Construction method and application of Kemann ataxia rat model

Abstract

The invention discloses a construction method and application of a Keman ataxia rat model, and belongs to the technical field of animal models. The construction method of the Keman ataxia rat model comprises the step of mutating the 38th nucleotide of the ATCAY gene exon 3 of a rat from G to A. The constructed Kemann ataxia rat model provides a research mode tool for researching the function of the ATCAY gene in Kemann ataxia and screening or preparing medicines for preventing or treating Kemann ataxia.

Description

Technical Field

[0001] The invention belongs to the technical field of animal models, and particularly relates to a construction method of a Cayman ataxia rat model and application thereof. Background Art

[0002] Cayman ataxia is an autosomal recessive genetic disease. Patients with this disease have symptoms such as dystonia, ataxic gait, and truncal ataxia since birth. Researchers have located the cause of this disease to mutations in the ATCAY gene at human 19p13.3. So far, four mutations have been found in this gene, including a missense mutation, a splicing mutation, and two frameshift mutations. The ATCAY gene encodes a caytaxin protein that exists only in neuronal tissue. This protein is highly expressed at the presynaptic site of GABAergic neurons. The homologous domains it contains are highly conserved across species and are believed to be closely related to the function of the caytaxin protein. However, no research has systematically clarified the function of the caytaxin protein in the body's nervous system.

[0003] Animal models are the main tools for studying human pathogenesis, screening drug targets and developing treatment methods. Among them, gene-edited animal models can more accurately simulate human disease phenotypes and pathological characteristics, and have very broad research and application prospects. At present, there are four types of animal models for ATCAY gene mutations: the jittery mouse model with the B1 element inserted into exon 3, the hesitant mouse model with the IAP element inserted into intron 1, the sidewinder mouse model with 2 bp deletion in intron 5, and the BNIP-H knockdown zebrafish model. However, the above animal models focus on dystonia caused by gene mutations and cannot completely simulate the human disease phenotype of Cayman ataxia. Therefore, this technical field urgently needs to solve the technical problem of how to obtain a disease animal model that can provide a disease animal model for studying the pathogenesis and drug screening of Cayman ataxia. Summary of the invention

[0004] In view of the problem that the existing ATCAY gene mutation animal model cannot fully simulate the phenotype of Cayman ataxia, the purpose of the present invention is to provide a method for constructing a rat model that is more consistent with the phenotype of Cayman ataxia. The purpose of the present invention is also to provide the application of the constructed Cayman ataxia rat model.

[0005] The purpose of the present invention is achieved through the following technical solutions: The present invention provides a method for constructing a Cayman ataxia rat model, which comprises: mutating the 38th nucleotide of exon 3 of the rat's ATCAY gene from G to A, i.e. causing the rat's ATCAY gene to undergo a c.115G>A mutation and the encoded protein to undergo a G39S mutation.

[0006] In some embodiments, the method of mutating the 38th nucleotide of exon 3 of the rat ATCAY gene from G to A includes gene editing technologies such as CRISPR / Cas9, ZFN (zinc finger nuclease), and TALEN (transcription activator-like effector nuclease), and preferably using CRISPR / Cas9 gene editing technology.

[0007] In some embodiments, the method for constructing the Cayman ataxia rat model comprises the following steps: (1) Obtain active sgRNA and Cas9 mRNA through in vitro transcription.

[0008] (2) mixing the active sgRNA, Cas9 mRNA and donor oligonucleotide sequence and microinjecting them into rat fertilized eggs, transplanting the fertilized eggs into the oviducts of surrogate mice for gestation, and obtaining F0 generation rats; (3) The F0 generation positive rats were crossed with wild rats to obtain the F1 generation ATCAY gene heterozygous mutant rats; the F1 generation ATCAY gene heterozygous mutant rats were self-fertilized to obtain the F2 generation ATCAY gene homozygous mutant rats, thus obtaining the Cayman ataxia rat model.

[0009] In step (1), the sequence of the sgRNA is preferably: GGATCACCTGGGCGGCACGG-TGG (SEQ ID NO. 1).

[0010] In step (2), the sequence of the donor oligonucleotide is preferably: ACCGCTCCCAGAAGACACCGGGGAGGATCACCTGGGCAGCACGGTGGAAGACTCCTCCT (SEQ ID NO. 2).

