Molecular marker Ta4996 of wheat thermo-sensitive stripe rust resistant gene TaEDR2-B, primer group and application

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker Ta4996 of a wheat thermo-sensitive stripe rust resistant gene TaEDR2-B, a primer group and application. The nucleotide sequence of the molecular marker Ta4996 is as shown in SEQ ID NO.1, wherein mutation from A to G exists at the 107th site from the 5'end; the nucleotide sequence of the temperature-sensitive stripe rust resistant gene TaEDR2-B of the wheat is as shown in SEQ ID NO. 2. The molecular marker provided by the invention has the characteristic of codominance, the specific primer of the marker can be used for accurately and efficiently identifying whether the stripe rust resistant wheat variety contains the temperature-sensitive stripe rust resistant gene TaEDR2-B or not, and the marker can be used in molecular marker-assisted breeding, so that the breeding selection efficiency is greatly improved.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology technology and specifically relates to a wheat temperature-sensitive stripe rust resistance gene. TaEDR2-B Molecular marker Ta4996, primer sets and applications. Background Art

[0002] Wheat is one of the most widely grown food crops in the world, providing the most basic food needs for 35% to 40% of the world's population. Puccinia striiformis West. f. sp. tritici ) is an airborne fungal disease that seriously threatens the safe production of wheat. It occurs in major wheat-producing areas around the world. The epidemic often causes a serious reduction in wheat production or even a total crop failure, posing a great threat to my country's wheat production and quality. Long-term exploration and practice have proved that planting disease-resistant varieties is the most economical and effective measure to prevent and control diseases. However, in production, due to the frequent variation of the pathogenicity of stripe rust, the promoted disease-resistant varieties continue to "lose" disease resistance. Since 1950, wheat stripe rust has caused eight major epidemics in China's major wheat-producing areas. The replacement of wheat varieties after each epidemic was caused by the variation of wheat stripe rust. So far, 34 physiological races of stripe rust (CYR1-CYR34) and multiple pathogenic groups have been identified and officially named in my country, causing most of my country's main cultivated varieties to lose resistance, which has also brought severe challenges to my country's wheat variety layout and disease-resistant breeding.

[0003] With the progress of modern biotechnology and the application of molecular marker technology, we have discovered and named a large number of stripe rust resistance genes. So far, there are 87 stripe rust resistance genes (Yr1-Yr87) that have been officially named, and there are many temporary stripe rust resistance genes or QTL genetic loci. Since different breeding units in different regions use the same type of resistance source or a single stripe rust resistance gene in large quantities at the same time, the large-scale promotion of new varieties has caused strong selection pressure on stripe rust, which is conducive to the generation and prevalence of new toxic subspecies of stripe rust and becomes a dominant subspecies, overcoming the resistance of stripe rust resistance genes, and ultimately causing the variety to lose disease resistance. Therefore, it is urgent to explore and utilize new disease resistance gene resources from common wheat materials to further broaden the genetic basis of disease-resistant breeding materials. The common wheat variety Aikang 58 is a comprehensive resistance variety that is currently well used in production practice. Previous studies have found that it carries the stripe rust resistance genes Yr5b, YrAK58.1 (Yr6), TaEDR2-B (Yr52), and YrAK58.3 (YrZH84). Among them, Yr5b located on chromosome 2BL has good resistance to physiological race CYR32, and Yr6 and TaEDR2-B located on chromosome 7BL have good resistance to physiological race CYR34.

