[0046] (c) Post-extraction treatment: Add 40 mL of anhydrous ether and stir the two-phase mixture vigorously for 5 minutes. Then, let the two phases stand and carefully remove the upper phase, and repeat the above steps twice. Next, add 7 mL of distilled water and stir, and continue to add 8 mL of hydrochloric acid solution (10 wt%) while stirring to reduce the pH to 3. Finally, add 80 mL of anhydrous ether for extraction, and repeat this step once. Finally, separate the upper layer and transfer it to a Buchner funnel, wash it with 40 mL of anhydrous ether, and dry the final product to obtain compound 1 (dodecanoic acid-AMP), as shown Figure 1 Shown is the synthetic route of compound 1.

[0047] Example 2: Preparation of Compound 2: Weigh 47.5 mg of 1-O-hexadecyl-sn-glycero-3-phosphocholine, 45.3 mg of Bco-β-alanine (Bco-β-Ala-OH), 70.2 mg of 4-dimethylaminopyridine (DMAP) and 46.7 μL of triethylamine (Et3N) in 7.5 mL of chloroform (CHCl3) and stir for 10 min, then add 97.3 μL of 2,4,6-trichlorobenzoyl chloride (TCBC) and stir for 13 h. After the time is reached, add 250 μL of double distilled water and remove the solvent to obtain a solid. Finally, the obtained solid is stirred in a mixed solution of 5 mL of trifluoroacetic acid (TFA) and dichloromethane (CH2Cl2) (the volume ratio of trifluoroacetic acid and dichloromethane is 1:1) for 25 min, and the solvent is removed to obtain a colorless oil, namely compound 2. Figure 2 The left part shows the route of synthesizing compound 2 using compound 1, such as Figure 4 Shown is the GC-MS identification result of compound 2.

[0048] Example 3: Preparation of Compound 3: 17 mg of compound 2 prepared in Example 2 and 16 mg of compound 1 prepared in Example 1 were placed in 100 mM HEPES buffer and stirred at pH 7.5 and 37°C for 3 h. After the reaction was completed, the solution was removed to obtain a white product, namely compound 3. Figure 2 The middle part shows the route for synthesizing compound 3 using compound 1 and compound 2, such as Figure 4 Shown is the GC-MS identification result of compound 3.

[0049] Example 4: Preparation of Compound 4 Weigh 3.10 mg of compound 3 obtained in Example 3 and add it to 3 mL of ethyl acetate, dissolve it under the action of a magnetic stirrer to obtain an ethyl acetate phase. Next, weigh 10 mg of phospholipase D and dissolve it in 1.5 mL of water, and add 50 mg of ethanolamine to dissolve it to obtain an aqueous phase. Then, mix the ethyl acetate phase and the aqueous phase, add 15 μL of 1.5 M CaCl2 solution, start stirring at 30°C, and stir it for 7 hours. After the reaction is completed, take the ethyl acetate phase and blow dry it under nitrogen to obtain compound 4. Figure 2 The rightmost part shows the route for synthesizing compound 4 using compound 3, such as Figure 4 Shown is the GC-MS identification result of compound 4.

[0050] Example 5: Bacterial culture and in vitro cloning of target genes (1) Bacterial culture: Myxobacterium and Bacillus subtilis were plated for activation culture. A single colony of Myxobacterium was picked and inoculated into 5 mL TGY medium (5 g yeast powder, 1.36 g CaCl2 and 0.5 mg vitamin B12 dissolved in 1 L water, then sterilized in an autoclave at 121°C for 20 min). The Myxobacterium was cultured overnight in a shaker at 30°C with a shaker speed of 220 rpm. A single colony of Bacillus subtilis was picked and inoculated into 5 mL LB medium (10 g NaCl, 5 g yeast extract, 10 g peptone dissolved in 1 L water, then sterilized in an autoclave at 121°C for 20 min). The Bacillus subtilis was cultured overnight in a shaker at 37°C with a shaker speed of 220 rpm. After overnight culture, the bacteria were collected and the genome was extracted using a bacterial genome kit.

