A method for constructing a Cayman ataxia rat model and its application

The CRISPR/Cas9 gene editing technology introduced the c.115G>A mutation of the ATCAY gene in rats was constructed, a rat model with a Cayman ataxia phenotype was solved, and the existing model was unable to fully simulate the disease phenotype was provided, providing an effective tool for studying disease mechanisms and screening drugs.

CN119913206BActive Publication Date: 2025-06-24PEKING UNION MEDICAL COLLEGE HOSPITAL +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510412501.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-03
Publication Date
2025-06-24
Estimated Expiration
2045-04-03

AI Technical Summary

Technical Problem

The existing ATCAY gene mutation animal models cannot fully simulate the human disease phenotype of Cayman ataxia, and cannot effectively study the pathogenesis of the disease and screen drugs.

Method used

Through CRISPR/Cas9 gene editing technology, the nucleotide 38 of the ATCAY gene exon 3 of rats was mutated from G to A, and the c.115G>A mutation was introduced, and the encoding protein G39S mutation occurred, thereby constructing a rat model with a Cayman ataxia phenotype.

Benefits of technology

The constructed Cayman ataxia rat model showed serious symptoms such as dystonia, ataxia gait and trunk ataxia, and could serve as an effective model for studying the pathogenesis of Cayman ataxia and screening therapeutic drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119913206B_ABST
    Figure CN119913206B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for constructing a Cayman ataxia rat model and its application, belonging to the technical field of animal models. The method for constructing the Cayman ataxia rat model of the present invention is to mutate the 38th nucleotide of exon 3 of the ATCAY gene of the rat from G to A. The Cayman ataxia rat model constructed by the present invention provides a research model tool for studying the function of the ATCAY gene in Cayman ataxia and screening or preparing drugs for preventing or treating Cayman ataxia.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of animal models, and particularly relates to a method for constructing a Cayman ataxia rat model and its application. Background Art

[0002] Cayman ataxia is an autosomal recessive genetic disease. Patients with this disease have symptoms such as dystonia, ataxic gait, and truncal ataxia from birth. Researchers have localized the cause of this disease to mutations in the ATCAY gene on human 19p13.3. So far, four mutations have been found in this gene, including one missense mutation, one splicing mutation, and two frameshift mutations. The ATCAY gene encodes a caytaxin protein that exists only in neuronal tissues. This protein is highly expressed at the presynaptic site of GABAergic neurons. The highly conserved homologous domain it contains is considered to be closely related to the function of the caytaxin protein. However, so far, no study has systematically elucidated the function of the caytaxin protein in the body's nervous system.

[0003] Animal models are the main tools for studying the pathogenesis of human diseases, screening drug treatment targets, and developing treatment methods. Among them, gene-edited animal models can more accurately simulate human disease phenotypes and pathological characteristics, and have very broad research and application prospects. Currently, there are the following four types of ATCAY gene mutation animal models: the jittery mouse model with insertion of the B1 element in exon 3, the hesitant mouse model with insertion of the IAP element in intron 1, the sidewinder mouse model with a 2-bp deletion in intron 5, and the BNIP-H knockdown zebrafish model. However, the above animal models focus on the dystonia caused by gene mutations and cannot fully simulate the human disease phenotype of Cayman ataxia. Therefore, the technical field urgently needs to solve the technical problem of how to obtain a disease animal model that can provide research on the pathogenesis of Cayman ataxia and drug screening. Summary of the Invention

[0004] Aiming at the problem that the existing ATCAY gene mutation animal models cannot fully simulate the Cayman ataxia phenotype, the purpose of the present invention is to provide a method for constructing a rat model that more conforms to the Cayman ataxia phenotype. The purpose of the present invention is also to provide the application of the constructed Cayman ataxia rat model.

[0005] The purpose of the present invention is achieved by the following technical solutions:

[0006] The present invention provides a method for constructing a Cayman ataxia rat model, which includes: mutating the 38th nucleotide of exon 3 of the rat ATCAY gene from G to A, that is, causing a c.115G>A mutation in the rat ATCAY gene and a G39S mutation in the encoded protein.

[0007] In some embodiments, the method for mutating the 38th nucleotide of exon 3 of the ATCAY gene in rats from G to A includes gene editing techniques such as CRISPR / Cas9, ZFN (zinc finger nuclease), and TALEN (transcription activator-like effector nuclease), and preferably the CRISPR / Cas9 gene editing technique is used to achieve it.

