SLAMP primer group and kit for detecting Elizabeth anopheles

Abstract

The invention relates to a rapid detection technology for Elizabethkingia anopheles EA (Elizabethkingia anopheles) based on an improved short-chain neck loop-mediated isothermal nucleic acid amplification (SLAMP) technology, in particular to a rapid detection technology for Elizabethkingia anopheles EA (Elizabethkingia anopheles EA (Elizabethia anopheles EA) based on the improved short-chain neck loop-mediated isothermal nucleic acid amplification technology (SLAMP) and a rapid detection method for Elizabethia anopheles EA (Elizabethia anopheles EA (Elizabethia anopheles EA. The invention discloses an SLAMP (Single Loop-Mediated Isothermal Amplification) primer group for detecting Elizabeth anopheles, a kit and application of the SLAMP primer group. The SLAMP primer group is a primer group aiming at the amplification of a conserved region fragment of the Elizabeth anopheles, and is a primer pair EA-SF / EA-SR; wherein the nucleotide sequence of the EA-SF is as shown in SEQ ID NO. 1, and the nucleotide sequence of the EA-SR is as shown in SEQ ID NO. 2. According to the method or the visual kit provided by the invention, rapid and accurate detection of the Elizabeth anopheles can be completed without expensive instruments or complicated operation, so that the method or the visual kit is suitable for on-site rapid detection in a scene with a low professional degree.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and in particular relates to a SLAMP primer set and a kit for detecting Elizabethkingia anophelis (EA) and applications thereof. Background Art

[0002] Elizabethkingia anophelis is a Gram-negative, obligately aerobic, non-spore-forming, non-fermenting, non-motile, slender, slightly curved rod. Elizabethkingia anophelis can cause cerebrospinal meningitis in premature infants and neonates, cerebrospinal meningitis in immunocompromised people, bloodstream and respiratory infections. However, the bacteria are difficult to identify, and its epidemiology, transmission routes, and pathogenic factors are also poorly understood. Its infection is mainly caused by nosocomial infection, most of which show a high mortality rate and are rarely encountered in clinical practice. Early identification of pathogens and conducting drug sensitivity tests are important bases for the treatment of Elizabethkingia infections.

[0003] The classic detection method for Anopheles Elizabethella is isolation and culture, which is time-consuming. Other relatively fast and accurate methods include RT-PCR-based detection of amplification signals of Anopheles Elizabethella DNA, which only requires a few bacteria per milliliter to detect positive results, and the results can be obtained in 1-2 days.

[0004] Among the existing detection methods, PCR, DNA probe technology, etc. Although these technologies can quickly detect the number of Anopheles Elizabeth bacteria in samples, these methods rely on special and expensive equipment, and their operation process is complicated and time-consuming (including DNA separation, hybridization, colorimetry, and synthesis of probes and primers, etc.). Only technicians who are proficient in their operation skills can complete the test. Therefore, the above methods are not suitable for rapid on-site detection, and it is urgent to establish a rapid, sensitive, and specific method for detecting Anopheles Elizabeth bacteria.

[0005] Short loop mediated isothermal amplification of nucleic acids (SLAMP) is a nucleic acid amplification technology under constant temperature conditions (Chinese patent application number: 202411655233.5) recently improved and developed by the inventor team based on the CDA technology (Chinese patent authorization number: ZL202110473121.8) and the Japanese LAMP nucleic acid amplification method developed in the early stage.

[0006] The SLAMP method (Chinese patent application number: 202411655233.5) developed by the research team in the early stage mainly uses two different specific primers to identify specific regions of the target gene and perform amplification reactions under constant temperature conditions. Compared with conventional gene detection methods (such as PCR, etc.), the SLAMP reaction can be completed in a constant temperature water bath, with low instrumentation requirements, much simpler than traditional PCR and culture methods, and can be accurately completed without professionals. The amplification results can be combined with the metal ion indicator hydroxynaphthol blue (HNB), and the color changes can be observed by naked eye to achieve the judgment of the results, making it suitable for primary medical institutions and local inspection and quarantine departments. In addition, SLAMP can also greatly shorten the operation time and reduce the chance of sample contamination, making it suitable for the rapid diagnosis of Anopheles Elizabeth bacteria. In addition, the key looping primer used in SLAMP is about 30bp, which is shorter than the 40bp looping primer in LAMP. The design of the relevant primers is extremely simple, and only simple rearrangement is required, which will greatly save design time and development costs. Summary of the invention

[0007] The purpose of the present invention is to provide a SLAMP primer set, a kit and application thereof for detecting Anopheles elizabethii, and solve the technical problems of complex operation and high cost in the prior art.