[0051] (2) PCR amplification to obtain gene fragments: Primer 5.0 was used to design upstream and downstream primers of CarF and Mistic, respectively. The sequences are: CarF-F: ATGAAGACCCAAGAGATTGAAAAGAAGGT; CarF-R: CTACGGGCGCGTGGAGGC; mistic-F: atgttttgtacattttttgaaaaacatcaccg; mistic-R:tcattctttttctccttcttcagatact.

[0052] After the reaction was completed, the samples were loaded on 1wt% agarose gel and the products were separated by electrophoresis at 120 V constant voltage for 30 min. After staining with ethidium bromide for 20 min, the bands were observed under a gel imager. The gel image is shown in the figure below. Figure 3 As shown, the target DNA band was obtained and the target band was recovered.

[0053] (3) Construction of plasmid Pet28a-Mistic-CarF: Mistic, CarF and Pet28a obtained in step (2) were reacted at 50°C for 30 min under the action of recombinase to obtain Pet28a-Mistic-CarF plasmid.

[0054] Example 6: Expression and purification of CarF protein (1) Protein expression: E. coli Overexpress C43 (DE3) cells transformed with the Pet28a-Mistic-CarF plasmid described in Example 5 were cultured in LB medium (10 g NaCl, 5 g yeast extract, 10 g peptone dissolved in 1 L water, then sterilized in an autoclave at 121 °C for 20 min) at 37 °C until OD reached 0. 600 Between 0.8 and 1.0. Then put it in an ice bath for half an hour, then add 100 μL of 1 M isopropyl-β-thiogalactoside (IPTG) solution, induce it at 37°C for 3 hours, and finally, collect and wash the bacteria.

[0055] (2) Protein purification: The bacteria collected in step (1) were resuspended in buffer A (20mM Tris / HCl (pH8.0) and 150mM NaCl), and then ultrasonically disrupted on ice to produce a lysate. Next, the cell lysate was centrifuged at 4000×g, 4°C, and 15 min to remove cell debris. Then, buffer A containing 1wt% dodecylphosphocholine (DPC) was added to dissolve the protein in the insoluble component for 2 h, and then centrifuged at 15,000×g, 4°C, and 90 min to remove the insoluble matter. Finally, the protein was filtered through a 0.45μm filter membrane using a syringe, purified by AKTA and HisTrapHP affinity chromatography, and washed with buffer B (20mM Tris / HCl (pH 8.0), 150mM NaCl, 700mM imidazole, and 0.02wt% DPC) to obtain the target protein, such as Figure 5 As shown in A, a single Mistic-CarF protein was obtained as the product.

[0056] (3) Removal of the molecular chaperone Mistic at the SNAC cleavage site: The protein in step (2) is eluted from Ni-NTA by performing the following operations.

[0057] a. The eluted Mistic-CarF membrane protein was completely removed of imidazole using a desalting column, and the buffer was replaced 4 times with a lysis buffer (pH 8.2, containing 0.1 M HEPES, 0.1 M NaCl, 0.1 M acetone oxime, and 5 mM DPC).

[0058] b. After exchanging the buffer 4 times, measure the protein concentration to be 0.5-1.0 mg / mL. If the protein concentration is higher, use lysis buffer to dilute the protein concentration to this range.

[0059] c. Add 10 μL of 0.1 M NiCl2 solution to a 1.5 mL centrifuge tube, then add 1 mL of the above Mistic-CarF protein to the same tube and pipette several times to mix evenly.

[0060] d. Incubate the reaction at room temperature (20°C) for 24 h without shaking or vortexing.

[0061] e. After the reaction is completed, add the resulting protein solution to the concentrator again and exchange the buffer 3 times to exchange the protein into the required buffer (pH 8.0, containing 20 mM Tris and 0.15 M NaCl) and remove free Ni 2+ ,like Figure 5 As shown in B in FIG. 5 and C in FIG. 5 , a CarF protein with high purity was finally obtained.

[0062] Example 7: Preparation of Compound 5 Synthesis of compound 5: 7 mg of compound 4 (alkyl phosphatidylethanolamine) prepared in Example 4 was added to 0.5 M Tris-HCl buffer at pH = 7.2, NADH and 30 μg / mL of catalase were added to a final concentration of 20 mM, and 8 μL of the purified CarF protein in Example 6 was reacted at a reaction temperature of 37° C. for 22 h to finally obtain compound 5, as shown in Figure 6 Shown is the mass spectrum of compound 5 (amide acetal phospholipid), indicating that the present invention has successfully synthesized amide acetal phospholipid.

