Gynostemma pentaphylla membrane protein gene GpAnnexin, recombinant vector, preparation method and application thereof

Abstract

The invention discloses a fiveleaf gynostemma herb membrane protein gene GpAnnexin, a recombinant vector, a preparation method and application of the fiveleaf gynostemma herb membrane protein gene GpAnnexin. The sequence of the fiveleaf gynostemma herb membrane protein gene GpAnnexin is shown as SEQ ID NO. 1. The invention also provides a recombinant vector of the gynostemma pentaphyllum membrane protein gene GpAnnexin, and a preparation method of the recombinant vector, and the preparation method comprises the following steps: 1) carrying out double enzyme digestion on pCY-35D-GFP plasmid by using SacI enzyme and SalI enzyme to obtain a pCY-35D-GFP linearized vector; and (2) carrying out homologous recombination reaction on the cDNA full-length sequence fragment of the gynostemma pentaphylla membrane protein gene GpAnnexin and a pCY-35D-GFP linearized vector, converting the reaction product into DH5 alpha cell competence, screening positive clone cells on an LB culture medium containing kanamycin, and extracting plasmids after the positive clone cells are verified to be correct through sequencing, thereby obtaining the pCY-35D-GFP-GpAnnexin recombinant vector. The gynostemma pentaphylla membrane protein gene GpAnnexin provided by the invention can improve the tolerance of plants to cadmium and salt stress, and provides a new thought for cultivating plants with high cadmium enrichment and salt tolerance.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology. More specifically, the present invention relates to a Gynostemma pentaphyllum membrane protein gene GpAnnexin , recombinant vector, preparation method and application thereof. Background Art

[0002] Gynostemma pentaphyllum ( Gynostemma pentaphyllum ) is a perennial herbaceous vine of the genus Gynostemma of the Cucurbitaceae family, widely distributed in the Qinling Mountains and the south of the Yangtze River in China. Gynostemma pentaphyllum has a wide range of ecological adaptability and rapid growth characteristics, which makes it show strong tolerance in heavy metal contaminated soil (Suntararuks et al., 2008). Studies have shown that Gynostemma pentaphyllum has a strong ability to accumulate heavy metal cadmium, and the cadmium concentration in the plant is positively correlated with the cadmium concentration in the soil (Zhang Xueying et al., 2018; Nookabkaew et al., 2016). The inventor's previous research found that Gynostemma pentaphyllum can still grow normally after being treated with high concentration (100 μM) of cadmium, and Cd accumulates in the roots, stems and leaves, indicating that Gynostemma pentaphyllum has a strong tolerance to cadmium (zhou et al., 2023), suggesting that it has great potential in repairing heavy metal cadmium pollution. Therefore, if the cadmium-tolerant gene of Gynostemma pentaphyllum can be found, it will be of great significance to improve the cadmium tolerance of plants.

[0003] Annexin is a type of calcium-dependent membrane-bound protein that mediates signal transduction between calcium ion signals and membranes. Current evidence shows that plant annexin has peroxidase activity and is related to plant stress response (Zhang Na et al., 2010). However, the role of plant annexin in cadmium stress has not been reported. Summary of the invention

[0004] An object of the present invention is to solve at least the above problems and to provide at least the advantages which will be described hereinafter.

[0005] Another object of the present invention is to provide a Gynostemma membrane protein gene GpAnnexin , which can improve the tolerance of plants to heavy metal cadmium and salt stress.

[0006] In order to achieve these purposes and other advantages according to the present invention, a Gynostemma pentaphyllum membrane protein gene is provided. GpAnnexin , the Gynostemma membrane protein gene GpAnnexin The sequence is shown in SEQ ID NO.1.

[0007] Recombinant vector containing the Gynostemma membrane protein gene GpAnnexin of the recombinant vector.

[0008] An engineered bacterium, which contains the recombinant vector.

