Transgene box

Abstract

The present invention relates to a polynucleotide comprising at least one miR-124 target sequence, and / or at least one miR-338-3p target sequence, and / or at least one miR-31 target sequence wherein the miRNA target sequence is operably linked to a transgene.

Description

Field of the Invention

[0001] The present invention relates to transgenic cassettes and polynucleotides for treating diseases or disorders. The polynucleotides of the present invention can promote cell-specific transgenic expression to improve target specificity and safety. Background of the Invention

[0003] Gene therapy involves the incorporation of genetic material into cells to treat or prevent disease. The genetic material can replenish defective genes with functional copies of those genes, inactivate genes that are not functioning properly, silence genes that may be associated with a disease state, or introduce new therapeutic genes into cells.

[0004] One limitation of gene therapy is the ability to selectively determine whether a transgene is expressed within the cells to which it is delivered. There continues to be a need for transgene expression cassettes that provide cell type-specific transgene expression to reduce off-target effects associated with transgene expression, which in turn could improve the specificity and safety of any such gene therapy. Summary of the invention

[0005] Herein, the inventors provide polynucleotides (e.g., transgenic expression cassettes) that utilize miRNA target sequences to regulate transgenic expression. The expression cassettes allow for regulation of transgenic expression such that unwanted expression is reduced or eliminated, thereby improving safety and reducing off-target effects. The inventors have demonstrated the efficacy of their method using a range of transgenics such as GFP and epigenetic silencing factors (ESFs; engineered oncogenic transcription factors and cancer-associated transcription factors as epigenetic suppressors).

[0006] In a first aspect, polynucleotides are provided that comprise at least one miR-124 target sequence, and / or at least one miR-338-3p target sequence, and / or at least one miR-31 target sequence, wherein the miRNA target sequence is operably linked to a transgene.

[0007] In one embodiment, the polynucleotide comprises at least one miR-124 target sequence, wherein the target sequence is operably linked to a transgene.

[0008] In one embodiment, the polynucleotide comprises at least one miR-338-3p target sequence, wherein the target sequence is operably linked to a transgene.

[0009] In one embodiment, the polynucleotide comprises at least one miR-31 target sequence, wherein the target sequence is operably linked to a transgene.

[0010] In one embodiment, the polynucleotide comprises at least one miR-124 target sequence and at least one miR-338-3p target sequence, wherein the target sequences are operably linked to a transgene.

[0011] In one embodiment, the polynucleotide comprises at least one miR-124 target sequence and at least one miR-31 target sequence, wherein the target sequences are operably linked to a transgene.

[0012] In one embodiment, the polynucleotide comprises at least one miR-338-3p target sequence and at least one miR-31 target sequence, wherein the target sequences are operably linked to a transgene.

[0013] In one embodiment, the polynucleotide comprises at least one miR-124 target sequence, at least one miR-338-3p target sequence, and at least one miR-31 target sequence, wherein the target sequences are operably linked to a transgene.

[0014] In one aspect, polynucleotides are provided that comprise at least one miR-124 target sequence, at least one miR-338-3p target sequence, and at least one miR-31 target sequence, wherein the miRNA target sequences are operably linked to a transgene.

[0015] In one embodiment, the number of copies of each of the miRNA target sequences is independently selected from the group consisting of: 1, 2, 3, and 4.

[0016] In one embodiment, the polynucleotide comprises four miR-124 target sequences, four miR-338-3p target sequences, and four miR-31 target sequences, wherein the miRNA target sequences are operably linked to a transgene.

[0017] In one embodiment:

[0018] (a) the miR-124 target sequence comprises, or consists of, a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity;

[0019] (b) the miR-338-3p target sequence comprises, or consists of, a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity; and / or

[0020] (c) the miR-31 target sequence comprises, or consists of, a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:3, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity.

[0021] In one embodiment, the miR-124 target sequence comprises a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 1, or consists of it. In one embodiment, the miR-338-3p target sequence comprises a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2, or consists of it. In one embodiment, the miR-31 target sequence comprises a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 3, or consists of it.

[0022] In one embodiment:

[0023] (a) the miR-124 target sequence comprises, or consists of, a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1;

[0024] (b) the miR-338-3p target sequence comprises, or consists of, a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; and / or

[0025] (c) the miR-31 target sequence comprises, or consists of, a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:3.

[0026] In one embodiment:

[0027] (a) the miR-124 target sequence comprises, or consists of, a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 1;

[0028] (b) the miR-338-3p target sequence comprises, or consists of, a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 2; and / or

[0029] (c) the miR-31 target sequence comprises, or consists of, a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:3.

[0030] In one embodiment:

[0031] (a) the miR-124 target sequence comprises, or consists of, a nucleotide sequence having at least 99% sequence identity to SEQ ID NO: 1;

[0032] (b) the miR-338-3p target sequence comprises, or consists of, a nucleotide sequence having at least 99% sequence identity to SEQ ID NO: 2; and / or

[0033] (c) the miR-31 target sequence comprises, or consists of, a nucleotide sequence having at least 99% sequence identity to SEQ ID NO:3.

[0034] In one embodiment:

[0035] (a) the miR-124 target sequence comprises or consists of a nucleotide sequence having 100% sequence identity to SEQ ID NO: 1;

[0036] (b) the miR-338-3p target sequence comprises or consists of a nucleotide sequence having 100% sequence identity to SEQ ID NO: 2; and / or

[0037] (c) The miR-31 target sequence comprises or consists of a nucleotide sequence having 100% sequence identity to SEQ ID NO:3.

[0038] In one embodiment, the miRNA target sequence is located downstream, ie, 3', of the transgene. In other words, the miRNA target sequence can be located after the transgene in the 5' to 3' direction.

[0039] In one embodiment, the miRNA target sequence is located within the 3'-UTR of the transgene.

[0040] In one embodiment, the miRNA target sequence or the cluster of copies of the miRNA target sequence is arranged from 5' to 3' in the following order: one or more miR-124 target sequences, one or more miR-338-3p target sequences and one or more miR-31 target sequences. The target sequence or the cluster comprising one or more copies thereof can be arranged, for example, from 5' to 3', so that they form a group according to their target specificity, for example, in one embodiment, the polynucleotide comprises 5'-[miR-124 target sequence]4-[miR-338-3p target sequence]4-[miR-31 target sequence]4-3'.

[0041] Both individual target sequences and clusters of target sequences can be adjacent to each other, separated by spacer sequences, or any combination thereof.

[0042] Thus, in one embodiment, the miRNA target sequence is separated by a spacer sequence.

[0043] In one embodiment, a polynucleotide is provided, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4. In one embodiment, the polynucleotide comprises a nucleotide sequence having at least 90%, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 4.

[0044] In one embodiment, the miRNA target sequence comprises the sequence shown in SEQ ID NO:4.

[0045] In one embodiment, the miRNA target sequence consists of the sequence shown in SEQ ID NO:4.

[0046] In one embodiment, the polynucleotide further comprises a promoter. In one embodiment, the promoter is operably linked to the transgene.

[0047] In one embodiment, the promoter is a constitutive promoter. In some embodiments, the constitutive promoter is the Ef1a promoter.

[0048] In one embodiment, the promoter is a tissue-specific promoter, preferably a cancer cell-specific promoter.

[0049] In one embodiment, the promoter is a proliferating cell-specific promoter.

[0050] In one embodiment, the polynucleotide further comprises a promoter operably linked to the transgene, optionally wherein the promoter is a tissue-specific promoter or a constitutive promoter, optionally a cancer cell-specific promoter.

[0051] In one embodiment, the promoter is selected from the group consisting of: Mki67 promoter, Ccnd1 promoter, Ccnb2 promoter, Ccna2 promoter, Cdc25c promoter, Cdc2 promoter, Cks1 promoter, PCNA promoter, CDC6 promoter, POLD1 promoter, CSK1B promoter, MCM2 promoter and PLK1 promoter.

[0052] In one embodiment, the promoter is the Mki67 promoter.

[0053] In one embodiment, the promoter is the Ef1a promoter.

[0054] In one aspect, a vector comprising a polynucleotide according to the invention is provided.

[0055] In one embodiment, the vector is a viral vector.

[0056] In one embodiment, the vector is a lentiviral vector.

[0057] In one embodiment, the vector is an adeno-associated virus (AAV) vector.

[0058] In one embodiment, the AAV vector is serotype 2, 5 or 9. In a preferred embodiment, the vector is an AAV2 vector. In another preferred embodiment, the vector is an AAV5 vector.

[0059] In one embodiment, the vector is an mRNA vector.

[0060] The order of the miRNA target sequences can vary. In one embodiment, the miRNA target sequences or clusters of copies of sequences are arranged from 5' to 3' in the following order: one or more miR-124 target sequences, one or more miR-338-3p target sequences, and one or more miR-31 target sequences.