[0063] GC-MS analysis of compound 5: Compound 5 was freeze-dried and then derivatized with fatty acid methyl esters. The dried powder was resuspended in chloroform:methanol (2:1, v / v), to which 2,6-di-tert-butyl-4-methylphenol (BHT) was added to 0.01% to minimize oxidation.

[0064] The 2 mg resuspended solution of compound 5 was blown dry under nitrogen and acid hydrolyzed overnight at 55°C with 1 mL of benzene and 2 mL of methanol solution containing 1 wt% H2SO4. The reaction was quenched with 2 mL of 0.2 M KHCO3 solution, gently mixed with 5 mL of n-hexane containing 0.01 wt% BHT, and then centrifuged at 500 × g for 3 min. The upper hexane phase was transferred to a separate tube, the lower phase was mixed with 5 mL of n-hexane again, the upper phase was transferred, combined with the upper hexane phase of the first extraction, and dried with nitrogen.

[0065] A triple quadrupole gas chromatography-mass spectrometry analyzer (GC-MS; 7890B / 7000C, Agilent, USA) was used, with a DB-5 fused silica capillary column (30 m × 0.25 mm × 0.25 μm) as the chromatographic column; the flow rate of helium carrier gas was 1 mL / min, 1 μL of sample was loaded, the column temperature was increased from 60°C to 270°C at a rate of 6°C / min and maintained for 10 min; the injection port temperature, MSD transmission line, ion source, and quadrupole temperature were set to 250°C, 280°C, 230°C, and 150°C, respectively; the fixed electron energy was 70 eV, and the mass selective detector scanning mode was 40 to 500 m / z. Figure 7 As shown, the GC-MS results showed that compound 5 was successfully obtained.

[0066] Example 8: Evaluation of the properties of the amide plasmalogen of compound 5 The specific steps are as follows: a. Preparation of amide plasmalogen solution: Dissolve compound 5 in DMSO to prepare an amide plasmalogen solution with a concentration of 500 μg / mL for later use.

[0067] b. Prepare H2O2 solution: Prepare H2O2 solution with a concentration of 500μM and set aside.

[0068] c. Cultured cells: PC12 neuronal cells were cultured in DMEM / F-12 medium (purchased from Thermo Fisher) under standard conditions (5% CO2 / 37°C), and 1 mL insulin-transferrin-selenium (100×), 40 ng / mL dexamethasone, 10 wt% FBS, 100 U / mL penicillin, and 100 U / mL streptomycin were added during the culture process. BV2 microglial cells were also cultured in DMEM / F-12 medium under standard conditions (5% CO2 / 37°C), and 10 wt% FBS, 100 U / mL penicillin, and 100 U / mL streptomycin were added during the culture process.

[0069] d. Detection of the effect of amide plasmalogens in scavenging ROS: PC12 neuronal cells and BV2 microglial cells were induced with hydrogen peroxide for 12 hours and pretreated with AMD-pls for 12 hours, and then the intracellular ROS levels of the two cell lines were detected using a ROS detection kit (Biyuntian).

[0070] e. Evaluation of amide acetal ions: The results are as follows Figure 8 As shown, the data indicate that the amide plasmalogen (Compound 5) synthesized by the present invention has a significant scavenging effect on ROS in two different nerve cells, and has great potential for use in the treatment of neurological diseases.

[0071] The above are only preferred embodiments of the present invention, and are not intended to limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the specification of the present invention, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A method for preparing an amide acetal phospholipid compound, characterized in that: The steps include: (1) Compound 1 and compound 2 are reacted in HEPES buffer to obtain compound 3; (2) Compound 3 was treated with phospholipase D in ethyl acetate phase and water phase, Ca 2+ ions to obtain compound 4; (3) Expression and purification of CarF protein from myxobacteria; (4) Compound 4 and CarF protein were reacted in Tris-HCl buffer with the assistance of NADH and catalase to obtain compound 5; The structural formula of compound 1-5 is as follows: 。 2. The method for preparing an amide acetal phospholipid compound according to claim 1, characterized in that: The preparation method of compound 1 comprises the following steps: dissolving 5'-AMP in a mixed solution of sodium hydroxide, pyridine and water to obtain a 5'-AMP solution; adding a tetrahydrofuran solution containing dodecanoic anhydride to the 5'-AMP solution, stirring for reaction, and performing extraction and post-treatment after the reaction to obtain compound 1.