[0008] In order to achieve the above object, the present invention adopts the following technical solution: a SLAMP primer set for detecting Anopheles elizabethii for non-disease diagnosis purposes, wherein the SLAMP primer set is the following pair of primers:

[0009] The primer pair is EA-SF / EA-SR, wherein the nucleotide sequence of EA-SF is shown in SEQ ID NO.1, and the nucleotide sequence of EA-SR is shown in SEQ ID NO.2.

[0010] The present invention also provides a kit for detecting Anopheles elizabethii, wherein the kit comprises the above-mentioned SLAMP primer set.

[0011] As a further description of the above technical solution:

[0012] In the SLAMP primer set, the concentrations of primers EA-SF and EA-SR are both 1 to 2 μM.

[0013] As a further description of the above technical solution:

[0014] The kit also includes Bst polymerase, SLAMP reaction buffer, ultrapure water and a color developer.

[0015] As a further description of the above technical solution:

[0016] The color developer is selected from one of SYBR green I, Eva green, hydroxynaphthol blue and chrome black T.

[0017] As a further description of the above technical solution:

[0018] The SLAMP reaction buffer comprises: Tris-HCl, KCl, (NH4)2SO4, MgSO4 and Triton X-100.

[0019] As a further description of the above technical solution:

[0020] The reaction system of the kit is composed of:

[0021] 2-50mM Tris-HCl pH8.8

[0022] 2-20mM KCl

[0023] 2-20mM(NH4)2SO4

[0024] 2~20mM MgSO4

[0025] 0.1~0.5%Triton X-100

[0026] 0.2~1M Betaine

[0027] 1~1.6mM dNTP

[0028] 5~10U Bst DNA polymerase

[0029] 100~150μmol / L colorimetric reagent

[0030] 1~2μM primer EA-SF

[0031] 1-2 μM primer EA-SR;

[0032] The reaction solvent was ultrapure water.

[0033] The present invention also provides a method for detecting Anopheles Elizabethellae using the kit for non-disease diagnosis purposes, comprising the following steps:

[0034] Step 1, mixing the nucleic acid sample to be detected and the reaction system of the kit to prepare an amplification reaction solution;

[0035] Step 2, the amplification reaction solution prepared above is reacted at 60-65° C. for 20-80 minutes, and whether the sample contains Anopheles Elizabethella is determined based on the color development result.

[0036] The present invention also provides the use of the SLAMP primer set in the detection of Anopheles Elizabethella for non-disease diagnosis purposes.

[0037] The present invention also provides the use of the kit in the detection of Anopheles Elizabethella for non-disease diagnosis purposes.

[0038] The present invention has the following beneficial effects:

[0039] 1. The present invention designs multiple primer sets based on the specific conserved region of Anopheles Elizabethella (GenBank: AP022313.1), and screens out the primer set with the highest amplification efficiency. The primer set consists of 2 primers, including an intra-sequence primer pair (EA-SF / EA-SR) which are upstream and downstream external primers. The primer set provided by the present invention has high sensitivity and strong specificity, and the kit made therefrom can quickly and accurately detect Anopheles Elizabethella contained in the sample to be tested. The specific primer nucleotide sequences are shown in Table 1:

[0040] Table 1 Primer sequences

[0041]

[0042] 2. Since the primer set provided by the present invention has extremely high specificity, the time required for SLAMP amplification is short, which further shortens the detection time and simplifies the operation.

[0043] 3. The method or kit provided by the present invention can complete the rapid and accurate detection of Anopheles Elizabethella without expensive instruments or complicated operations, and is therefore suitable for on-site rapid detection in airports, customs, ports, communities, etc. where the level of expertise is not high. The visualization kit provided by the present invention will greatly facilitate on-site detection and can achieve rapid and accurate detection of Anopheles Elizabethella. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 This is a curve diagram showing the change of fluorescence intensity with reaction time in Example 1 of the present invention.

[0045] Figure 2 This is a curve diagram showing the change of fluorescence intensity with reaction time in Example 2 of the present invention.