[0061] In one embodiment, the miRNA target sequence or cluster of copies of sequences are arranged from 5' to 3' in the following order: one or more miR-124 target sequences, one or more miR-31 target sequences, and one or more miR-338-3p target sequences.

[0062] In another embodiment, the miRNA target sequence or cluster of copies of sequences are arranged from 5' to 3' in the following order: one or more miR-338-3p target sequences, one or more miR-124 target sequences, and one or more miR-31 target sequences.

[0063] In another embodiment, the miRNA target sequences or clusters of copies of sequences are arranged from 5' to 3' in the following order: one or more miR-338-3p target sequences, one or more miR-31 target sequences, and one or more miR-124 target sequences.

[0064] In another embodiment, the miRNA target sequence or cluster of copies of sequences are arranged from 5' to 3' in the following order: one or more miR-31 target sequences, one or more miR-124 target sequences, and one or more miR-338-3p target sequences.

[0065] In another embodiment, the miRNA target sequence or cluster of copies of sequences are arranged from 5' to 3' in the following order: one or more miR-31 target sequences, one or more miR-338-3p target sequences, and one or more miR-124 target sequences.

[0066] Both individual target sequences and clusters of copies of sequences can be adjacent to each other, separated by spacer sequences, or any combination thereof.

[0067] Thus, in one embodiment, the miRNA target sequence is separated by a spacer sequence.

[0068] In one embodiment, a polynucleotide is provided, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4. In one embodiment, the polynucleotide comprises a sequence having at least 90%, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 4.

[0069] In one aspect, a nanoparticle comprising a polynucleotide or a vector according to the invention is provided.

[0070] In one embodiment, the nanoparticle is a polymer nanoparticle, an inorganic nanoparticle, or a lipid nanoparticle. In some embodiments, the nanoparticle is a liposome.

[0071] In one aspect, a cell comprising a polynucleotide, vector or nanoparticle according to the invention is provided.

[0072] In one embodiment, the cell is a eukaryotic cell, such as a mammalian cell. In another embodiment, the cell is a human cell.

[0073] In one aspect, a composition comprising a polynucleotide, vector, nanoparticle or cell according to the invention is provided.

[0074] The composition can be a hydrogel. In some embodiments, the hydrogel is a poly(ethylene glycol) dimethacrylate (PEG-DMA) hydrogel. In some embodiments, the hydrogel further comprises hydroxyapatite nanoparticles.

[0075] In one aspect, a pharmaceutical composition is provided, comprising a polynucleotide, vector, nanoparticle or cell according to the present invention, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0076] In one aspect, there is provided a polynucleotide, a vector, a nanoparticle, a cell, a composition or a pharmaceutical composition according to the invention for use in therapy.

[0077] In one aspect, there is provided a polynucleotide, a vector, a nanoparticle, a cell, a composition or a pharmaceutical composition according to the invention for use in the treatment of a disease or disorder.

[0078] In one aspect, a polynucleotide, a vector, a nanoparticle, a cell, a composition or a pharmaceutical composition according to the invention is provided for use in the treatment of cancer.

[0079] In some embodiments, the polynucleotide, vector, cell, or composition (eg, hydrogel) is administered topically.

[0080] In another aspect, the present invention provides use of a polynucleotide, a vector, a nanoparticle, a cell, a composition or a pharmaceutical composition according to the present invention in the preparation of a medicament for therapy.

[0081] In another aspect, the present invention provides use of a polynucleotide, a vector, a nanoparticle, a cell, a composition or a pharmaceutical composition according to the present invention in the preparation of a medicament for treating cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1 .Use of miRNA-based detargeting silencing factor constructs to enhance transgene specificity.

[0083] (a) Schematic representation of a vector containing a Tmir cassette (four copies each of the miRNA target sequences for miR124, miR338-3p, and miR31) within the 3'UTR. The Tmir cassette allows for transgene expression in cancer cells but not in brain cells (neurons, oligodendrocytes, and astrocytes). (b) GFP-Tmir is expressed in the U251GBM cancer cell line, as shown by GFP expression counterstained with Hoecst.

[0084] Figure 2 .AAV Function on Patient-Derived Cancer Stem Cells.

[0085] Recombinant AAV serotypes containing the Ef1a::GFP construct were used to infect patient-derived GBM cancer stem cells in vitro. Four days after infection, cells were fixed and subjected to GFP immunofluorescence and stained with the nuclear marker Hoecst.

[0086] Figure 3 .Use of miRNA-based de-targeting silencing factor constructs to enhance ESF specificity.

[0087] (a) Schematic diagram of both control and SES vectors containing Tmir cassettes (four copies each of miRNA target sequences for miR124, miR338-3p, and miR31) within the 3'UTR. The Tmir cassette allows transgene expression in cancer cells, but not in brain cells (neurons, oligodendrocytes, and astrocytes). (b) Both GFP-Tmir and SES-Tmir are expressed in the U251 GBM cancer cell line, as shown by GFP / V5 expression counterstained with Hoecst. SES-Tmir is able to reduce cancer cell proliferation in vitro. (c) SES-Tmir is not expressed (de-targeted) in mouse primary cortical cultures containing postmitotic neurons, postmitotic and proliferating astrocytes, and proliferating oligodendrocyte precursor cells (OPCs). DETAILED DESCRIPTION OF THE INVENTION

[0089] As used herein, the terms "comprising, comprises and comprised of" are synonymous with "including or includes"; or "containing or contains"; and are inclusive or open-ended, and do not exclude additional, unrecited members, elements or steps. The terms "comprising, comprises and comprised of" also include the term "consisting of".

[0090] It will be understood that when reference is made herein to a protein or polypeptide, the description is equally applicable to a polynucleotide encoding the protein or polypeptide, and where relevant (ie, when reference is made to a coding sequence within a polynucleotide), and vice versa.

[0091] It should be understood that any of the following aspects of the invention may be combined as appropriate in the practice of the invention.

[0092] Polynucleotides and transgene cassettes

[0093] Triplet miRNA cassette

[0094] Here, the inventors provide a transgenic expression cassette comprising a target sequence recognized by a microRNA (miRNA) to regulate transgenic expression. The expression cassette allows for regulation of transgenic expression, thereby reducing or eliminating unwanted expression in cell types containing the miRNA, thereby improving safety and reducing off-target effects.

[0095] In one aspect, polynucleotides are provided that comprise at least one miR-124 target sequence, at least one miR-338-3p target sequence, and at least one miR-31 target sequence, wherein the miRNA target sequences are operably linked to a transgene.

[0096] In one embodiment, the number of copies of each of the miRNA target sequences is independently selected from the group consisting of: 1, 2, 3, and 4.

[0097] In one embodiment, the copy number of each of the miRNA target sequences is one.

[0098] In one embodiment, the copy number of each of the miRNA target sequences is two.

[0099] In one embodiment, the copy number of each of the miRNA target sequences is three.

[0100] In one embodiment, the copy number of each of the miRNA target sequences is four.

[0101] In one embodiment, the number of copies of each of the miRNA target sequences is greater than four, such as five, six, seven, eight, nine or ten.

[0102] Suitable miRNA target sequences for miR-124 are:

[0103] attgccttatttc[SEQ ID NO:1]

[0104] In one embodiment, the miRNA target sequence comprises the sequence of SEQ ID NO:1.

[0105] Suitable miRNA target sequences for miR-338-3p are:

[0106] caacaaaatcactgatgctgga[SEQ ID NO:2]

[0107] In one embodiment, the miRNA target sequence comprises the sequence of SEQ ID NO:2.

[0108] Suitable miRNA target sequences for miR-31 are:

[0109] cagctatgccagcatcttgcc[SEQ ID NO:3]

[0110] In one embodiment, the miRNA target sequence comprises the sequence of SEQ ID NO:3.

[0111] In one embodiment, the miRNA target sequence comprises SEQ ID NOs: 1, 2, and 3.

[0112] In one embodiment, the miRNA target sequence is located downstream, ie, 3', of the transgene.

[0113] In one embodiment, the miRNA target sequence is located within the 3'-UTR of the transgene.

[0114] In one embodiment, the miRNA target sequence or cluster of copies of the sequence is arranged from 5' to 3' in the following order: miR-124, miR-338-3p, and miR-31.

[0115] According to the aforementioned embodiment, the target sequences or clusters comprising one or more copies thereof are arranged from 5' to 3' such that they form groups according to their target specificity, i.e. 5'-[miR-124 target sequence]4-[miR-338-3p target sequence]4-[miR-31 target sequence]4-3'.

[0116] Both individual target sequences and sequence clusters can be adjacent to each other, separated by spacer sequences, or any combination thereof.

[0117] Thus, in one embodiment, the miRNA target sequence is separated by a spacer sequence.