[0004] In the field of wheat stripe rust resistance gene localization and function research, molecular marker technology has always been an important research method. Molecular markers can be used to assist in the breeding of wheat stripe rust resistant varieties. At present, most molecular markers are traditional SSR markers and AFLP markers, etc. At present, these molecular markers of the same type still have many problems in practical application or their own characteristics. For example, some molecular markers are not specific enough, and false positive or false negative results are prone to occur in different wheat varieties or genetic backgrounds, leading to misjudgment of wheat stripe rust resistance. The detection process of some traditional molecular markers is cumbersome and requires expensive instruments and professional technicians to operate, which greatly increases the detection cost and time cost, and limits its promotion and application in large-scale breeding practice. KASP (Kompetitive Allele Specific PCR) molecular markers are a new SNP detection method based on PCR technology. Its technology can solve the problems of molecular markers of the same type as SSR markers and AFLP markers. At the same time, it can be used for large-scale genotyping research and is also suitable for the detection of a small number of samples. It has strong flexibility; the cost is low, and KASP technology does not require the use of expensive special instruments, and only requires ordinary fluorescent quantitative PCR instruments for detection. At the same time, its reaction system is relatively simple, the reagent cost is low, the primer design and synthesis cost is not high, and the overall experimental cost is relatively low, which has obvious advantages in large-scale sample detection. Therefore, it is urgent to develop corresponding KASP molecular markers related to wheat stripe rust resistance genes.

[0005] At present, there are few targeted studies on the thermosensitive stripe rust resistance of wheat by existing KASP molecular markers, which cannot meet the actual needs. Therefore, it is necessary to develop new KASP molecular markers for the thermosensitive stripe rust resistance of wheat. Summary of the invention

[0006] In order to develop a new KASP molecular marker for the temperature-sensitive stripe rust resistance of wheat, the present invention provides a wheat temperature-sensitive stripe rust resistance gene TaEDR2-B The molecular marker Ta4996, primer set and application thereof. The molecular marker Ta4996 can be used to identify the wheat temperature-sensitive stripe rust resistance gene TaEDR2-B To achieve the above purpose, the present invention adopts the following technical solution.

[0007] The purpose of the present invention is to develop a new KASP molecular marker for the temperature-sensitive stripe rust resistance of wheat, and to provide a wheat temperature-sensitive stripe rust resistance gene. TaEDR2-B The molecular marker Ta4996, the nucleotide sequence of which is shown in SEQ ID NO. 1, wherein there is a mutation from A to G at position 107 from the 5' end.

[0008] 0-AGAGGAAGAAGAGGAGGAGGATAATCACCGATCATTGATGCGGAGAACAACAATTGGGAATGGTCCTCCGGAATCATTGCATGATTGGACTCGTGGAAATGATACG[A / G]GAATATCTGATCAGGGAAGCCCTGCCCAAGTTTTCTCTAGAGGACACTGGCGCCTTGTCAGATGCCAGAATGGTCTCCGCATTTTTGAGGAGCTCCAAGATGTTGAT-3', wherein [A / G] A is the mutation site and G is the site after mutation.

[0009] The molecular marker Ta4996 provided by the present invention can be used to identify the wheat temperature-sensitive stripe rust resistance gene TaEDR2-B Accurate prediction of wheat temperature-sensitive stripe rust resistance genes TaEDR2-B The cloning of this gene is of great significance, as it can solve the problem that the existing molecular markers have little targeted research on the thermosensitive stripe rust resistance of wheat and cannot meet actual needs.

[0010] Preferably, the molecular marker Ta4996 is used to detect the wheat temperature-sensitive stripe rust resistance gene TaEDR2-B.

[0011] The wheat temperature-sensitive stripe rust resistance gene TaEDR2-B The nucleotide sequence is shown in SEQ ID NO.2.

[0012] The present invention also provides a primer set for amplifying the molecular marker Ta4996, comprising a forward primer 1, a forward primer 2 and a reverse primer 3.

[0013] The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO.3.

[0014] The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO.4.

[0015] The nucleotide sequence of the reverse primer 3 is shown in SEQ ID NO.5.

[0016] Preferably, fluorescent label sequences are added to the 5' ends of the forward primer 1 and the forward primer 2, respectively.

[0017] Preferably, the nucleotide sequence of the forward primer 1 after adding the fluorescent label sequence is as shown in SEQ ID NO.6; the nucleotide sequence of the forward primer 2 after adding the fluorescent label sequence is as shown in SEQ ID NO.7.

[0018] The present invention also provides the use of the molecular marker Ta4996 or the primer set in wheat assisted breeding.