[0008] In some embodiments, the method for constructing the Cayman ataxia rat model includes the following steps:

[0009] (1) Obtain active sgRNA and Cas9 mRNA through in vitro transcription.

[0010] (2) Mix the active sgRNA, Cas9 mRNA, and donor oligonucleotide sequence and then microinject them into rat fertilized eggs. Transplant the fertilized eggs into the oviduct of a surrogate rat for gestation to obtain F0 generation rats;

[0011] (3) Cross the F0 generation positive rats with wild rats to obtain F1 generation ATCAY gene heterozygous mutant rats; self-cross the F1 generation ATCAY gene heterozygous mutant rats to obtain F2 generation ATCAY gene homozygous mutant rats, that is, obtain the Cayman ataxia rat model.

[0012] In step (1), the sequence of the sgRNA is preferably: GGATCACCTGGGCGGCACGG-TGG (SEQ ID NO.1).

[0013] In step (2), the sequence of the donor oligonucleotide is preferably: ACCGCTCCCAGAAGACACCGGGGAGGATCACCTGGGCAGCACGGTGGAAGACTCCTCCT (SEQ ID NO.2).

[0014] In step (3), the mutation situation of the rat ATCAY gene is preferably detected by PCR using the following primers:

[0015] Forward primer: 5-′ TTCAATGCATTCCTCCTGCT-3′ (SEQ ID NO.3);

[0016] Reverse primer: 5-′ TCTTACCCTTGTTGGCCTTG-3′ (SEQ ID NO.4).

[0017] In the method for constructing the Cayman ataxia rat model, the rats are preferably SD rats.

[0018] The Cayman ataxia rat model obtained through the above construction method exhibits the following phenotypes: Diseased rats develop symptoms 1 to 2 weeks after birth, with significant morphological differences from normal rats, severe phenotypes, and a survival period of no more than 1 month without artificial feeding. The upper and lower bodies of diseased rats show reverse twisting, their limbs exhibit high-frequency tremors, accompanied by obvious dystonia, and they are unable to crawl and feed independently, requiring artificial feeding three times a day.

[0019] The present invention also provides a targeting system for constructing a Cayman ataxia rat model. The Cayman ataxia rat model is a gene-edited rat with the ATCAY:c.115G>A gene. The targeting system includes: sgRNA, donor oligonucleotide, and Cas9 mRNA.

[0020] The present invention also provides the application of the rat model obtained through the above construction method in the research of Cayman ataxia disease, and this application is for non-disease treatment purposes. The research is for studying the pathogenesis and mechanism of Cayman ataxia disease or screening drugs for preventing or treating Cayman ataxia disease.

[0021] The present invention also provides the application of the rat model obtained through the above construction method in screening or preparing drugs for preventing or treating Cayman ataxia, and this application is for non-disease treatment purposes.

[0022] Compared with the prior art, the present invention has the following advantages: The present invention for the first time obtains a new strain of gene-edited rats with the loss of function of the Caytaxin protein encoded by the ATCAY gene caused by the ATCAY:c.115G>A point mutation and with Cayman ataxia phenotypes, providing a research model tool for studying the function of the ATCAY gene in Cayman ataxia and screening or preparing drugs for preventing or treating Cayman ataxia. Description of the Drawings

[0023] Figure 1 It is a schematic diagram of the target strategy for point mutation of the ATCAY gene, the protein-coding gene of the caytaxin protein of the present invention. The genomic region of the ATCAY locus is shown in the figure, and the solid bar represents the open reading frame (ORF).

[0024] Figure 2 It is the sequencing map for genotype identification of the ATCAY gene point mutation gene-edited rats of the present invention. 5, 7, 19, and 31 are the founder numbers of the founder rats Founder 5, 7, 19, and 31 respectively; WT is the wild-type rat; a is the sequencing peak map of the PCR product of the F0 generation founder rat Founder 5, and the base mutation site is marked by the black arrow; b is the base sequence of the F0 generation founder rats Founder 5, 7, 19, and 31; c is the amino acid sequence of the F0 generation founder rats Founder 5, 7, 19, and 31.