[0046] Figure 3 This is an endpoint monitoring diagram based on color change of the reaction using HNB in ​​Example 3 of the present invention. DETAILED DESCRIPTION

[0047] The technical scheme of the present invention is described in detail below in conjunction with the examples. The experimental methods used in the following examples are conventional methods unless otherwise specified, and can be specifically performed with reference to the specific methods listed in the book Molecular Cloning Experiment Guide (3rd Edition) by J. Sambrook, or according to the kit and product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0048] Example 1: Application of Eva Green to verify the amplification reaction of the conserved sequence DNA fragment of Anopheles elizabethii

[0049] Eva Green is similar to SYBR Green I. It is a dye with a green excitation wavelength that binds to all DNA double helix minor groove regions. Its inhibitory effect on nucleic acid amplification reactions such as PCR is much less than that of the latter. In the free state, EvaGreen emits weak fluorescence, but once it binds to double-stranded DNA, the fluorescence is greatly enhanced. Therefore, the fluorescence signal intensity of Eva Green is related to the amount of double-stranded DNA, and the amount of double-stranded DNA in the nucleic acid amplification system can be detected based on the intensity of the fluorescence signal.

[0050] The reaction solution was composed as follows (add ddH2O to make up to 25 μL):

[0051] 20mM Tris-HCl pH8.8

[0052] 10mM KCl

[0053] 10mM(NH4)2SO4

[0054] 14mM MgSO4

[0055] 0.1% Triton X-100

[0056] 1M Betaine

[0057] 1.25mM dNTP

[0058] 8U Bst DNA polymerase (NEW ENGLAND Biolabs)

[0059] 1◇Eva Green (Biotum)

[0060] Primers:

[0061] 1600nM EA-SF (shown in SEQ ID NO.1)

[0062] 1600nM EA-SR (shown in SEQ ID NO.2)

[0063] Target: Extraction of genomic DNA from Anopheles elizabethii

[0064] At the same time, two control groups with and without targets were set up.

[0065] The SLAN 96 real time PCR reaction temperature was set to 63°C and the reaction time was 60 min. The curve of fluorescence intensity versus reaction time is shown in Figure 1 shown. Figure 1 The results show that the primer set provided by the present invention can realize the rapid amplification of the genome extracted from Anopheles elizabethii, and the application of fluorescence detection therein can realize the purpose of real-time monitoring, and the result can be judged in advance by observing the real-time amplification curve.

[0066] Example 2: Application of Eva Green to verify the amplification reaction of Anopheles elizabethii SLAMP on genomes extracted from various bacteria

[0067] The method is the same as in Example 1.

[0068] The reaction solution was composed as follows (add ddH2O to make up to 25 μL):

[0069] 20mM Tris-HCl pH8.8

[0070] 10mM KCl

[0071] 10mM(NH4)2SO4

[0072] 14mM MgSO4

[0073] 0.1% Triton X-100

[0074] 1M Betaine

[0075] 1.25mM dNTP

[0076] 8U Bst DNA polymerase (NEW ENGLAND Biolabs)

[0077] 1◇Eva Green (Biotum)

[0078] Primers:

[0079] 1600nM EA-SF (shown in SEQ ID NO.1)

[0080] 1600nM EA-SR (shown in SEQ ID NO.2)

[0081] Target nucleic acid 1: Anopheles elizabethii genomic DNA (target fragment sequence is shown in SEQ ID NO.3), set as positive control

[0082] Target nucleic acid 2: Genomic DNA extracted from Listeria monocytogenes, set as negative control

[0083] Target nucleic acid 3: Shigella genomic DNA extracted, set as negative control

[0084] Target nucleic acid 4: Genomic DNA extracted from Haemophilus influenzae, set as negative control

[0085] Target nucleic acid 5: Genomic DNA extracted from Staphylococcus aureus, set as negative control

[0086] A non-target control group was also set up.

[0087] The SLAN 96 real time PCR reaction temperature was set to 61°C and the reaction time was 60 min. The curve of fluorescence intensity versus reaction time is shown in Figure 2 shown. Figure 2 The results show that the primer set provided by the present invention can effectively distinguish Anopheles elizabethii from Listeria monocytogenes, Shigella, Haemophilus influenzae, and Staphylococcus aureus, further illustrating the specificity of the SLAMP primer set provided by the present invention.