[0019] Preferably, the molecular marker Ta4996 or the primer set is used to prepare a product for assisting wheat breeding.

[0020] The present invention also provides the molecular marker Ta4996 or the primer set for detecting the wheat temperature-sensitive stripe rust resistance gene. TaEDR2-B Application in.

[0021] Preferably, the molecular marker Ta4996 or the primer set is used to prepare a gene for detecting the temperature-sensitive stripe rust resistance gene in wheat. TaEDR2-B products.

[0022] Preferably, the detection of wheat temperature-sensitive stripe rust resistance gene TaEDR2-B The steps are as follows: Extract the genomic DNA of the wheat to be tested.

[0023] The genomic DNA of the wheat to be tested is used as a template and the primer set is used for PCR amplification.

[0024] The PCR amplification product is subjected to typing detection.

[0025] The primer set is used to determine the genotype of the SNP site of the molecular marker Ta4996.

[0026] Judgment result: If the genotype is homozygous "CC" or heterozygous "CT", the wheat to be tested is a candidate wheat with stripe rust resistance; if the genotype is homozygous "TT", the wheat to be tested is a candidate wheat with stripe rust susceptibility.

[0027] Preferably, the reaction system for PCR amplification is: 2 μL of HiGeno 2×Probe Mix B, 0.0448 μL of primer mixture solution, 50 mg~100 ng of DNA template, 6 μL of ddH2O; the forward primer concentration is 12 mmol / L, and the reverse primer concentration is 30 mmol / L.

[0028] The primer mixture solution is: Ta4996-A 0.012μL+Ta4996-B 0.012μL+Ta4996-C 0.024μL.

[0029] Preferably, the reaction procedure of the PCR amplification is: 94°C for 15 min; 94°C for 20 s; 61°C-55°C for 1 min, with the temperature decreasing by 0.6°C in each cycle, for 10 cycles; 94°C for 20 s, 55°C for 60 s, for 30 cycles.

[0030] The present invention targets the TaEDR2-B (Yr52) locus, and through fine positioning and further gene annotation analysis, it is found that the interval contains 5 disease resistance genes, among which TraesAK58CH7B01G499600 encodes the Protein ENHANCEDDISEASERESISTANCE 2 gene, and during the stripe rust infection process, the gene is highly expressed, and it is speculated to be an important candidate gene. According to the gene naming rules, it is named TaE DR2-B. Based on the difference sequence between the gene in the parents Avocet S and the dwarf resistance 58, the corresponding KASP gene functional marker was developed, and the KASP molecular detection was carried out in the natural population material, and it was found that its presence can significantly improve the resistance of wheat to stripe rust, thereby reducing the damage of stripe rust in the whole growth and development process of wheat. At the same time, it also has huge potential application value for improving the stripe rust resistance of wheat seedlings in the future. Therefore, the development of molecular markers of the stripe rust resistance gene is of great significance to the molecular assisted polymerization breeding of multiple disease resistance genes.

[0031] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention provides a wheat temperature-sensitive stripe rust resistance gene TaEDR2-B Molecular marker Ta4996 can accurately predict the wheat temperature-sensitive stripe rust resistance gene TaEDR2-B , for the subsequent wheat temperature-sensitive stripe rust resistance gene TaEDR2-B The cloning of this gene is of great significance, as it can solve the problem that the existing molecular markers have little targeted research on the thermosensitive stripe rust resistance of wheat and cannot meet actual needs.

[0032] 2. The present invention provides a primer set for amplifying the molecular marker Ta4996. The molecular marker Ta4996 and its primer set can be rapidly and high-throughput applied to molecular-assisted breeding for wheat variety improvement, thereby accelerating the wheat breeding process at the whole genome level. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The scatter plot is amplification typing of the primer set of molecular marker Ta4996 in Example 2 of the present invention for the disease-resistant parent, the disease-susceptible parent, and 388 wheat varieties; wherein, Figure 1 Figure a in the figure is a scatter plot of amplification typing of the primer set of molecular marker Ta4996 for the disease-resistant parent, the disease-susceptible parent, and 388 wheat varieties; Figure 1 Figure b is a box plot of disease response types; among them, FAM is on the X-axis, HEX is on the Y-axis, ÷÷ represents the same typing as the resistant parent, -- represents the same typing as the susceptible parent, and ÷- represents the heterozygous type.