[0025] Figure 3 This is a phenotypic example diagram of the homozygous mutant rats and heterozygous mutant rats with ATCAY gene editing of the present invention. a is a homozygous mutant rat with ATCAY gene editing in the F2 generation, which becomes ill one to two weeks after birth. After the onset of the disease, its phenotype is significantly different from that of normal rats. The upper and lower body of the diseased rat is twisted in the opposite direction, the limbs tremble frequently, there is dystonia, it cannot crawl normally, and it cannot eat independently, requiring artificial feeding three times a day, which conforms to the Cayman ataxia phenotype; b is a heterozygous mutant rat with ATCAY gene editing in the F2 generation. This rat has no body twist, no limb tremors, can crawl normally, and has the ability to eat. Its phenotype is no different from that of normal rats. Detailed implementation mode

[0026] The present invention accidentally discovered that a SD rat showed phenotypes such as dystonia with the upper and lower body twisted in the opposite direction and frequent tremors in the limbs within 1 week after birth. After whole-genome sequencing of the rat, it was found that the 38th nucleotide of exon 3 of its ATCAY gene was mutated from G to A (ATCAY:c.115G>A), corresponding to the Cayman ataxia caused by the mutation of the human ATCAY gene. Then, further through gene editing means, an ATCAY:c.115G>A point mutant rat was constructed, and it was found that the constructed rat had phenotypes of ataxia with the upper and lower body twisted in the opposite direction 1 to 2 weeks after birth, accompanied by frequent tremors in the limbs, unable to crawl normally and eat independently, and requiring artificial feeding three times a day. Therefore, by using gene editing means to mutate the rat ATCAY gene to c.115G>A, a Cayman ataxia rat model can be obtained.

[0027] The following will describe in detail the implementation mode of the present invention in combination with embodiments, so as to fully understand how the present invention uses technical means to solve technical problems and achieve the realization process of technical effects and implement accordingly.

[0028] Example 1

[0029] (1) According to the mutation site of the ATCAY gene of a spontaneously mutated SD rat with phenotypes such as dystonia with the upper and lower body twisted in the opposite direction and frequent tremors in the limbs, sgRNA and donor oligonucleotides were designed (the sequences are shown below), and the 38th nucleotide of exon 3 of the ATCAY gene was mutated from G to A ( Figure 1 ) that is, an ATCAY:c.115G>A point mutant rat was constructed using the CRISPR / Cas9 technology.

[0030] The sequence near the target of the wild-type allele before mutation was: ACCGCTCCCAGAAGACACCGGGGAGGATCACCTGGGC(GGC)ACGGTGGAAGACTCCTCCT (SEQ ID NO.5). The sequence near the target of the wild-type allele after mutation was ACCGCTCCCAGAAGACACCGGGGAGGATCACCTGGGC(AGC)ACGGTGGAAGACTCCTCCT (SEQ ID NO.6). After successful mutation, the sequence in the parentheses of the wild-type allele will be replaced by the sequence in the parentheses of the mutant allele.

[0031] sgRNA sequence: GGATCACCTGGGCGGCACGG-TGG (SEQ ID NO.1).

[0032] Donor oligonucleotide sequence: ACCGCTCCCAGAAGACACCGGGGAGGATCACCTGGGCAGCACGGTGGAAGACTCCTCCT (SEQ ID NO.2).

[0033] (2) Mix two single-stranded oligonucleotide sgRNAs, anneal them at 95 °C for 5 min and then let them cool to room temperature naturally to form double strands. Under the action of T4 DNA ligase, ligate the formed double-stranded sgRNA with the linearized pGK1.1 vector to construct the sgRNA expression vector pGK1.1-sgRNA. Subsequently, transform the recombinant plasmid into DH5α competent cells, and identify the correctly inserted recombinant plasmid by screening positive clones containing the kanamycin resistance gene and combining with target DNA sequencing. After selecting the correct colony clones, perform amplification culture and extract plasmid DNA to prepare a template for in vitro transcription. Further, obtain active sgRNA through in vitro transcription.

[0034] (3) Obtain Cas9 mRNA by in vitro transcription of the Cas9 expression plasmid (Addgene No. 44758).

[0035] (4) The donor oligonucleotide sequence was directly synthesized by the company, and the obtained donor oligonucleotide was used for injection.

[0036] (5) Mix the above-mentioned active sgRNA, Cas9 mRNA and donor oligonucleotide and then microinject them into the fertilized eggs of SD rats. Then transplant the injected embryos into the oviducts of surrogate SD rats for development.

[0037] (6) PCR identification of positive gene-edited rats: 9-14 days after the birth of F0 rats, toe clipping was used for marking and tissue samples were collected. Genomic DNA was extracted and PCR was performed using specific primers to confirm the gene editing. The detection primer sequences are as follows:

[0038] Upstream primer: 5-′ TTCAATGCATTCCTCCTGCT-3′ (SEQ ID NO. 3);

[0039] Downstream primer: 5-′ TCTTACCCTTGTTGGCCTTG-3′ (SEQ ID NO. 4).