[0009] The method for preparing a recombinant vector comprises the following steps: 1) Double digest the pCY-35D-GFP plasmid with SacI and SalI to obtain the pCY-35D-GFP linearized vector; 2) The Gynostemma membrane protein gene as claimed in claim 1 GpAnnexin The full-length cDNA sequence fragment was homologously recombined with the pCY-35D-GFP linearized vector, and the reaction product was transformed into DH5α cells. Positive clones were screened on LB medium containing kanamycin. After sequencing verification, the plasmid was extracted to obtain pCY-35D-GFP- GpAnnexin Recombinant vector.

[0010] Preferably, the reaction system in step 1) is 2.5 uL of SacI enzyme, 2.5 μL of SalI enzyme, 30 μL of pCY-35D-GFP plasmid, 5 μL of 1.5*T+BSA Universal Buffer, and ddH 2 O 10 μL; the enzyme digestion reaction conditions were 37 ℃ for 12 h.

[0011] Preferably, in step 2), the reaction system of the homologous recombination reaction is: 4 μL of pCY-35D-GFP linearized vector, GpAnnexin cDNA fragment 3 μL, 5 × CE II Buffer 2 μL, Exnase II 1 μL; reaction conditions: 37℃ for 30 min.

[0012] Used to clone the Gynostemma membrane protein gene GpAnnexin The upstream primer is shown as SEQ ID NO.2, and the downstream primer is shown as SEQ ID NO.3.

[0013] Gynostemma pentaphyllum membrane protein gene GpAnnexin Application in improving plant cadmium and salt tolerance.

[0014] The present invention at least has the following beneficial effects: First, the Gp Annexin The gene is a gene that improves plant cadmium tolerance and has important applications in plant heavy metal enrichment, providing a new idea for cultivating plants with high cadmium accumulation. Annexin The gene is a gene that improves the salt tolerance of plants. It has a relatively important application in plant salt tolerance and provides a new idea for breeding highly salt-tolerant plants.

[0015] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 pCY-35D-GFP- GpAnnexin Schematic diagram of the recombinant vector plasmid; Figure 2 This is the graph of plant growth changes after 14 days of cadmium treatment; Figure 3 This is the graph of plant growth changes after 14 days of salt treatment; Figure 4 This is the change diagram of plant growth after 14 days of drought treatment; Figure 5 The graph shows the changes in antioxidant enzyme activities of plants after 24 h of stress treatment; Figure 6 This is the expression change diagram of antioxidant enzyme genes in plants after 24 hours of stress treatment; Figure 7 This is a graph showing changes in cadmium content in plants after 14 days of cadmium treatment. DETAILED DESCRIPTION

[0017] The present invention is further described in detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0018] It should be understood that terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0019] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0020] 1. Gynostemma pentaphyllum GpAnnexin Gene cloning 0.2 g of Gynostemma pentaphyllum leaves were taken and placed in a 2.0 ml centrifuge tube containing grinding beads, frozen in liquid nitrogen, and ground into powder using a tissue grinder (Shanghai Jingxin, JXFSTPRP-64L). The total RNA of the plant was extracted using Eastep® SuperTotal RNA Extraction Kit from Promega Biotechnology, and the RNA was reverse transcribed into cDNA using HiScript II 1st StrandcDNA Synthesis Kit (+gDNA wiper) from Novazonic. GpAnnexinThe full-length cDNA sequence was designed and synthesized with upstream and downstream primers (upstream primer SEQ ID NO.2: atgtcttctcttactatgcctcctgtc; downstream primer SEQ ID NO.3: ctaatgatcaggacccaacaagg), and PCR amplification was performed using Takala's high-fidelity enzyme PrimeSTAR® HS (Premix) with Gynostemma pentaphyllum cDNA as a template. The reaction system was: 25 μL high-fidelity enzyme, 2 μL upstream primer, 2 μL downstream primer, 2 μL cDNA, 19 μL ddH2O; the reaction conditions were: 98 ℃ denaturation for 10 s, 58 ℃ annealing for 15 s, 72 ℃ extension for 2 min, and 30 cycles. The DNA purification and recovery kit of Tiangen Biochemical Technology Co., Ltd. was used for gel recovery. Gynostemma pentaphyllum GpAnnexin The gene sequence SEQ ID NO.1 is as follows:

[0021] two, GpAnnexin Gene recombination vector plasmid acquisition The pCY-35D-GFP plasmid was extracted using the Tiangen Plasmid Extraction Kit and double digested with SacI and SalI enzymes. The reaction conditions were: 2.5 μL each of SacI and SalI enzymes, 30 μL of pCY-35D-GFP plasmid, 5 μL of 1.5*T+BSA UniversalBuffer, and ddH 2 O 10 μL; react at 37 ℃ for 12 h to linearize the vector. GpAnnexin The full-length cDNA sequence fragment was homologously recombined with the pCY-35D-GFP linearized vector. The reaction system was: 4 μL of the linearized pCY-35D-GFP vector, GpAnnexin cDNA fragment 3 μL, 5 × CE II Buffer 2 μL, Exnase II 1 μL; reaction conditions: 37 ℃, 30 min. The reaction product was transformed into DH5α cells, and positive clones were screened on LB medium containing 50 mg / L kanamycin. After sequencing verification, the plasmid was extracted using the Tiangen plasmid extraction kit to obtain pCY-35D-GFP- GpAnnexin Recombinant vector, the schematic diagram of the recombinant vector construction is shown in the attached Figure 1 shown.

[0022] 3. Gp Annexin Gene overexpression strains The correctly sequenced pCY-35D-GFP- GpAnnexin The recombinant vector was transformed into Agrobacterium GV3101 by heat shock method, and the Arabidopsis inflorescence was infected by inflorescence infection method to obtain T0 generation plants. The seeds of T0, T1 and T2 generation plants were used for resistance culture to screen the homozygous plants of T3 generation, and finally the T3 generation homozygous plants were obtained. The DNA of the leaves of T3 generation plants was extracted by CTAB method and PCR amplification was performed for verification. The total RNA of the leaves of T3 generation plants was extracted by Takara RNA extraction kit, reverse transcribed into cDNA, and qRT-PCR was performed for verification using fluorescent quantitative primers (upstream primer SEQ ID NO.4: ttggtgaggcaggctata; downstream primer SEQ ID NO.5: ctgtgatgatgtgcgagaa), and three strains with positive identification results and high gene expression were selected and named OE-1, OE-2, and OE-3.

[0023] IV. Gp Annexin Gene function analysis To study Gynostemma pentaphyllum Gp Annexin Gene function, wild-type Arabidopsis seedlings and transgenic Arabidopsis seedlings were subjected to cadmium stress, salt stress and drought stress analysis. Seedlings were sown on 1 / 2MS solid medium, and when the seedlings grew true leaves, they were transplanted into peat soil (4 plants per pot). After growing for 1 month, 500 μM CdCl 2 (cadmium stress), 200 μM NaCl (salt stress) and 300 μM mannitol (drought stress) solution irrigation, once every 3 days, each time 100 mL, with clean water as the control. After 24 h of treatment, the antioxidant enzyme activity (superoxide dismutase: SOD, peroxidase: POD, catalase: CAT) of the plants was measured; after 14 days of treatment, the growth of the plants was observed and the cadmium content was measured. From the leaf samples treated for 24 h, total RNA was extracted using the RNA extraction kit of Takara Company, reverse transcribed into cDNA, and specific primers were used to detect the expression of antioxidant enzyme genes. The specific primers are shown in Table 1. The housekeeping gene Actin was used as the internal reference gene (upstream primer SEQ ID NO.6: gcaccctgttcttcttaccga; downstream primer SEQ ID NO.7: agtaaggtcacgtccagcaagg), and 2- △△ The relative expression of genes was calculated by CT method.