[0034] Figure 2The genetic linkage map constructed by the 660K chip and the SNP markers in the candidate genes and the position map of the SNP markers in the genetic linkage map in Example 1 of the present invention; wherein, Figure 2 a in the figure is the rough localization map of YrAK58.2 (TaEDR2-B); Figure 2 b in the figure is the fine positioning map of YrAK58.2 (TaEDR2-B); Figure 2 Figure c is the genetic integration map of chromosome 7BL where YrAK58.2 (TaEDR2-B) is located, among which I, II, and III are three different disease resistance hotspot enrichment areas. DETAILED DESCRIPTION

[0035] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0036] The test materials and their preparation used in the embodiments of the present invention are as follows: The wheat material used in the embodiment of the present invention is common wheat, specifically the dwarf resistant 58 material and its derivative varieties bred by the Wheat Breeding Center of Henan Institute of Science and Technology.

[0037] The stripe rust in the present invention may specifically be the stripe rust caused by the currently popular stripe rust fungi races CYR32, CYR33 and CYR34.

[0038] Example 1: Wheat temperature-sensitive stripe rust resistance gene TaEDR2-B Acquisition of molecular markers 1. Construction of genetic population and genetic analysis (1) Wheat materials for testing The parents used in genetic population construction were Aikang 58 and Avocet S.

[0039] Among them, the disease-resistant parent, Aikang 58, was bred by the Wheat Breeding Center of Henan Institute of Science and Technology and has seedling resistance to the current popular stripe rust race CYR34. The susceptible parent is the Australian susceptible variety Avocet S (AvS), with Avocet S (AvS) as the female parent. The disease-resistant variety Aikang 58 was used as the male parent to cross to obtain F1, and F1 was self-pollinated to obtain F2. F2 single plants were continuously self-pollinated using the "single seed transmission" method to obtain a recombinant inbred line population (recombinant inbred line, RIL) for genetic analysis and gene positioning.

[0040] Common wheat Xiaoyan 22 is a cultivated variety and can be obtained from the National Crop Germplasm Resource Bank as a susceptible control.

[0041] (2) Phenotypic evaluation and phenotypic data analysis of the test population The steps and methods for seedling resistance identification are as follows: the parents, susceptible controls and 133 F6RILs were sown in the greenhouse of the Institute of Plant Pathology, Northwest Agriculture and Forestry University. They were planted in a 10cm×10cm×10cm plastic square box filled with substrate. For the parents and RIL families, 8 seeds of each material were planted in the four corners of the square pot (the materials in the four corners should be concentrated as much as possible during sowing to avoid the situation where it is difficult to distinguish which parent or family each seedling belongs to after the wheat seedlings grow up, which is not conducive to the identification of stripe rust in the seedling stage). When the wheat seedlings grow to the second leaf fully extended (usually about 15 days), the powder shaking method (the stripe rust species are inoculated according to the volume ratio of CYR34: talcum powder ≈ 1:50) was used (to ensure that the first and second leaves of the seedlings are fully shaken). After inoculation, the wheat seedlings were placed at 9℃~11℃ and 100% relative humidity, protected from light and moisturized for 24 hours, and then cultured in a greenhouse with a day and night temperature cycle of 18℃ / 11℃, a light intensity of 20,000lx, a light-dark cycle of 16h / 8h, and a relative humidity of about 80%. After the susceptible control became fully diseased (18 days after inoculation), the reaction types of AvS, dwarf 58 and the offspring genetic populations were recorded. The reading of infection type (IT) refers to the 9-level judgment standard of Line and Qayoum (1991), among which the reaction type 0~6 is disease-resistant type (R), and the reaction type 7~9 is susceptible type (S) (Line, RF, and Qayoum, A.1991.Virulence, aggressiveness, evolution, and distribution of races of Pucciniastriiformis (the cause of stripe rust of wheat)in North America, 1968-87. USDep. Agric. Tech. Bull. No.1788.). Surveys were conducted every 3 days, and the highest reaction type was used as the final identification result based on the survey data. According to the reaction type of the parent and offspring groups, the χ2 matrix was used in Excel to calculate the final result. 2 The method was used to conduct suitability testing on the separation ratios obtained in the survey, determine the most suitable separation ratio, clarify the number of genes, interaction modes and disease resistance characteristics of the test varieties to specific stripe rust races, and then clarify the number of stripe rust resistance genes and their relationships.