[0011] In step (3), the mutation of the rat ATCAY gene is preferably detected by PCR using the following primers: Upstream primer: 5-′ TTCAATGCATTCCTCCTGCT-3′ (SEQ ID NO. 3); Downstream primer: 5-′ TCTTACCCTTGTTGGCCTTG-3′ (SEQ ID NO. 4).

[0012] In the method for constructing the Cayman ataxia rat model, the rat is preferably a SD rat.

[0013] The Cayman ataxia rat model obtained by the above construction method exhibits the following phenotypes: the disease occurs 1 to 2 weeks after birth, and the morphology is significantly different from that of normal rats. The phenotype is severe, and if not supplemented with artificial feeding, the survival period does not exceed 1 month. The upper and lower bodies of the sick rats are reversely twisted, and high-frequency tremors occur in the limbs, accompanied by obvious dystonia. They are unable to crawl normally and eat independently, and need to be artificially fed three times a day.

[0014] The present invention also provides a targeting system for constructing a Cayman ataxia rat model, wherein the Cayman ataxia rat model is an ATCAY:c.115G>A gene-edited rat, and the targeting system comprises: sgRNA, a donor oligonucleotide, and Cas9 mRNA.

[0015] The present invention also provides the use of the rat model obtained by the above construction method in the study of Cayman ataxia, which is for the purpose of non-disease treatment. The study is the study of the pathogenesis and mechanism of Cayman ataxia or the study of screening drugs for preventing or treating Cayman ataxia.

[0016] The present invention also provides the use of the rat model obtained by the above construction method in screening or preparing drugs for preventing or treating Cayman ataxia, and the purpose of the application is to treat non-diseases.

[0017] Compared with the prior art, the present invention has the following advantages: the present invention is the first to obtain a new strain of gene-edited rats with a Cayman ataxia phenotype, in which the ATCAY gene-encoded protein Caytaxin has lost its function due to the ATCAY:c.115G>A point mutation, providing a research model tool for studying the function of the ATCAY gene in Cayman ataxia and screening or preparing drugs for preventing or treating Cayman ataxia. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The schematic diagram of the target strategy of point mutation of the caytaxin protein encoding gene ATCAY of the present invention shows the genomic region of the ATCAY site, and the solid bar represents the open reading frame (ORF).

[0019] Figure 2 The figure is a sequencing diagram for genotyping of ATCAY gene point mutation gene editing rats of the present invention. 5, 7, 19, 31 are the numbers of the first founder rats Founder 5, 7, 19, 31 respectively; WT is a wild-type rat; a is the sequencing peak diagram of the PCR product of the first founder rat Founder 5 of the F0 generation, and the black arrow indicates the base mutation site; b is the base sequence of the first founder rat Founder 5, 7, 19, 31 of the F0 generation; c is the amino acid sequence of the first founder rat Founder 5, 7, 19, 31 of the F0 generation.

[0020] Figure 3 The phenotypes of homozygous mutant rats and heterozygous mutant rats edited by the ATCAY gene of the present invention are shown in the figure. a is an F2 generation ATCAY gene-edited homozygous mutant rat, which develops the disease one to two weeks after birth, and the phenotype after the onset of the disease is significantly different from that of normal rats. The upper and lower bodies of the sick rats are twisted in opposite directions, the limbs have high-frequency tremors, muscular tension disorders, cannot crawl normally, cannot eat independently, and need artificial feeding three times a day, which is consistent with the phenotype of Cayman ataxia; b is an F2 generation ATCAY gene-edited heterozygous mutant rat, the rat has no twisting of the body, no tremors in the limbs, can crawl normally, has the ability to eat, and the phenotype is no different from that of normal rats. DETAILED DESCRIPTION

[0021] The present invention accidentally discovered that a SD rat had reverse twisting of the upper and lower body and high-frequency tremors in the limbs within 1 week after birth. After whole genome sequencing of the rat, it was found that the 38th nucleotide of exon 3 of its ATCAY gene mutated from G to A (ATCAY: c.115G>A), which corresponds to Cayman ataxia caused by mutation of the human ATCAY gene. Therefore, ATCAY: c.115G>A point mutation rats were further constructed by gene editing. It was found that the constructed rats had reverse twisting of the upper and lower body 1 to 2 weeks after birth, accompanied by high-frequency tremors in the limbs, unable to crawl normally and eat independently, and required artificial feeding three times a day. The ataxia phenotype, therefore, the c.115G>A mutation of the rat ATCAY gene by gene editing can obtain a Cayman ataxia rat model.