[0118] In embodiments where the polynucleotide comprises four target sequences for each of miR-124, miR-338-3p, and miR-31, the polynucleotide may comprise the sequence set forth as SEQ ID NO:4.

[0119] Triple miRNA target sequence (Tmir) (SEQ ID NO: 4):

[0120]

[0121] miR124 target sequences

[0122] miR338-3p target sequences

[0123]

[0124] In one embodiment, the polynucleotide comprises the sequence shown as SEQ ID NO:4.

[0125] In one embodiment, the polynucleotide consists of the sequence shown in SEQ ID NO:4.

[0126] The polynucleotides and transgene cassettes described herein can be used with any transgene.

[0127] miR-124 can, for example, also be referred to as miRNA-124 or miR124; miR-338-3p can also be referred to as miR-338-3p or miRNA338-3p; and miR-31 can also be referred to as miRNA-31 or miR31.

[0128] A miRNA target sequence may be represented by one or more copies of a sequence of a given identity. The number of copies of each target sequence may be selected independently, ie, the number of copies of a given sequence does not necessarily depend on the number of copies of another different sequence.

[0129] Thus, in one embodiment, the one or more miRNA target sequences comprises more than one copy of said miRNA target sequence.

[0130] In one embodiment, the one or more miRNA target sequences comprise one copy of said miRNA target sequence.

[0131] In one embodiment, the one or more miRNA target sequences comprise two copies of the miRNA target sequence.

[0132] In one embodiment, the one or more miRNA target sequences comprise three copies of said miRNA target sequence.

[0133] In one embodiment, the one or more miRNA target sequences comprise four copies of said miRNA target sequence.

[0134] In one embodiment, the one or more miRNA target sequences comprise more than four copies of said miRNA target sequence, such as five, six, seven, eight, nine or ten copies.

[0135] In a preferred embodiment, the miRNA target sequence comprises four copies of the target sequence of each of miR-124, miR-338-3p, and miR-31.

[0136] The order of the miRNA target sequences may vary. In one embodiment, the miRNA target sequences or clusters of copies of sequences are arranged from 5' to 3' in the following order: miR-124, miR-338-3p, and miR-31.

[0137] In another embodiment, the miRNA target sequence or cluster of copies of the sequence is arranged from 5' to 3' in the following order: miR-124, miR-31, and miR-338-3p.

[0138] In another embodiment, the miRNA target sequence or cluster of copies of sequences are arranged from 5' to 3' in the following order: miR-338-3p, miR-124, and miR-31.

[0139] In another embodiment, the miRNA target sequence or cluster of copies of the sequence is arranged from 5' to 3' in the following order: miR-338-3p, miR-31, and miR-124.

[0140] In another embodiment, the miRNA target sequence or cluster of copies of the sequence is arranged from 5' to 3' in the following order: miR-31, miR-124, and miR-338-3p.

[0141] In another embodiment, the miRNA target sequence or cluster of copies of the sequence is arranged from 5' to 3' in the following order: miR-31, miR-338-3p, and miR-124.

[0142] Both individual target sequences and sequence clusters can be adjacent to each other, separated by spacer sequences, or any combination thereof.

[0143] Thus, in one embodiment, the miRNA target sequence is separated by a spacer sequence.

[0144] In one embodiment, the polynucleotide comprises the sequence according to SEQ ID NO:4.

[0145] Spacer

[0146] As used herein, a "spacer" can be a sequence (eg, a nucleotide or amino acid sequence) that can be used to separate other sequence elements within a larger polymer.

[0147] In one embodiment, one or more spacer sequences separate polynucleotide sequences (eg, miRNA target sequences).

[0148] A single miRNA target sequence or a group of miRNA target sequences can be separated by one or more spacer sequences. In one embodiment, the miRNA target sequence is separated by one or more spacer sequences. The spacer sequence can include, for example, at least one, at least two, at least three, at least four, at least five, at least ten, at least twenty or at least thirty nucleotide bases.

[0149] By way of non-limiting example, in the following triple miRNA target sequence, each miRNA target sequence is separated by a sequence that may not be considered part of the miRNA target sequence. Such sequences can be considered spacers that separate functional sequence elements.

[0150] Triple miRNA target sequence (Tmir) (SEQ ID NO: 4):

[0151]

[0152] The spacer sequences in SEQ ID NO: 4 include: (a) at; (b) cgatt; (c) gcatt; (d) tcact; (e) cgatcccggggtttaaaccgat (SEQ ID NO: 5); (f) cgat; (g) tcac; (h) cgatgtttaaaccctgcaggcgat (SEQ ID NO: 6); (i) cgatcctgcaggagatct (SEQ ID NO: 7).

[0153] In one embodiment, the spacer is selected from the group consisting of: (a) - (i).

[0154] In one embodiment, the polynucleotide comprises one or more spacers selected from the group consisting of: (a) - (i).

[0155] In one embodiment, the spacer sequences separating clusters of miRNA target sequences are longer than the spacer sequences separating miRNA target sequences within clusters.

[0156] genetically modified

[0157] The polynucleotide according to the invention may comprise any suitable transgene. A suitable transgene may be operably linked to a miRNA target sequence according to the invention such that expression of the transgene is dependent on the presence of the miRNA.

[0158] By "operably connected" it is to be understood that the individual components are connected together in such a way that they can perform their functions substantially unhindered.

[0159] Expression control sequences

[0160] The polynucleotides of the invention may comprise one or more expression control sequences. Suitably, the transgene is operably linked to one or more expression control sequences.

[0161] As used herein, an "expression control sequence" is any nucleotide sequence that controls expression of a transgene (eg, promotes and / or increases expression in certain cell types and / or decreases expression in other cell types).

[0162] The expression control sequence and the transgene can be in any suitable arrangement in the polynucleotide, provided that the expression control sequence is operably linked to the transgene.

[0163] Promoter

[0164] In some embodiments, the expression control sequence is a promoter.

[0165] Any suitable promoter can be used, and the selection of promoters can be easily performed by technicians. The promoter sequence can be constitutively active (i.e., operational in any host cell background), or alternatively, can be active only in a specific host cell environment, thereby allowing transgenes to be targeted and expressed in specific cell types (e.g., tissue-specific promoters). The promoter can display inducible expression in response to the presence of another factor (e.g., a factor present in the host cell). In any case, when the vector is administered for therapy, it is preferred that the promoter is functional in the target cell background.

[0166] In some embodiments, the polynucleotide further comprises a promoter operably linked to the transgene.

[0167] In some embodiments, the promoter is a constitutive promoter. In some embodiments, the constitutive promoter is the Ef1a promoter.

[0168] An example sequence for the Ef1a promoter is:

[0169]

[0170] (SEQ ID NO:8)

[0171] In some embodiments, the promoter is a tissue-specific promoter, preferably a cancer cell-specific promoter.

[0172] In some embodiments, the promoter is a proliferating cell-specific promoter.

[0173] In some embodiments, the promoter is selected from the group consisting of: Mki67 promoter, Ccnd1 promoter, Ccnb2 promoter, Ccna2 promoter, Cdc25c promoter, Cdc2 promoter, Cks1 promoter, PCNA promoter, CDC6 promoter, POLD1 promoter, CSK1B promoter, MCM2 promoter and PLK1 promoter.

[0174] In some embodiments, the promoter is the Mki67 promoter.

[0175] An example sequence for the Mki67 promoter is:

[0176]

[0177] (SEQ ID NO:9)

[0178] For example, the promoter may comprise or consist of a nucleic acid sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 8 or 9, preferably, wherein the promoter substantially retains the native function of the promoter of SEQ ID NO: 8 or 9, respectively.

[0179] miRNA target sequences

[0180] In some embodiments, the polynucleotide further comprises one or more miRNA target sequences. Suitably, the nucleic acid sequence encoding the transgene is operably linked to one or more miRNA target sequences.

[0181] MicroRNA (miRNA) genes are scattered on all human chromosomes except the Y chromosome. They can be located in non-coding regions of the genome or in introns of protein-coding genes. About 50% of miRNAs appear in clusters, which are transcribed as polycistronic primary transcripts. Similar to protein-coding genes, miRNAs are usually transcribed from polymerase II promoters to generate so-called primary miRNA transcripts (pri-miRNAs). Then, the pri-miRNA undergoes a series of endonucleolytic cleavage steps, which are performed by two enzymes belonging to the RNase III family (called Drosha and Dicer). A stem loop of about 60 nucleotides in length (called a miRNA precursor (pre-miRNA)) is removed from the pri-miRNA by a specific nuclear complex, which is composed of Drosha and the DiGeorge syndrome critical region gene (DGCR8), which trims (crops) the two chains near the base of the primary stem loop and leaves a 5' phosphate and a 2bp long 3' single-stranded overhang. The pre-miRNA is then actively transported from the nucleus to the cytoplasm via RAN-GTP and exportin. Dicer then performs double-stranded cleavage at the end of the undefined stem-loop cut by Drosha, generating a 19-24bp duplex consisting of a mature miRNA and the opposite strand of the duplex (called miRNA*). Consistent with the thermodynamic asymmetry rule, only one strand of the duplex is selectively loaded into the RNA-induced silencing complex (RISC) and accumulated as a mature microRNA. This strand is usually the one whose 5' end is less tightly paired with its complement, as demonstrated by the single nucleotide mismatch introduced into the 5' end of each strand of the siRNA duplex. However, there are also some miRNAs that support the accumulation of both duplex strands to a similar degree.