[0042] The result is: the ratio of disease-resistant strains to susceptible strains in the offspring population is 78:49 (not in compliance with the 1:1 ratio, P =0.011), indicating that seedling resistance is not controlled by one pair of genes, but by two or more pairs of genes.

[0043] 2. Genetic map construction and stripe rust resistance genes TaEDR2-B Localization and cloning of candidate genes (1) Bulked segregant analysis (BSA) combined with wheat microarray analysis When wheat grows to the 3-leaf stage, the 3rd leaf of each parent and individual plant / family is collected, and DNA is extracted using the CTAB method. According to the stripe rust resistance segregation characteristics of the F2 progeny population of AvS×AK58 and the RIL family of AvS×AK58, the cluster segregation analysis method was used to select 10 extremely resistant individual plants / families and 10 extremely susceptible individual plants / families, respectively, and extract equal amounts of DNA to construct two groups of resistance and susceptible pools. After quality inspection, the constructed resistance and susceptible pools and parents were sent to Beijing Bio Biotechnology Co., Ltd. for genotyping using the wheat 660K SNP chip. Based on the chromosome where the number of differential SNPs is located and the degree of concentration on the chromosome, the location of the QTL locus was preliminarily determined, and then the polymorphic KASP marker was developed, the RIL population was genotyped, and the genetic map was drawn using the IciMapping software. A new stripe rust resistance gene was located in this population, named TaEDR2-B . TaEDR2-B Wheat temperature-sensitive stripe rust resistance gene TaEDR2-B , hereinafter referred to as TaEDR2-B The nucleotide sequence of its molecular marker Ta4996 is shown in SEQ ID NO. 1:

[0044] 5'-AGAGGAAGAAGAGGAGGAGGATAATCACCGATCATTGATGCGGAGAACAACAATTGGGAATGGTCCTCCGGAATCATTGCATGATTGGACTCGTGGAAATGATACG[A / G]GAATATCTGATCAGGGAAGCCCTGCCCAAGTTTTCTCTAGAGGACACTGGCGCCTTGTCAGATGCCAGAAATGTCTCCGCATTTTTGAGGAGCTCCAAGATGTTGAT-3'.

[0045] (2) TaEDR2-B Fine mapping and candidate gene cloning The remaining heterozygous population was further used to carry out fine mapping of the locus. YrAK58.2The remaining heterozygous families AAKHIF10, AAKHIF23, AAKHIF52 and AAKHIF81 were self-pollinated to create F2 secondary segregation populations. About 200 F2 plants were selected as the basic segregation population for each heterozygous line. According to the phenotype and segregation of the F2 plants, the population whose target trait was controlled by a single gene (resistance:susceptibility segregation ratio was 3:1) was screened for preliminary positioning and fine positioning. The F2 segregation population required for fine positioning was more than 5,000 plants, which were composed of F2 or F 2:3 The derived population composition was determined by using the F 2:3 Based on the identification results in multiple environments, families with extreme phenotypes were selected to construct a disease-resistant / susceptible mixed pool: 30 susceptible families (genotype yrAK58.2 / yrAK58.2 , i.e. recessive homozygous), to construct a susceptible homozygous pool; 30 dominant homozygous disease-resistant families (genotype YrAK58.2 / YrAK58.2 ) to construct a disease-resistant mixed pool. The two mixed pools and the two parents were genotyped by wheat 660K SNP chip and sequenced by RNA-Seq. In addition, the genome of each parent of the isolated population was resequenced at 10×. The specific operations are as follows:

[0046] 1) For SNP chip typing data: After mining the differential SNPs between the resistance and susceptible pools, obtain the chromosome distribution and genetic and physical location information of the differential SNP sites based on the reference integrated genetic map and physical map. Use the Perl language program to calculate and count the number of differential SNPs contained in each megabase pair (Mb) or each genetic distance centimole (cM) to understand the enrichment of SNP distribution on the chromosome, so as to determine the possible range of the target gene; 2) For RNA-Seq data, align the sequencing data to the Chinese Spring reference genome sequence and perform SNP calling and calculate the index value of the SNP site (the proportion of a certain genotype to the total genotype). In most areas of the genome, due to the free combination of genes, the above Index value is about 0.5; in the gene region that controls the target trait, there will be significant differences in the Index values ​​of the two extreme mixed pools, which can quickly complete the preliminary positioning and roughly lock the target gene in a certain interval on the chromosome, which is locked in the 690Mb~750Mb interval of the 7BL chromosome; 3) Since the genome of one of the parents, Dwarf Anti-58, has basically completed assembly and splicing, the resequencing data of other parents can be compared with it, and the Chinese Spring genome will also be referenced during the period to explore more DNA variation information.

[0047] Based on the positioning intervals of the above methods, SNP-based KASP molecular markers or InDel markers based on small fragment insertions and deletions were developed, and F 2:3Separate the population for genotyping. 2:3 After separating the phenotypic and genotypic data of the population under multiple environments, the data were analyzed using two methods: qualitative traits and quantitative traits. For qualitative traits, Joinmap software was used to combine phenotypes and genotypes according to the Kosambi function to calculate the recombination exchange rate and draw a linkage map. For quantitative traits, the inclusive composite interval mapping (ICIM) method was used and QTLIciMapping V4.1 software was selected for QTL positioning. Finally, the results of the two methods were combined to verify the positioning interval. After determining that the target gene interval is in the range of 710Mb~720Mb of the Chinese Spring reference genome, appropriate flanking markers at both ends were selected such as AX-111521000 and AX-108746141 Key recombinants were screened in the F2 population, and the genotypes and phenotypes of these key recombinants were analyzed and confirmed, combined with the newly developed molecular markers in the fine positioning process, to establish marker and phenotype (corresponding YrAK58.2 The linkage relationship between the dominant homozygous and heterozygous materials is determined by whether the offspring phenotypes are separated) and the closer flanking markers are determined. Finally, the target interval is locked in AX-108892862 and AX-109545885 The corresponding interval of chromosome 7B in the Chinese Spring reference genome v.2.1 is 729.732Mb~730.681Mb, and the corresponding interval of the dwarf 58 genome is 731.153Mb~732.309Mb. According to the Chinese Spring gene annotation and transcription expression results, only 7 high-confidence genes are expressed, which are TraesCS7B03G1231400.1, TraesCS7B03G1236800.1, TraesCS7B03G1238300.1, TraesCS7B03G1238700.1, TraesCS7B03G1238900.1, TraesCS7B03G1239600.1 and TraesCS7B03G1239800.1 , respectively annotated Glyoxylate reductase / hydroxypyruvate reductase, Protein ENHANCED DISEASE RESISTANCE 2, receptorkinase 1, Chalcone synthase, Receptor-like protein kinase, receptor kinase 1, and Disease resistance protein RPM1. Based on the results of the differences in parental resequencing and the degree of association with the phenotype, it was preliminarily determined that TraesCS7B03G1236800 It is an important candidate gene. The corresponding dwarf 58 genome ID number is TraesAK58CH7B01G499600 , whose nucleotide sequence is shown in SEQ ID NO.2:

[0048] TCATTGGTCGCCCTTACTG

[0049] Based on the sequence differences of the gene in the resistant and susceptible materials, the molecular marker of the gene was developed and designed using Primer 5.0 software Ta4996 , and its robustness was verified in subsequent recombinant strains.