[0022] The following will describe the implementation methods of the present invention in detail in conjunction with embodiments, so that the implementation process of how the present invention applies technical means to solve technical problems and achieve technical effects can be fully understood and implemented accordingly.

[0023] Example 1 (1) Based on the mutation site of the ATCAY gene in spontaneously mutated SD rats with dystonia phenotypes such as reverse twisting of the upper and lower body and high-frequency tremors in the limbs, sgRNA and donor oligonucleotides (sequences are shown below) were designed, and CRISPR / Cas9 technology was used to construct a gene that mutates the 38th nucleotide of exon 3 of the ATCAY gene from G to A ( Figure 1 ) that is, ATCAY:c.115G>A point mutation rats.

[0024] The sequence near the wild-type allele target site before mutation is: ACCGCTCCCAGAAGACACCGGGGAGGATCACCTGGGC(GGC)ACGGTGGAAGACTCCTCCT (SEQ ID NO.5). The sequence near the wild-type allele target site after mutation is ACCGCTCCCAGAAGACACCGGGGAGGATCACCTGGGC(AGC)ACGGTGGAAGACTCCTCCT (SEQ ID NO.6). After successful mutation, the sequence in brackets of the wild-type allele will be replaced by the sequence in brackets of the mutant allele.

[0025] sgRNA sequence: GGATCACCTGGGCGGCACGG-TGG (SEQ ID NO. 1).

[0026] Donor oligonucleotide sequence: ACCGCTCCCAGAAGACACCGGGGAGGATCACCTGGGCAGCACGGTGGAAGACTCCTCCT (SEQ ID NO. 2).

[0027] (2) Mix the two single-stranded oligonucleotide sgRNAs, anneal at 95°C for 5 minutes, and then cool naturally to room temperature to form a double-stranded strand. Under the action of T4 DNA ligase, connect the formed double-stranded sgRNA to the linearized pGK1.1 vector to construct the sgRNA expression vector pGK1.1-sgRNA. Subsequently, the recombinant plasmid was transformed into DH5α competent cells, and the correctly inserted recombinant plasmid was identified by screening positive clones containing the kanamycin resistance gene and combining target DNA sequencing. After selecting the correct colony clone, amplification culture was performed, and plasmid DNA was extracted to prepare a template for in vitro transcription. Further in vitro transcription was performed to obtain active sgRNA.

[0028] (3) Cas9 expression plasmid (Addgene No. 44758) was used to obtain Cas9 mRNA through in vitro transcription.

[0029] (4) The donor oligonucleotide sequence is directly synthesized by the company, and the obtained donor oligonucleotide is used for injection.

[0030] (5) The above-mentioned active sgRNA, Cas9 mRNA and donor oligonucleotide are mixed and microinjected into fertilized eggs of SD rats, and then the injected embryos are transplanted into the oviducts of surrogate SD rats for development.

[0031] (6) PCR identification of positive gene-edited rats: 9-14 days after the birth of F0 rats, toe clipping was used for marking and tissue samples were collected. Genomic DNA was extracted and PCR was performed using specific primers to confirm the gene editing. The detection primer sequences are as follows: Upstream primer: 5-′ TTCAATGCATTCCTCCTGCT-3′ (SEQ ID NO. 3); Downstream primer: 5-′ TCTTACCCTTGTTGGCCTTG-3′ (SEQ ID NO. 4). The positive PCR test was used as the experimental group, and the negative test was used as the wild-type control group. The F0 rats 5, 7, 19, and 31 with the target gene point mutation were confirmed again by sequencing the PCR products. Figure 2 As shown, the nucleotide at position 38 of the third exon of the atcay gene in F0 rats mutated from G to A, and the corresponding amino acid changed from glycine to serine.