[0182] MicroRNAs trigger RNAi, much like the small interfering RNAs (siRNAs) widely used for experimental gene knockdown. The main difference between miRNAs and siRNAs is their biogenesis. Once loaded into RISC, the guide strand of the small RNA molecule interacts with the mRNA target sequence that is preferentially found in the 3' untranslated region (3'UTR) of protein-coding genes. Studies have shown that the 2nd-8th nucleotides counted from the 5' end of the miRNA, the so-called seed sequence, are critical for triggering RNAi. If the entire guide strand sequence is completely complementary to the mRNA target, which is usually the case for siRNAs and plant miRNAs, the mRNA will enter the RNA-induced silencing complex (RISC) through endonucleolytic cleavage by the participation of Argonaute (Ago) proteins, also known as "slicers" of small RNA duplexes. DGRC (DiGeorge syndrome critical region gene 8) and TRBP (TAR (HIV) RNA binding protein 2) are double-stranded RNA binding proteins that promote the biogenesis of mature miRNAs through the Drosha and Dicer RNase III enzymes, respectively. The guide strand of the miRNA duplex is incorporated into the effector complex RISC, which recognizes specific targets through imperfect base pairing and induces posttranscriptional gene silencing. Several mechanisms have been proposed for this mode of regulation: miRNAs can induce inhibition of translation initiation, mark target RNAs for degradation by deadenylation, or sequester targets into cytoplasmic P-bodies.

[0183] On the other hand, if only the seed is fully complementary to the target mRNA, but the remaining bases show incomplete pairing, RNAi acts through multiple mechanisms, leading to translational inhibition. Eukaryotic mRNA degradation occurs primarily through shortening of the polyA tail at the 3' end of the mRNA and decapping at the 5' end, followed by 5'-3' exonuclease digestion, and accumulation of miRNAs in discrete cytoplasmic regions (the so-called P bodies) enriched with components of the mRNA degradation pathway.

[0184] One or more corresponding miRNA target sequences can be used to regulate the expression of a nucleic acid sequence encoding a transgene by one or more endogenous miRNAs. Using this method, one or more miRNAs endogenously expressed in a cell prevent or reduce transgene expression in the cell by binding to its corresponding miRNA target sequence located in a polynucleotide or vector.

[0185] The target sequence can be completely or partially complementary to the miRNA. As used herein, the term "completely complementary" can refer to a target sequence having a nucleic acid sequence that is 100% complementary to the sequence of the miRNA that recognizes it. As used herein, the term "partially complementary" can refer to a target sequence that is only partially complementary to the sequence of the miRNA that recognizes it, whereby the partially complementary sequence is still recognized by the miRNA. In other words, the partially complementary target sequence in the context of the present invention effectively recognizes the corresponding miRNA and effectively prevents or reduces transgenic expression in cells expressing the miRNA. Suitably, a partially complementary miRNA target sequence can be completely complementary to a miRNA seed sequence.

[0186] Including more than one copy of the miRNA target sequence can increase the effectiveness of the system. In addition, different miRNA target sequences can also be included. For example, the protein coding sequence can be operably linked to more than one miRNA target sequence, and the more than one miRNA target sequence can be different or the same. The miRNA target sequences can be connected in series, but the present disclosure contemplates other arrangements. The polynucleotide can, for example, contain 1, 2, 3, 4, 5, 6, 7 or 8 copies of the same or different miRNA target sequence. Suitably, the polynucleotide contains 4 copies of each of the miRNA target sequences.

[0187] The copies of the miRNA target sequence can be separated by a spacer sequence. The spacer sequence can comprise, for example, at least one, at least two, at least three, at least four, or at least five nucleotide bases.

[0188] One or more miRNA target sequences can, for example, inhibit the expression of a transgene in non-cancerous cells. For example, this can increase the safety of a therapy targeting cancer cells. The expression of a transgene in cancer cells may, for example, not be inhibited by one or more miRNA target sequences.

[0189] One or more miRNA target sequences can inhibit transgene expression in one or more cells other than cancer cells, such as neurons, astrocytes, and / or oligodendrocytes. In one embodiment, one or more miRNA target sequences inhibit transgene expression in neurons. In one embodiment, one or more miRNA target sequences inhibit transgene expression in astrocytes. In one embodiment, one or more miRNA target sequences inhibit transgene expression in oligodendrocytes.

[0190] As used herein, the term "inhibit expression" can refer to a reduction in expression of a transgene operably linked to one or more miRNA target sequences in a relevant cell type compared to transgene expression in the absence of one or more miRNA target sequences but under otherwise substantially identical conditions. In some embodiments, transgene expression is inhibited by at least 50%. In some embodiments, transgene expression is inhibited by at least 60%, 70%, 80%, 90%, or 95%. In some embodiments, transgene expression is substantially prevented.

[0191] protein

[0192] As used herein, the term "protein" includes single-chain polypeptide molecules, as well as multiple polypeptide complexes (in which the individual component polypeptides are linked by covalent or non-covalent means). As used herein, the terms "polypeptide" and "peptide" refer to polymers in which monomers are amino acids and are linked together by peptide bonds or disulfide bonds.

[0193] Polynucleotide

[0194] The polynucleotides of the present invention may comprise DNA or RNA. They may be single-stranded or double-stranded. It will be appreciated by the skilled artisan that, due to the degeneracy of the genetic code, many different polynucleotides may encode the same polypeptide. In addition, it will be appreciated that the skilled artisan may use conventional techniques to perform nucleotide substitutions that do not affect the polypeptide sequence encoded by the polynucleotides of the present invention to reflect the codon usage of any particular host organism in which the polypeptide of the present invention is to be expressed.

[0195] The transgenes and coding sequences of the invention, such as those disclosed herein, may also comprise a stop codon, such as TGA, at the 3' end of the transgene or coding sequence.

[0196] The polynucleotides may be modified by any method available in the art. Such modifications may be performed to enhance the in vivo activity or lifespan of the polynucleotides of the invention.

[0197] Polynucleotides such as DNA polynucleotides may be produced recombinantly, synthetically or by any means available to those skilled in the art. They may also be cloned by standard techniques.

[0198] Longer polynucleotides are usually generated using recombinant means, such as using polymerase chain reaction (PCR) cloning techniques. This may involve preparing a pair of primers (e.g., about 15 to 30 nucleotides) flanking the target sequence of the desired clone, contacting the primers with mRNA or cDNA obtained from animal or human cells, performing polymerase chain reaction under conditions that cause amplification of the desired region, separating the amplified fragments (e.g., by purifying the reaction mixture with agarose gel) and recovering the amplified DNA. Primers can be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable vector.

[0199] Carrier

[0200] Vector is a tool that allows or promotes the transfer of an entity from one environment to another. According to the present invention, and by way of example, some vectors used for recombinant nucleic acid technology allow entities, such as nucleic acid segments (e.g., heterologous DNA segments, such as heterologous cDNA segments) to be transferred to target cells. Vectors can be used to maintain heterologous nucleic acids (DNA or RNA) in cells, promote the replication of vectors comprising nucleic acid segments, or promote the expression of proteins encoded by nucleic acid segments. Vectors can be non-viral or viral. Examples of vectors used for recombinant nucleic acid technology include, but are not limited to, plasmids, mRNA molecules (e.g., in vitro transcribed mRNA), chromosomes, artificial chromosomes, and viruses. Vectors can also be, for example, naked nucleic acids (e.g., DNA). In its simplest form, the vector itself can be a nucleotide of interest.

[0201] The vector used in the present invention may be, for example, a plasmid, mRNA or viral vector, and may comprise a promoter for expressing the polynucleotide and, optionally, a regulator of the promoter.

[0202] A variety of techniques known in the art, such as transfection, transformation and transduction, can be used to introduce vectors containing polynucleotides used in the present invention into cells. Several such techniques are known in the art, such as infection with recombinant viral vectors, such as retrovirus, lentivirus (e.g., integration-defective lentivirus), adenovirus, adeno-associated virus, baculovirus and herpes simplex virus vectors; direct injection of nucleic acid and biolistic transformation.