[0024] Table 1 Specific primers The results showed that after 14 days of cadmium stress treatment, the leaves of wild-type Arabidopsis thaliana wilted and died, while the leaves of overexpressing plants turned yellow but grew normally ( Figure 2 ). After 14 days of salt stress treatment, some leaves of wild-type Arabidopsis thaliana wilted and fell off, while transgenic plants were able to grow normally ( Figure 3 ). Under drought stress conditions, both wild-type Arabidopsis and overexpressing plants withered and died after 14 days of stress treatment ( Figure 4 ).like Figure 5 and Figure 6 As shown in the figure, transgenic plants can increase the superoxide dismutase (SOD) activity, peroxidase (POD) activity, catalase (CAT) activity and the expression of coding genes in the leaves of plants under cadmium and salt stress conditions, which helps to improve the tolerance of plants to cadmium and salt; after drought stress treatment, the superoxide dismutase (SOD) activity, peroxidase (POD) activity, catalase (CAT) activity and the expression of coding genes of wild-type and transgenic Arabidopsis were reduced, which reduced the tolerance of plants to drought. After cadmium treatment, the cadmium content in the underground part of wild-type Arabidopsis was higher than that in the aboveground part, and that in the aboveground part of transgenic plants was higher than that in the underground part, such asFigure 7 As shown, it indicates that transgenic GpAnnexin It can improve the cadmium tolerance of plants and enrich the cadmium in the soil by increasing the cadmium content in the aboveground parts of plants. Annexin The gene is a gene that improves plant tolerance to cadmium and salt. It has important applications in plant heavy metal enrichment and improving plant salt tolerance, and provides a new idea for breeding plants with high cadmium enrichment and salt tolerance.

[0025] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. Gynostemma membrane protein gene GpAnnexin , characterized in that, Gynostemma pentaphyllum membrane protein gene GpAnnexin The sequence is shown in SEQ ID NO.

1.

2. A recombinant vector, characterized in that: Containing the Gynostemma membrane protein gene according to claim 1 GpAnnexin of the recombinant vector.

3. An engineered bacterium, characterized in that: An engineered bacterium containing the recombinant vector according to claim 2.

4. A method for preparing a recombinant vector, characterized in that: The following steps are involved: 1) Double digest the pCY-35D-GFP plasmid with SacI and SalI to obtain the pCY-35D-GFP linearized vector; 2) The Gynostemma membrane protein gene as claimed in claim 1 GpAnnexin The cDNA full-length sequence fragment was homologously recombined with the pCY-35D-GFP linearized vector, and the reaction product was transformed into the competent E. coli DH5α cells. The positive clone cells were screened on the LB medium containing kanamycin. After sequencing verification, the plasmid was extracted to obtain pCY-35D-GFP- GpAnnexin Recombinant vector.

5. The method for preparing a recombinant vector according to claim 1, characterized in that: The reaction system of step 1) is 2.5 uL of SacI enzyme, 2.5 μL of SalI enzyme, 30 μL of pCY-35D-GFP plasmid, 5 μL of 1.5*T+BSA Universal Buffer, and 10 μL of ddH2O; the enzyme digestion reaction conditions are 37 ℃ for 12 h.

6. The method for preparing a recombinant vector according to claim 1, characterized in that: In step 2), the reaction system for homologous recombination reaction is: 4 μL of pCY-35D-GFP linearized vector, GpAnnexin cDNA fragment 3 μL, 5 × CE IIBuffer 2 μL, Exnase II 1 μL; reaction conditions: 37 ℃ reaction for 30 min.

7. Used for cloning the Gynostemma membrane protein gene as claimed in claim 1 GpAnnexin A primer characterized in that The upstream primer is shown as SEQ ID NO.2, and the downstream primer is shown as SEQ ID NO.

3.

8. The Gynostemma membrane protein gene according to claim 1 GpAnnexin Application in improving plant tolerance to cadmium and salt stress.

Images