[0050] YrAK58.2 The result of coarse positioning is as follows Figure 2 Figure a in .

[0051] YrAK58.2 The results of fine positioning are as follows Figure 2 Figure b in .

[0052] Depend on Figure 2 As shown in Figure b, Ta4996 Marking and YrAK58.2 The phenotypes co-segregated.

[0053] Example 2: Wheat temperature-sensitive stripe rust resistance gene TaEDR2-B Feasibility verification of molecular markers The invention is to modify the wheat temperature-sensitive stripe rust resistance gene TaEDR2-B Candidate genes TraesAK58CH7B01G499600 The functional molecular marker Ta4996 (hereinafter referred to as Ta4996) and its dedicated primer set were used for feasibility verification and the following studies were conducted: 1. Molecular detection of stripe rust resistance genes in 388 wheat cultivars Methods: The primer set Ta4996 was used to detect stripe rust resistance genes in 388 wheat cultivars.

[0054] The primer set of Ta4996 was used to detect 388 samples of the tested varieties using the method of Example 1. The DNA concentration was 100 ng / μL of the template solution. The detection steps were as follows:

[0055] Extract the genomic DNA of the wheat to be tested.

[0056] The wheat genomic DNA is used as a template and the primer set is used for PCR amplification.

[0057] The PCR amplification product is subjected to typing detection.

[0058] The primer set is used to determine the genotype of the SNP site of the molecular marker Ta4996.

[0059] Judgment result: If the genotype of the target SNP containing the marker is "CC" homozygous or "CT" heterozygous, the wheat to be tested is a candidate wheat with stripe rust resistance; if the genotype of the target SNP containing the marker is "TT" homozygous, the wheat to be tested is a candidate wheat with stripe rust susceptibility. The result is as follows: Figure 1Figure a in .

[0060] Among them, the primer set of Ta4996 is as follows: The primer set for Ta4996 is as follows: The nucleotide sequence of forward primer 1: Ta4996A is shown in SEQ ID NO. 3: 5'-GGCTTCCTGATCAGATATTCT-3''.

[0061] The nucleotide sequence of forward primer 2: Ta4996B is shown in SEQ ID NO. 4: 5'-GGCTTCCTGATCAGATATTCC-3'.

[0062] Reverse primer 3: The nucleotide sequence of Ta4996C is shown in SEQ ID NO. 5: 5'-GCATGATTGGACTCGTGGAAAT-3'.

[0063] Wherein, a fluorescent label sequence and a FAM probe sequence are added to the 5' end of the forward primer 1.

[0064] The nucleotide sequence of the forward primer 1 after adding the sequence of the fluorescent label is shown in SEQ ID NO.6: 5'- gaaggtgaccaagttcatgctGGCTTCCCTGATCAGATATTCT-3'.

[0065] A fluorescent tag sequence and a HEX probe sequence were added to the 5' end of the forward primer 2.

[0066] The nucleotide sequence of the forward primer 2 after adding the fluorescent tag sequence is shown in SEQ ID NO.7: 5'-gaaggtcggagtcaacggattGGCTTCCCTGATCAGATATTCC-3'.

[0067] Depend on Figure 1 As shown in Figure a, Ta4996 can amplify the "CC" homozygous type in the disease-resistant parent, and all "CC" homozygous types or "AC" heterozygous types are possible target gene materials. Figure 1 As shown in Figure b, the resistance of the "CC" homozygous material, i.e., the material containing the target gene, in the adult stage is better than that of the "AA" homozygous material. This indicates that the molecular marker Ta4996 can be used to detect wheat resistance to stripe rust.

[0068] The genotypes and stripe rust phenotypes of 388 wheat cultivars detected by the Ta4996 primer set are shown in Table 1 .