[0203] Non-viral delivery systems include, but are not limited to, DNA transfection methods. Herein, transfection includes the process of delivering genes to target cells using non-viral vectors. Typical transfection methods include electroporation, DNA gene guns, lipid-mediated transfection, compacted DNA-mediated transfection, liposomes, immunoliposomes, lipofectin, cationic agent-mediated transfection, cationic surface amphiphiles (CFA) (Nat. Biotechnol. (1996) 14: 556), and combinations thereof.

[0204] For example, transfection of cells with mRNA vectors can be accomplished using nanoparticles, such as liposomes.

[0205] In some embodiments, the carrier (e.g., mRNA carrier) is contained in a nanoparticle. In some embodiments, the nanoparticle is a polymer nanoparticle, an inorganic nanoparticle, or a lipid nanoparticle. In some embodiments, the nanoparticle is a liposome.

[0206] Nanoparticles can be targeted to specific cell types (eg, cancer cells) using one or more ligands displayed on the surface of the nanoparticle.

[0207] Viral vectors

[0208] In a preferred embodiment, the vector is a viral vector. The viral vector may be in the form of a viral vector particle.

[0209] The viral vector can be, for example, a retroviral, lentiviral, adeno-associated viral (AAV) or adenoviral vector.

[0210] In some embodiments, the vector is a lentiviral vector. In some embodiments, the vector is an AAV vector. In some embodiments, the vector is an AAV vector particle.

[0211] Retroviral and lentiviral vectors

[0212] Retroviral vectors can be derived from any suitable retrovirus or can be derived from any suitable retrovirus. A large number of different retroviruses have been identified. Examples include murine leukemia virus (MLV), human T-cell leukemia virus (HTLV), mouse mammary tumor virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus (Mo-MLV), FBR murine osteosarcoma virus (FBR MSV), Moloney murine sarcoma virus (Mo-MSV), Epstein murine leukemia virus (A-MLV), avian myelocytoma virus 29 (MC29) and avian erythroblastosis virus (AEV). A detailed list of retroviruses can be found in Coffin et al. (1997) Retroviruses, Cold Spring Harbor Laboratory Press, 758-63.

[0213] Retroviruses can be roughly divided into two categories: "simple" and "complex". Retroviruses can be further divided into seven groups. Five of these groups represent retroviruses with oncogenic potential. The remaining two groups are lentiviruses and foamy viruses. A review of these retroviruses is presented in Coffin et al. (1997) Retroviruses, Cold Spring Harbor Laboratory Press, 758-63.

[0214] The basic structure of retroviral and lentiviral genomes share many common features, such as the 5'LTR and 3'LTR. Positioned between or within them are packaging signals that enable the genome to be packaged, primer binding sites, integration sites that enable integration into the host cell genome, and gag, pol, and env genes that encode packaging components - these are polypeptides required for the assembly of viral particles. Lentiviruses have additional features, such as the rev and RRE sequences in HIV, which enable efficient export of the RNA transcripts of the integrated provirus from the nucleus to the cytoplasm of the infected target cell.

[0215] In the provirus, these genes are flanked at both ends by regions called long terminal repeats (LTRs). LTRs are responsible for proviral integration and transcription. LTRs also act as enhancer-promoter sequences and can control the expression of viral genes.

[0216] The LTR itself is an identical sequence that can be divided into three elements: U3, R, and U5. U3 is derived from a sequence unique to the 3' end of the RNA. R is derived from a sequence that is repeated at both ends of the RNA. U5 is derived from a sequence unique to the 5' end of the RNA. The sizes of the three elements can vary greatly in different retroviruses.

[0217] In a defective retroviral vector genome, gag, pol and env may be absent or inoperative.

[0218] In a typical retroviral vector, at least a portion of one or more protein coding regions essential for replication may be removed from the virus. This renders the viral vector replication defective.

[0219] Lentivirus vectors are part of a larger group of retroviral vectors. A detailed list of lentiviruses can be found in Coffin et al. (1997) Retroviruses, Cold Spring Harbor Laboratory Press, 758-63. Lentiviruses can be divided into primate groups and non-primate groups. Examples of primate lentiviruses include, but are not limited to, human immunodeficiency virus (HIV), the pathogen of human acquired immunodeficiency syndrome (AIDS); and simian immunodeficiency virus (SIV). Examples of non-primate lentiviruses include the prototype "slow virus" Vesna / Medi virus (VMV), as well as the related caprine arthritis encephalitis virus (CAEV), equine infectious anemia virus (EIAV), and the recently described feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV).

[0220] The lentivirus family differs from retroviruses in that lentiviruses have the ability to infect both dividing and non-dividing cells (Lewis et al. (1992) EMBO J. 11:3053-8; Lewis et al. (1994) J. Virol. 68:510-6). In contrast, other retroviruses, such as MLV, are unable to infect non-dividing or slowly dividing cells, such as cells that make up, for example, muscle, brain, lung, and liver tissue.

[0221] As used herein, a lentiviral vector is a vector comprising at least one component that can be derived from a lentivirus. Preferably, the component is involved in the biological machinery of the vector to infect cells, express genes or replicate.

[0222] The lentiviral vector may be a "primate" vector. The lentiviral vector may be a "non-primate" vector (i.e., derived from a virus that does not primarily infect primates, especially humans). Examples of non-primate lentiviruses may be any member of the Lentiviridae family that does not naturally infect primates.

[0223] Preferably, the viral vector used in the present invention has a minimal viral genome.

[0224] By "minimal viral genome" it is understood that the viral vector has been manipulated to remove non-essential elements and retain essential elements in order to provide the functions required for infection, transduction and delivery of the nucleotide sequence of interest to the target host cell. Further details of this strategy can be found in WO1998 / 017815.

[0225] Preferably, the plasmid vector used to produce the viral genome in the host cell / packaging cell will have sufficient lentiviral genetic information to allow the RNA genome to be packaged into viral particles capable of infecting target cells but unable to replicate independently in the presence of packaging components to produce infectious viral particles in the final target cell. Preferably, the vector lacks functional gag-pol and / or env genes and / or other genes essential for replication.

[0226] However, the plasmid vector used to produce the viral genome in the host cell / packaging cell will also contain transcriptional regulatory control sequences operably linked to the lentiviral genome to direct the transcription of the genome in the host cell / packaging cell. These regulatory sequences can be natural sequences associated with the transcribed viral sequence (i.e., the 5' U3 region), or they can be a heterologous promoter, such as another viral promoter (e.g., CMV promoter).

[0227] The vector can be a self-inactivating (SIN) vector in which the viral enhancer and promoter sequences have been deleted. SIN vectors can be generated in vivo and transduce non-dividing cells with efficacy similar to that of wild-type vectors. Transcriptional inactivation of the long terminal repeats (LTRs) in the SIN provirus will prevent mobilization by replication-competent viruses. This will also enable regulation of gene expression from internal promoters by eliminating any cis-acting effects of the LTRs.

[0228] The vector may be integration-defective. For example, an integration-defective lentiviral vector (IDLV) may be produced by packaging the vector with a catalytically inactive integrase (such as an HIV integrase with a D64V mutation in the catalytic site), or by modifying or deleting essential att sequences from the vector LTR, or by a combination of the above.

[0229] Adeno-associated virus (AAV) vector

[0230] Adeno-associated virus (AAV) is an attractive vector system for the present invention because it has a high integration frequency. In addition, due to the small size of AAV and reduced binding to cell membranes, AAV can spread in brain tissue.

[0231] AAV has a broad host range for infectivity. Details on the production and use of AAV vectors are described in US Pat. Nos. 5,139,941 and 4,797,368.

[0232] Recombinant AAV vectors have been successfully used for in vitro and in vivo transduction of marker genes and genes involved in human diseases.

[0233] In some embodiments, the vector is an AAV2 vector. In some embodiments, the vector is an AAV5 vector.

[0234] In some embodiments, the vector is an AAV9 vector.

[0235] The viral vector can be a modified or mutated viral vector. Such a vector can be a vector modified to have certain desired properties. For example, the AAV2 vector HBKO (or AAV2-HBKO) is a modified AAV2 that is unable to bind to the heparan sulfate proteoglycan receptor (Naidoo et al. (2018) Mol Ther 26: 2418-2430).

[0236] In one embodiment, the vector is a modified AAV2 vector.

[0237] In one embodiment, the vector is an AAV2-HBKO vector.

[0238] Modified viral vectors may comprise proteins that confer, for example, altered cellular tropism, and have been described, for example, in WO2021155137 and WO2015168666.

[0239] In one embodiment, the vector is a modified AAV5 vector.

[0240] In one embodiment, the vector comprises a capsid having one or more mutations in one or more capsid proteins.

[0241] In one embodiment, the vector comprises a capsid having one or more mutations in VP1.