3. The method for preparing an amide acetal phospholipid compound according to claim 2, wherein The volume ratio of pyridine to water is 1:1; the concentration of sodium hydroxide in the mixed solution is 0.4-0.6 mM; the concentration of 5'-AMP in the 5'-AMP solution is 17-19 mg / mL; the concentration of dodecanoic anhydride in the tetrahydrofuran solution containing dodecanoic anhydride is 30-50 mg / mL; the volume ratio of the tetrahydrofuran solution containing dodecanoic anhydride to the 5'-AMP solution is 1:1; and the stirring reaction is stirred at room temperature for 20-30 minutes.

4. The method for preparing an amide acetal phospholipid compound according to any one of claims 1 to 3, characterized in that: The preparation method of compound 2 comprises the following steps: adding 1-O-hexadecyl-sn-glyceryl-3-phosphocholine, Bco-β-alanine, 4-dimethylaminopyridine and triethylamine into chloroform, then adding 2,4,6-trichlorobenzoyl chloride and stirring for reaction, adding water to remove the solvent to obtain a solid; stirring the solid again in a mixed solution of trifluoroacetic acid and dichloromethane for reaction, and removing the solvent to obtain compound 2.

5. The method for preparing an amide acetal phospholipid compound according to claim 4, characterized in that: The molar ratio of 1-O-hexadecyl-sn-glyceryl-3-phosphocholine, Bco-β-alanine, 4-dimethylaminopyridine, triethylamine and chloroform is 9-11:23-26:55-65:0.5-2:450; the molar ratio of 2,4,6-trichlorobenzoyl chloride and 1-O-hexadecyl-sn-glyceryl-3-phosphocholine is 1:1; the stirring reaction time is 12-15h; the ratio of the added amount of the solid and the mixed solution is 150-200mg:5mL; the stirring reaction time again is 20-30min.

6. The method for preparing an amide acetal phospholipid compound according to claim 1, wherein In step (1), the molar ratio of compound 1 to compound 2 is 1:0.8-1.3; the reaction conditions are pH 7-8, 37° C., and stirring for 3-5 hours.

7. The method for preparing an amide acetal phospholipid compound according to claim 1 or 6, characterized in that: Step (2) specifically comprises the following steps: dissolving compound 3 in ethyl acetate to obtain an ethyl acetate phase; adding phospholipase D and ethanolamine to water to obtain an aqueous phase; mixing the ethyl acetate phase and the aqueous phase, and adding CaCl2 to react. After the reaction is completed, taking the ethyl acetate phase and drying it to obtain compound 4.

8. The method for preparing an amide acetal phospholipid compound according to claim 7, wherein The concentration of compound 3 in the ethyl acetate phase is 2-4 mg / mL; the concentration of phospholipase D in the aqueous phase is 3-10 mg / mL; the mass ratio of phospholipase D to ethanolamine is 1:5-10; the volume ratio of the ethyl acetate phase to the aqueous phase is 1.5-3:1; the amount of CaCl2 added is such that the concentration of CaCl2 in the solution after addition is 3-10 mM; and the reaction is stirred at 30-40°C for 7-8h.

9. The method for preparing an amide acetal phospholipid compound according to claim 1, characterized in that: In step (4), the mass ratio of the compound 4 to the CarF protein is 1:100-1000; the molar ratio of the compound 4 to NADH is 1:1-5; the mass ratio of the compound 4 to catalase is 100:1-10; the pH of the Tris-HCl buffer is 7-7.5; the reaction temperature is 30-37°C, and the reaction time is 16-24h.

10. Use of an amide acetal phospholipid compound prepared by the preparation method according to any one of claims 1 to 9 in the manufacture of a drug for increasing the level of acetal phospholipids.

Images