[0069] Table 1 Genotypes and stripe rust phenotypes of 388 wheat cultivars detected by the Ta4996 primer set As shown in Table 1, Ta4996 can amplify "CC" homozygous and "AA" homozygous in disease-resistant / susceptible parents respectively. All "CC" homozygous or "AC" heterozygous are materials that may carry the target gene, and their stripe rust resistance phenotype, i.e., the values ​​of the reaction type, are generally smaller than those of the "AA" homozygous materials (without the target gene), indicating that they have good resistance in the adult stage. This shows that the molecular marker Ta4996 can be used to detect wheat stripe rust resistance.

[0070] The above experimental results show that Ta4996, as a functional molecular marker of the candidate gene TaEDR2-B, co-segregates with the stripe rust resistance phenotype in a large genetic population (more than 5000 F2 generations), indicating that the marker is closely linked to the target gene or is the functional marker of the target gene, which is different from previous markers such as Xgwm577 and Xbarc32 Compared with (see Figure 2 c in the figure), its genetic distance is closer to the target gene, which means it is less likely to undergo recombination, further ensuring the accuracy of the marker for detection; in addition, as a high-throughput KASP molecular marker, another advantage of molecular marker Ta4996 is that it can detect large samples quickly and efficiently, and its operation is simple and easy, ensuring the timeliness of field selection, which traditional SSR markers cannot achieve.

[0071] It should be noted that when the present invention involves a numerical range, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0072] Although preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they understand the basic inventive concepts, and all such changes and modifications fall within the scope of the present invention.

Claims

1. A wheat temperature-sensitive stripe rust resistance gene TaEDR2-B The molecular marker Ta4996 is characterized by: The nucleotide sequence of the molecular marker Ta4996 is shown in SEQ ID NO. 1, wherein there is a mutation from A to G at position 107 from the 5' end.

2. The molecular marker Ta4996 according to claim 1, characterized in that: The molecular marker Ta4996 is used to detect the wheat temperature-sensitive stripe rust resistance gene TaEDR2-B ; The wheat temperature-sensitive stripe rust resistance gene TaEDR2-B The nucleotide sequence is shown in SEQ ID NO.

2.

3. A primer set for amplifying the molecular marker Ta4996 according to claim 1, characterized in that: comprising forward primer 1, forward primer 2 and reverse primer 3; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 3; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO. 4; The nucleotide sequence of the reverse primer 3 is shown in SEQ ID NO.

5.

4. The primer set according to claim 3, characterized in that: Fluorescent label sequences are added to the 5' ends of the forward primer 1 and the forward primer 2, respectively.

5. The primer set according to claim 4, characterized in that: The nucleotide sequence of the forward primer 1 after adding the fluorescent label sequence is shown as SEQ ID NO.6; the nucleotide sequence of the forward primer 2 after adding the fluorescent label sequence is shown as SEQ ID NO.

7.

6. Use of the molecular marker Ta4996 described in claim 1 or the primer set described in claim 3 in wheat assisted breeding.

7. The use according to claim 6, characterized in that: The molecular marker Ta4996 or the primer set is used to prepare a product to assist wheat breeding.

8. The molecular marker Ta4996 according to claim 1 or the primer set according to claim 3 is used to detect the temperature-sensitive stripe rust resistance gene in wheat TaEDR2-B Application in.

9. The use according to claim 8, characterized in that: The molecular marker Ta4996 or the primer set is used to prepare a method for detecting the temperature-sensitive stripe rust resistance gene in wheat TaEDR2-B products.

10. The use according to claim 8, characterized in that: Detection of temperature-sensitive stripe rust resistance genes in wheat TaEDR2-B The steps are as follows: Extracting genomic DNA of wheat to be tested; Using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using the primer set; Performing typing detection on the PCR amplification product; Using the primer set to determine the genotype of the SNP site of the molecular marker Ta4996; Judgment result: If the genotype is "CC" homozygous or "CT" heterozygous, the wheat to be tested is a candidate wheat with stripe rust resistance; if the genotype is "TT" homozygous, the wheat to be tested is a candidate wheat with stripe rust susceptibility.

Images