[0242] In one embodiment, the vector is an AAV vector (preferably an AAV5 vector) comprising a capsid protein (e.g., a VP1 protein) comprising: (a) a G at a position corresponding to amino acid 194; (b) an R at a position corresponding to amino acid 474; (c) an R at a position corresponding to amino acid 564; and / or (d) an R at a position corresponding to amino acid 573, wherein the amino acids are numbered with reference to VP1 of AAV5.

[0243] Variants, derivatives, analogs, homologs and fragments

[0244] In addition to the specific proteins and polynucleotides mentioned herein, the present invention also encompasses the use of variants, derivatives, analogs, homologs and fragments thereof.

[0245] In the context of the present invention, a variant of any given sequence is a sequence in which the residues of a particular sequence (whether amino acid residues or nucleic acid residues) have been modified in such a way that the polypeptide or polynucleotide in question substantially retains at least one of its endogenous functions. Variant sequences can be obtained by addition, deletion, substitution, modification, replacement and / or variation of at least one residue present in a naturally occurring protein.

[0246] As used herein, the term "derivative" in relation to a protein or polypeptide of the present invention comprises any substitution, change, modification, replacement, deletion and / or addition of one (or more) amino acid residues starting from the sequence, or any substitution, change, modification, replacement, deletion and / or addition of one (or more) amino acid residues to the sequence, provided that the resulting protein or polypeptide substantially retains at least one of its endogenous functions.

[0247] As used herein, the term "analog" in relation to a polypeptide or polynucleotide encompasses any mimetic, ie, a compound having at least one endogenous function of the polypeptide or polynucleotide that it mimics.

[0248] Generally, amino acid substitutions, for example 1, 2 or 3 to 10 or 20 substitutions, can be made, provided that the modified sequence substantially retains the desired activity or ability.Amino acid substitutions may include the use of non-naturally occurring analogs.

[0249] The proteins used in the present invention may also have deletions, insertions or substitutions of amino acid residues that produce silent changes and result in functionally equivalent proteins. Deliberate amino acid substitutions may be made based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic properties of the residues, as long as endogenous function is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values ​​include asparagine, glutamine, serine, threonine, and tyrosine.

[0250] For example, conservative substitutions can be made according to the following table. Amino acids in the same block in the second column and preferably in the same row in the third column can be substituted for each other:

[0251]

[0252] The term "homologue" as used herein refers to an entity having a certain homology with a wild-type amino acid sequence or a wild-type nucleotide sequence. The term "homology" may be equivalent to "identity".

[0253] Homologous sequences may comprise amino acid sequences that are at least 50%, 55%, 65%, 75%, 85% or 90% identical, preferably at least 95% or 97% or 99% identical to the subject sequence. Typically, homologs will comprise the same active sites, etc. as the subject amino acid sequence. Although homology can also be considered in terms of similarity (i.e., amino acid residues having similar chemical properties / functions), in the context of the present invention, homology is preferably expressed in terms of sequence identity.

[0254] Homologous sequences can comprise nucleotide sequences that are at least 50%, 55%, 65%, 75%, 85% or 90% identical, preferably at least 95% or 97% or 99% identical to the subject sequence. Although homology can also be considered in terms of similarity, in the context of the present invention, homology is preferably expressed in terms of sequence identity.

[0255] Preferably, reference to a sequence having a percentage identity to any SEQ ID NO disclosed herein refers to the sequence having that percentage identity over the entire length of the referenced SEQ ID NO.

[0256] Homology comparisons can be performed by eye, or more usually with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate the percent homology or identity between two or more sequences.

[0257] The percent homology can be calculated over contiguous sequences, i.e., one sequence is aligned with the other sequence and each amino acid in one sequence is directly compared to the corresponding amino acid in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively small number of residues.

[0258] Although this is a very simple and consistent approach, it does not take into account that, for example, in a pair of otherwise identical sequences, one insertion or deletion in the nucleotide sequence may cause subsequent codons to be out of alignment, thus potentially resulting in a substantial reduction in percent homology when a global alignment is performed. Therefore, most sequence comparison methods aim to produce an optimal alignment that takes into account possible insertions and deletions without overly penalizing the overall homology score. This is achieved by inserting "gaps" in the sequence alignment in an attempt to maximize local homology.

[0259] However, these more complex methods assign "gap penalties" to each gap that occurs in the alignment, so that for the same number of identical amino acids, the sequence alignment has as few gaps as possible, which reflects the higher correlation between the two comparison sequences and will obtain higher scores than sequences with many gaps. "Affine gap costs" are usually used, which charge a relatively high cost for the existence of gaps and charge a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will certainly produce optimized alignments with fewer gaps. Most alignment programs allow modification of gap penalties. However, when using such software for sequence comparison, it is preferred to use default values. For example, when using the GCG Wisconsin Bestfit package, the default gap penalty for amino acid sequences for gaps is -12, and for each extension is -4.

[0260] Therefore, calculating the maximum homology percentage first requires producing the best alignment, taking into account the gap penalty. A suitable computer program for performing such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, USA; Devereux et al. (1984) Nucleic Acids Res. 12: 387). Examples of other software that can perform sequence comparisons include, but are not limited to, the BLAST package, FASTA (Atschul et al. (1990) J. Mol. Biol. 403-410) and the GENEWORKS comparison tool suite. Both BLAST and FASTA can be used for offline and online searches. However, for some applications, the GCG Bestfit program is preferably used. Another tool called BLAST 2 Sequences can also be used to compare protein and nucleotide sequences (see FEMS Microbiol. Lett. (1999) 174: 247-50; FEMS Microbiol. Lett. (1999) 177: 187-8).

[0261] The comparison process itself is usually not based on an all-or-nothing pairing comparison, although the final identity percentage can be measured according to identity. Instead, a scaled similarity score matrix (scaledsimilarity score matrix) is usually used, which is assigned a score for each paired comparison based on chemical similarity or evolutionary distance. The example of this type of matrix commonly used is the BLOSUM62 matrix (the default matrix of the BLAST program suite). The GCG Wisconsin program usually uses public default values ​​or a custom symbol comparison table (if provided) (see user manual for further details). For some applications, it is preferred to use public default values ​​for the GCG package, or in the case of other software, use a default matrix, such as BLOSUM62.

[0262] Once the software has produced an optimal alignment, the percent homology, preferably percent sequence identity, can be calculated. The software typically does this as part of the sequence comparison and generates a numerical result.

[0263] A "fragment" is also a variant, and the term generally refers to a selected region of a polypeptide or polynucleotide that is of interest functionally or, for example, in an assay. Thus, a "fragment" refers to an amino acid or nucleic acid sequence that is a portion of a full-length polypeptide or polynucleotide.

[0264] Such variants can be prepared using standard recombinant DNA techniques such as site-directed mutagenesis. When inserting, a synthetic DNA can be prepared that encodes the insert together with 5' and 3' flanking regions corresponding to the naturally occurring sequence on either side of the insertion site. The flanking regions will contain convenient restriction sites corresponding to the sites in the naturally occurring sequence so that the sequence can be cut with an appropriate enzyme and the synthetic DNA can be connected to the nick. The DNA is then expressed according to the present invention to prepare the encoded protein. These methods are examples of numerous standard techniques known in the art for manipulating DNA sequences, and other known techniques may also be used.

[0265] Codon optimization

[0266] The polynucleotide used in the present invention can be codon optimized. Codon optimization has been previously described in WO1999 / 41397 and WO2001 / 79518. Different cells have different uses for specific codons. This codon bias corresponds to the bias of specific tRNA relative abundance in the cell type. By changing the codon in the sequence, it is customized to match the relative abundance of the corresponding tRNA, and expression may be increased. For the same reason, expression may be reduced by intentionally selecting the following codon, for which the corresponding tRNA is known to be rare in a specific cell type. Therefore, an additional degree of translation control may be obtained.

[0267] Composition

[0268] The polynucleotides, vectors, nanoparticles and cells of the invention can be formulated with a pharmaceutically acceptable carrier, diluent or excipient for administration to a subject. Suitable carriers and diluents include isotonic saline solutions, such as phosphate buffered saline, and potentially containing human serum albumin.

[0269] Materials used to formulate pharmaceutical compositions should be non-toxic and should not interfere with the efficacy of the active ingredients. The precise nature of the carrier or other materials can be determined by one skilled in the art depending on the route of administration.

[0270] Pharmaceutical compositions are generally in liquid form. Liquid pharmaceutical compositions generally include a liquid carrier, such as water, petroleum, animal or vegetable oils, mineral oils or synthetic oils. Physiological saline solutions, magnesium chloride, dextrose or other sugar solutions, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included. In some cases, a surfactant may be used, such as 0.001% pluronic acid (PF68). In some cases, serum albumin may be used in the composition.