[0040] The positive PCR test was used as the experimental group, and the negative test was used as the wild-type control. The F0 rats 5, 7, 19, and 31 with the target gene point mutation were confirmed again by sequencing of the PCR products. Figure 2 As shown, the nucleotide at position 38 of the third exon of the atcay gene in F0 rats mutated from G to A, and the corresponding amino acid changed from glycine to serine.

[0041] (7) The obtained F0 positive rats were mated with wild-type SD rats to breed F1 generation rats. After PCR identification and sequencing confirmation, a total of 12 F1 generation heterozygous rats were obtained. Their bodies had no twisting, their limbs had no tremors, they could crawl normally, and they had the ability to eat. Their phenotypes were no different from normal rats.

[0042] (8) The F1 generation heterozygous rats were self-fertilized to obtain the F2 generation rats. After PCR identification and sequencing confirmation, a total of 38 F2 generation ATCAY:c.115G>A homozygous mutant rats were obtained. The phenotypes of the F2 generation homozygous mutant rats and heterozygous rats were observed, and the following phenotypes were found in the F2 homozygous mutant rats: Figure 3 ): The disease occurs one to two weeks after birth, and the phenotype after the onset of the disease is significantly different from that of normal rats. The upper and lower bodies of the sick rats are twisted in the opposite direction, and the limbs show dystonia phenotypes such as high-frequency tremors. They cannot crawl normally and cannot eat independently. They need to be artificially fed three times a day (if not supplemented with artificial feeding, the survival period does not exceed 1 month old). They meet the phenotype of Cayman ataxia and can be used as an effective model for studying Cayman ataxia; the phenotype of the F2 generation heterozygous mutant rats is no different from that of normal rats.

[0043] The above examples illustrate and describe the discovery, identification and example phenotypes of the present invention, but as mentioned above, it should be understood that the present invention is not limited to the form disclosed herein, and should not be regarded as excluding other embodiments, but can be used in various other combinations, modifications, and can be modified within the scope of the present invention through the above teachings or the technology or knowledge of the relevant field. The changes and modifications made by those skilled in the art do not depart from the spirit and scope of the present invention, and should all be within the scope of protection of the present invention.

Claims

1. A method for constructing a Cayman ataxia rat model, characterized in that: The method comprises: mutating the 38th nucleotide of exon 3 of the rat ATCAY gene into A; comprising the following steps: (1) Obtaining active sgRNA and Cas9 mRNA; The sequence of the sgRNA is: GGATCACCTGGGCGGCACGG-TGG; (2) mixing the active sgRNA, Cas9 mRNA and donor oligonucleotide sequence and microinjecting them into rat fertilized eggs, transplanting the fertilized eggs into the oviducts of surrogate mice for gestation, and obtaining F0 generation rats; The sequence of the donor oligonucleotide is: ACCGCTCCCAGAAGACACCGGGGAGGATCACCTGGGCAGCACGGTGGAAGACTCCTCCT; The rats are SD rats; (3) The F0 generation positive rats were crossed with wild rats to obtain the F1 generation ATCAY gene heterozygous mutant rats; the F1 generation ATCAY gene heterozygous mutant rats were self-fertilized to obtain the F2 generation ATCAY gene homozygous mutant rats, thus obtaining the Cayman ataxia rat model.

2. A targeting system for constructing a Cayman ataxia rat model, characterized in that: It comprises sgRNA, donor oligonucleotide and Cas9 mRNA; the targeting system is used to mutate the 38th nucleotide of exon 3 of rat ATCAY gene into A; The sequence of the sgRNA is: GGATCACCTGGGCGGCACGG-TGG; The sequence of the donor oligonucleotide is: ACCGCTCCCAGAAGACACCGGGGAGGATCACCTGGGCAGCACGGTGGAAGACTCCTCCT; The rats are SD rats.

3. An application of a rat model constructed by the method of claim 1 in the study of Cayman ataxia, characterized in that: The application is for the purpose of treating non-diseases.

4. Use of a rat model constructed by the method of claim 1 in screening or preparing drugs for preventing or treating Cayman ataxia, characterized in that: The application is for the purpose of treating non-diseases.

Citation Information

Patent Citations

  • Knock-in mouse model of new mutation pathogenic site C104G of Anxa11 gene as well as construction method and application of knock-in mouse model

    CN117859703A

  • Knock-in mouse model of new pathogenic mutation c.1143delC of SQSTM1 / p62 gene and construction method of knock-in mouse model

    CN117887760A