[0032] (7) The obtained F0 positive rats were mated with wild-type SD rats to breed F1 generation rats. After PCR identification and sequencing confirmation, a total of 12 F1 generation heterozygous rats were obtained. Their bodies had no twisting, their limbs had no tremors, they could crawl normally, and they had the ability to eat. Their phenotypes were no different from normal rats.

[0033] (8) The F1 generation heterozygous rats were self-fertilized to obtain the F2 generation rats. After PCR identification and sequencing confirmation, a total of 38 F2 generation ATCAY:c.115G>A homozygous mutant rats were obtained. The phenotypes of the F2 generation homozygous mutant rats and heterozygous rats were observed, and the following phenotypes were found in the F2 homozygous mutant rats: Figure 3 ): The disease occurs one to two weeks after birth, and the phenotype after the onset of the disease is significantly different from that of normal rats. The upper and lower bodies of the sick rats are twisted in the opposite direction, and the limbs show dystonia phenotypes such as high-frequency tremors. They cannot crawl normally and cannot eat independently. They need to be artificially fed three times a day (if not supplemented with artificial feeding, the survival period does not exceed 1 month old). They meet the phenotype of Cayman ataxia and can be used as an effective model for studying Cayman ataxia; the phenotype of the F2 generation heterozygous mutant rats is no different from that of normal rats.

[0034] The above examples illustrate and describe the discovery, identification and example phenotypes of the present invention, but as mentioned above, it should be understood that the present invention is not limited to the form disclosed herein, and should not be regarded as excluding other embodiments, but can be used in various other combinations, modifications, and can be modified within the scope of the present invention through the above teachings or the technology or knowledge of the relevant field. The changes and modifications made by those skilled in the art do not depart from the spirit and scope of the present invention, and should all be within the scope of protection of the present invention.

Claims

1. A method for constructing a Cayman ataxia rat model, characterized in that: The method comprises: mutating the 38th nucleotide of exon 3 of rat ATCAY gene into A.

2. The method for constructing a Cayman ataxia rat model according to claim 1, characterized in that: Methods for mutating the 38th nucleotide in exon 3 of the rat ATCAY gene to A include CRISPR / Cas9, ZFN, and TALEN.

3. The method for constructing a Cayman ataxia rat model according to claim 1, characterized in that: The CRISPR / Cas9 gene editing technology was used to mutate the 38th nucleotide of exon 3 of the rat ATCAY gene into A.

4. The method for constructing a Cayman ataxia rat model according to claim 1, characterized in that: The following steps are involved: (1) Obtaining active sgRNA and Cas9 mRNA; (2) mixing the active sgRNA, Cas9 mRNA and donor oligonucleotide sequence and microinjecting them into rat fertilized eggs, transplanting the fertilized eggs into the oviducts of surrogate mice for gestation, and obtaining F0 generation rats; (3) The F0 generation positive rats were crossed with wild rats to obtain the F1 generation ATCAY gene heterozygous mutant rats; the F1 generation ATCAY gene heterozygous mutant rats were self-fertilized to obtain the F2 generation ATCAY gene homozygous mutant rats, thus obtaining the Cayman ataxia rat model.

5. The method for constructing a Cayman ataxia rat model according to claim 4, characterized in that: In step (1), the sequence of the sgRNA is: GGATCACCTGGGCGGCACGG-TGG.

6. The method for constructing a Cayman ataxia rat model according to claim 4, characterized in that: In step (2), the sequence of the donor oligonucleotide is: ACCGCTCCCAGAAGACACCGGGGAGGATCACCTGGGCAGCACGGTGGAAGACTCCTCCT.

7. The method for constructing a Cayman ataxia rat model according to claim 1, characterized in that: The rats are SD rats.

8. A targeting system for constructing a Cayman ataxia rat model, characterized in that: It comprises sgRNA, donor oligonucleotide and Cas9 mRNA; the targeting system is used to mutate the 38th nucleotide of exon 3 of rat ATCAY gene into A.

9. Use of a rat model constructed by the method described in any one of claims 1 to 7 in the study of Cayman ataxia, characterized in that: The application is for the purpose of treating non-diseases.

10. Use of a rat model constructed by the method according to any one of claims 1 to 7 in screening or preparing drugs for preventing or treating Cayman ataxia, characterized in that: The application is for the purpose of treating non-diseases.

Images