[0271] For injection, the active ingredient can be a pyrogen-free aqueous solution with suitable pH, isotonicity and stability. The technician is very capable of using, for example, isotonic vehicles (such as sodium chloride injection, Ringer's injection or lactated Ringer's injection) to prepare suitable solutions. Preservatives, stabilizers, buffers, antioxidants and / or other additives may be included as needed.

[0272] For delayed release, the drug may be contained in a pharmaceutical composition formulated for slow release, such as in microcapsules formed from biocompatible polymers or in a liposomal carrier system according to methods known in the art.

[0273] Processing of cell therapy products is preferably performed in accordance with the FACT-JACIE international standards for cell therapy.

[0274] Treatment

[0275] In one aspect, the invention provides a polynucleotide, vector, nanoparticle, cell, composition or pharmaceutical composition of the invention for use in therapy.

[0276] In another aspect, the present invention provides a polynucleotide, vector, cell or composition of the present invention for use in the treatment of cancer.

[0277] All treatments mentioned herein include curative, palliative and prophylactic treatments. Treatment of mammals, especially humans, is preferred. Both human and veterinary treatments are within the scope of the present invention.

[0278] In some embodiments, the method of treatment provides a polynucleotide, vector, nanoparticle, cell, composition, or pharmaceutical composition of the invention to a tumor.

[0279] In some embodiments, the method of treatment provides a polynucleotide, vector, nanoparticle, cell, composition, or pharmaceutical composition of the invention to the brain of a subject.

[0280] Application

[0281] In some embodiments, the polynucleotide, vector, nanoparticle, cell, composition, or pharmaceutical composition is administered topically to a subject.

[0282] In some embodiments, the polynucleotide, vector, nanoparticle, cell, composition, or pharmaceutical composition is administered to the brain of a subject.

[0283] In a preferred embodiment, the polynucleotide, vector, nanoparticle, cell, composition or pharmaceutical composition is administered to a tumor.

[0284] In some embodiments, the polynucleotide, vector, nanoparticle, cell, composition, or pharmaceutical composition is administered to a subject systemically (eg, intravenously).

[0285] In some embodiments, the polynucleotide, vector, nanoparticle, cell, composition, or pharmaceutical composition is administered topically to a subject.

[0286] As used herein, the term "systemic delivery" or "systemic administration" refers to administering an agent of the invention into the circulatory system, for example, to achieve widespread distribution of the agent. In contrast, topical or local administration limits the delivery of an agent to a local area, for example, a tumor.

[0287] dose

[0288] The technician can easily determine the appropriate dose of the medicament of the present invention applied to the subject. Usually, the doctor will determine the actual dose that is most suitable for the individual patient, which will depend on various factors, including the activity of the specific compound used, the metabolic stability and the length of action of the compound, age, body weight, general health, sex, diet, mode of administration and time, excretion rate, drug combination, the severity of the specific condition and the individual undergoing therapy. Of course, there may be situations where individual examples of higher or lower dosage ranges are needed, and this is within the scope of the present invention.

[0289] Subjects

[0290] As used herein, the term "subject" refers to a human or non-human animal.

[0291] Examples of non-human animals include vertebrates, e.g., mammals, such as non-human primates (particularly higher primates), dogs, rodents (e.g., mice, rats, or guinea pigs), pigs, and cats. The non-human animal may be a companion animal.

[0292] Preferably, the subject is a human.

[0293] The skilled person will understand that they can combine all features of the present invention disclosed herein without departing from the scope of the invention disclosed.

[0294] Preferred features and embodiments of the invention will now be described by way of non-limiting examples.

[0295] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of chemistry, biochemistry, molecular biology, microbiology and immunology, which are within the capabilities of one of ordinary skill in the art and are explained in the literature. See, e.g., Sambrook, J., Fritsch, EF, and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press; Ausubel, FM et al. (1995 and periodically supplemented) Current Protocols in Molecular Biology, Ch. 9, 13, and 16, John Wiley and Sons; Roe, B., Crabtree, J., and Kahn, A. (1996) DNA Isolation and Sequencing: Essential Techniques, John Wiley and Sons; Polak, JM, and McGee, J.O'D. (1990) In Situ Hybridization: Principles and Practice, Oxford University Press; Gait, MJ (1984) Oligonucleotide Synthesis: A Practical Approach, IRL Press; and Lilley, DM, and Dahlberg, JE (1992) Methods in Enzymology: DNA Structures Part A: Synthesis and Physical Analysis of DNA, Academic Press. Each of these general texts is incorporated herein by reference.

[0296] All publications mentioned in the above description are incorporated herein by reference. Without departing from the scope and spirit of the present invention, various modifications and variations of the polypeptides, polynucleotides, vectors, cells, compositions, uses and methods disclosed in the present invention will be apparent to those skilled in the art. Although the present invention has been disclosed in conjunction with specific preferred embodiments, it should be understood that the claimed invention should not be unreasonably limited to such specific embodiments. In fact, various modifications of the disclosed modes for implementing the present invention that are apparent to the technician are intended to fall within the scope of the appended claims. Example

[0297] Example 1

[0298] Materials and methods

[0299] The triple miRNA target sequence (Tmir) is shown in SEQ ID NO:4:

[0300]

[0301] miR124 target sequences

[0302] miR338-3p target sequences

[0303]

[0304] Cell culture

[0305] U-251 cells were cultured in DMEM medium (Dulbecco's modified Eagle's medium-high glucose, Sigma-Aldrich) containing 10% fetal bovine serum (FBS, Sigma-Aldrich), 1% Pen / Strept (Sigma-Aldrich), 2 mM glutamine (Sigma-Aldrich), 1% non-essential amino acids (MEM NEAA, ThermoFisher Scientific), 1% sodium pyruvate solution (Sigma-Aldrich) under plastic adherence conditions and passaged twice a week using trypsin-EDTA solution (Sigma-Aldrich).

[0306] Cancer stem cell (CSC) glioblastoma tumors were maintained in DMEM / F12 (Sigma-Aldrich) supplemented with a hormone cocktail (DMEM / F12, 0.6% glucose (Sigma-Aldrich) (30% in phosphate buffered saline (PBS) (Euroclone)), insulin (Sigma-Aldrich) 250 μg / ml, putrescine powder (Sigma-Aldrich) 97 μg / ml, apotransferrin powder (SigmaAldrich), sodium selenite 0.3 μM, progesterone 0.2 μM), 1% Pen / Strept, 2 mM glutamine, 0.66% glucose (30% in phosphate buffered saline (PBS) (Euroclone)) and heparin (4 mg / ml, Sigma-Aldrich) under plastic adherent conditions; bFGF (20 ng / ml, ThermoFisher Scientific) and EGF (20 ng / ml, ThermoFisher Scientific) were freshly added to the culture medium.

[0307] All cultures were maintained at 37°C under atmospheric oxygen in a humidified atmosphere of 5% CO2.

[0308] Immunostaining

[0309] Cells were seeded on glass coverslips and fixed on ice for 20 minutes in 4% paraformaldehyde (PFA, Sigma) in phosphate buffered saline (PBS, Euroclone). They were then washed twice with PBS and permeabilized for 30' in a blocking solution containing 0.2% Triton X-100 (SigmaAldrich) and 5% donkey serum (Euroclone), and incubated overnight at 4°C with primary antibodies diluted in blocking solution. The primary antibodies used were as follows: anti-V5 (mouse, 1:500, ThermoFisher Scientific, R96025), anti-GFP (chicken, 1:1000, ThermoFisher Scientific, A10262) and anti-MAP2 (chicken, 1:1000, Abcam, ab92434). On the second day, cells were washed 3 times with PBS for 5 minutes each time and incubated with Hoechst 33342 (ThermoFischer Scientific) in blocking solution and with secondary antibodies (ThermoFisherScientific) at room temperature for 1 hour. Finally, slides were washed and mounted in Fluorescent Mounting Medium (Dako Cytomation). Images were collected using an epifluorescence microscope Nikon DS-Qi2 and analyzed using Fiji software.

[0310] AAV production and infection

[0311] Recombinant virus particles without replication ability were produced in 293T cells by co-transfection of the following three different plasmids with polyethyleneimine (PEI) (Polyscience): a plasmid containing a transgene, a packaging plasmid for the rep and cap genes, and pHelper (Agilent) for three adenovirus helper genes. Cells and supernatants were harvested at 120 hr. Cells were lysed at 37 ° C for 1 hour in a hypertonic buffer (40 mM Tris, 500 mM NaCl, 2 mM MgCl2, pH = 8) containing 100 U / ml salt-active nuclease (SAN, Arcticzymes), and the virus particles present in the supernatant were concentrated by precipitation with 8% PEG8000 (polyethylene glycol 8000, Sigma-Aldrich), which was then added to the supernatant to incubate for an additional 30 min at 37 ° C. For clarification, lysate cell fragments were separated by centrifugation (4000 g, 30 minutes). The virus phase was separated in the 40% fraction using an iodixanol step gradient (15%, 25%, 40%, 60% Optiprep, Sigma-Aldrich) and concentrated in PBS (phosphate buffered saline) using a 100K cutoff concentrator (Amicon Ultra15, MERCK-Millipore). Virus titer was determined using AAVpro Titration Kit Ver2 (TaKaRa).

[0312] 2,5x10^4 CSC L0627 were infected with adenoviral vector expressing GFP (5 μl / well) and seeded on glass coverslips previously coated with Matrigel in 24-well plates. After 4 days, the cells were fixed and used for immunostaining studies.

[0313] result

[0314] The inventors have devised a strategy to restrict transgene expression to certain cells, for example, after viral inoculation of the brain. The strategy is based on a microRNA (miRNA) detargeting system that enables transgene silencing by including binding / target sites (TS) of endogenously expressed miRNAs in specific cell types where expression is not desired. To this end, an expression cassette was generated in which the 3'-UTR downstream of the transgene contained a 4x TS cluster of each of miRNA-124, miRNA-338-3p, and miRNA-31, which are specifically expressed in neurons, astrocytes, and oligodendrocytes, respectively. Thus, exogenous transgene expression, for example, Figure 1GFP expression, as shown, was silenced in all aforementioned cell types by miRNA-dependent post-transcriptional silencing and protein translation blockade ( Figure 1 a). Notably, miRNA-124, miRNA-338-3p, and miRNA-31 were not expressed in GBM, as demonstrated by GFP-Tmir lentivirus (LV) expressing unaffected transgene in cancer cells ( Figure 1 b).

[0315] It would be desirable to use a transgene with a delivery system that allows for easy and widespread distribution of the vector over brain regions that may contain residual tumor cells after surgery. This would reduce the likelihood of tumor recurrence, which is a significant problem in GBM. To this end, the inventors tested the use of adeno-associated virus (AAV) as a shuttle vector. Recombinant serotypes 2 and 5 performed better than serotype 9 in transgene delivery as assessed by GFP expression in patient-derived cancer stem cells ( Figure 2 ).

[0316] discuss

[0317] The inventors demonstrate herein that by using miRNA target sequences within the 3'UTR, exogenous transgene expression from healthy brain cells (e.g., neurons, astrocytes, and oligodendrocytes) can be detargeted, thereby providing improved safety and specificity. By utilizing target sequences of miRNAs that are highly expressed in brain cells but not tumor cells, the inventors provide polynucleotides and transgene expression cassettes with high specificity, for example, for use as anti-GBM treatments.

[0318] The inventors also provide here alternative therapeutic viruses to lentiviruses that can be used similarly. Particularly useful are adeno-associated virus (AAV) strains, which can spread in brain tissue due to their small size and exhibit reduced binding to cell membranes. Maximizing the spread of the virus in the brain parenchyma will increase the targeting efficiency of cancer cells dispersed in the tissue, which provides better protection from tumor recurrence. Here, the inventors demonstrate that AAV2 spreads in the brain parenchyma when injected directly into the organ and is able to efficiently infect GBM CSCs in vitro.

[0319] Example 2

[0320] The inventors further demonstrated their detargeting approach using epigenetic silencing factor (ESF) transgenes. ESFs are engineered oncogenic and cancer-associated transcription factors that function as epigenetic repressors.

[0321] ESF should not have any obvious and harmful effects on healthy brain cells that do not express the oncogene of interest and are not proliferating cells. In such healthy cells, the reduction of some key cell cycle genes induced by ESF may be harmful to the cells. However, ESF-dependent chromatin changes may change the performance of neurons in vivo over a long period of time, for example, if used for human treatment. Therefore, the inventors have designed and applied their de-targeting strategy to limit the expression of ESF to cancer cells after viral inoculation of the brain. For this reason, an expression cassette was generated in which the 3'-UTR downstream of the transgene (e.g., ESF cDNA) contained 4x TS clusters of each of miRNA-124, miRNA-338-3p and miRNA-31: SES-Tmir (SEQ ID NO: 10):

[0322] Ef1a::KRAB-hSOX2 1-179 -DNMT3a3L-V5-Tmir[SES-Tmir]

[0323]

[0324]

[0325]

[0326]

[0327] Ef1a promoter

[0328] KRAB

[0329] hSOX2 1-179

[0330] DNMT3a3L

[0331] V5

[0332] miR124 target sequences

[0333] miR338-3p target sequences

[0334]

[0335] Thus, exogenous transgene expression, e.g. Figure 3 The expression of the indicated SES (example ESF) will be silenced in all aforementioned cell types by miRNA-dependent post-transcriptional silencing and protein translation blockade ( Figure 3a). Notably, miRNA-124, miRNA-338-3p, and miRNA-31 were not expressed in GBM, as demonstrated by GFP-Tmir and SES-Tmir lentiviruses (LVs) that displayed unaffected transgene expression in cancer cells ( Figure 3 b). The data herein further demonstrate that the presence of Tmir does not impair SES activity, as this construct induced significant cell loss in transduced cancer cells in vitro ( Figure 3 b, lower right). Specificity of miRNA de-targeting system Figure 3 c, where data show that when applied to primary cortical cultures from mice, no cells expressed SES, as expected and due to miRNA de-targeting ( Figure 3 c).

[0336] It was demonstrated that by using miRNA target sequences within the 3'UTR, exogenous ESF expression from healthy brain cells (e.g., neurons, astrocytes, and oligodendrocytes) can be detargeted, thereby providing improved safety and specificity. By utilizing target sequences of miRNAs that are highly expressed in brain cells but not tumor cells, the inventors provide polynucleotides and transgenic expression cassettes with high specificity, for example, for use as anti-GBM treatments.

Claims

1. A polynucleotide comprising at least one miR-124 target sequence, and / or at least one miR-338-3p target sequence, and / or at least one miR-31 target sequence, wherein the miRNA target sequence is operably linked to a transgene.

2. The polynucleotide of claim 1, wherein the number of copies of each of the miRNA target sequences is independently selected from the group consisting of: 1, 2, 3, and 4.

3. The polynucleotide of claim 1 or claim 2, wherein the polynucleotide comprises four miR-124 target sequences, four miR-338-3p target sequences, and four miR-31 target sequences, wherein the miRNA target sequences are operably linked to the transgene.

4. The polynucleotide according to any one of claims 1 to 3, wherein: (a) the miR-124 target sequence comprises, or consists of, a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1; (b) the miR-338-3p target sequence comprises, or consists of, a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; and / or (c) the miR-31 target sequence comprises, or consists of, a nucleotide sequence having at least 90% sequence identity with SEQ ID NO:

3.

5. The polynucleotide of any one of claims 1 to 4, wherein the miRNA target sequence is located after the transgene in the 5' to 3' direction.

6. The polynucleotide according to any one of claims 1 to 5, wherein the miRNA target sequence or a cluster of copies of the miRNA target sequence is arranged from 5' to 3' in the following order: one or more miR-124 target sequences, one or more miR-338-3p target sequences and one or more miR-31 target sequences.

7. The polynucleotide according to any one of claims 1 to 6, wherein the miRNA target sequence is separated by a spacer sequence.

8. The polynucleotide according to any one of claims 1 to 7, wherein the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity with SEQ ID NO:

4.

9. according to the polynucleotide described in any one of claims 1 to 8, wherein said polynucleotide further comprises a promoter operably linked to said transgenic, optionally wherein said promoter is a tissue-specific promoter or a constitutive promoter, optionally a cancer cell-specific promoter or a proliferating cell-specific promoter.

10. The polynucleotide according to claim 9, wherein the promoter is Ef1a promoter or Mki67 promoter.

11. A vector comprising a polynucleotide according to any one of claims 1 to 10, optionally wherein the vector is a viral vector, optionally wherein the vector is a lentiviral vector or an adeno-associated viral (AAV) vector.

12. A nanoparticle comprising the polynucleotide according to any one of claims 1 to 10 or the vector according to claim 11.

13. A cell comprising the polynucleotide according to any one of claims 1 to 10, the vector according to claim 11, or the nanoparticle according to claim 12.

14. A composition comprising the polynucleotide according to any one of claims 1 to 10, the vector according to claim 11, the nanoparticle according to claim 12, or the cell according to claim 13.

15. The polynucleotide of any one of claims 1 to 10, the vector of claim 11, the nanoparticle of claim 12, the cell of claim 13, or the composition of claim 14 for use in therapy.

16. The polynucleotide of any one of claims 1 to 10, the vector of claim 11, the nanoparticle of claim 12, the cell of claim 13, or the composition of claim 14 for use in the treatment of cancer.

Images