[0088] Example 3: End point monitoring of SLAMP amplification reaction of Anopheles elizabethii using hydroxynaphthol blue (HNB)

[0089] Hydroxynaphthol blue (HNB) is a metal ion indicator that displays different indicator colors to judge the results according to the changes in the amount of magnesium ions or manganese ions combined with the by-product pyrophosphate in the reaction.

[0090] The composition of the reaction solution for SLAMP amplification of Anopheles elizabethii using hydroxynaphthol blue (HNB) is shown below.

[0091] The reaction solution is composed as follows, and ddH2O is added to the rest to make up to 25 μL

[0092] 20mM Tris-HCl pH8.8

[0093] 10mM KCl

[0094] 10mM(NH4)2SO4

[0095] 14mM MgSO4

[0096] 0.1% Triton X-100

[0097] 1M Betaine

[0098] 1.25mM dNTP

[0099] 8U Bst DNA polymerase (NEW ENGLAND Biolabs)

[0100] 120 μM HNB

[0101] Primers:

[0102] 1600nM EA-SF (shown in SEQ ID NO.1)

[0103] 1600nM EA-SR (shown in SEQ ID NO.2)

[0104] Target nucleic acid: Extract genomic DNA from Anopheles elizabethii. Set up 4 positive controls and 4 negative controls for the amplification reaction. Set the water bath reaction temperature to 61°C and the reaction time to 60 minutes. The endpoint results of the positive and negative reactions are as follows: Figure 3 As shown, violet indicates negative, and sky blue indicates positive. The experimental results show that the application of HNB can realize the judgment of the reaction result by observing the color change with naked eyes.

[0105] Sequence Listing:

[0106] <110>

[0107] SEQ ID NO.3

[0108] AAGGCGGAACATTAGTGAAGCATTACCGTGATCTTGCATTTATGGGATTTGCTGAGGTTATTCAGA

[0109] ATCTGGGGACAATTCTTGGGAATATAAAATTGTGTAAAAAAGATATTCAGGAATACAGACCCGATG

[0110] TTTTGGTGCTGATAGATTACCCCGGATTTAATTTACGGATTGCAAAGTTTGCTAAATCACTTGGAA

[0111] TAAGAGTCGTTTATTATATCTCGCCACAGTTGTGGGCATGGAAGGAAGGACGTGTAGAGATCATTA

[0112] AAAAGTATGTGGACGATATGCTGGTGATTCTCCCTTTTGAAAAAGATTTTTATAAAAAACATCAGG

[0113] TAGATGCTCACTTTGTTGGGCACCCATTGTTGGATGCTATACATAATCTGCAAGATCTAGATAAAG

[0114] ACAAATTTAAAGCTGAAAATAATCTTACAGATAAAGAGATCATTGCGTTATTACCAGGTAGTCGGA

[0115] AGCAAGAAGTAGAAAAGATGCTGGAAATTATGCTTTCTGTTCGGCCTTTCTTTCCGGACTATCAGT

[0116] TTGTAATTGCAGGAGCACCTTCGTTGGAAAAAGAATTCTATGAGCAGTATGTGGACGAT

[0117] Finally, it should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for those skilled in the art to modify the technical solutions described in the aforementioned embodiments or to make equivalent substitutions for some of the technical features therein. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A SLAMP primer set for detecting Anopheles elizabethii for non-disease diagnosis purposes, characterized in that: The SLAMP primer set is the following pair of primers, The primer pair is EA-SF / EA-SR, wherein the nucleotide sequence of EA-SF is shown in SEQ ID NO.1, and the nucleotide sequence of EA-SR is shown in SEQ ID NO.

2.

2. A kit for detecting Anopheles elizabethii, characterized in that: The kit comprises the SLAMP primer set according to claim 1.

3. A kit for detecting Anopheles elizabethii as claimed in claim 2, characterized in that: In the SLAMP primer set, the concentrations of primers EA-SF and EA-SR are both 1 to 2 μM.

4. A kit for detecting Anopheles elizabethii as claimed in claim 2, characterized in that: The kit also includes Bst polymerase, SLAMP reaction buffer, ultrapure water and a color developer.

5. A kit for detecting Anopheles elizabethii as claimed in claim 4, characterized in that: The color developer is selected from one of SYBR green I, Eva green, hydroxynaphthol blue and chrome black T.

6. A kit for detecting Anopheles elizabethii according to claim 4, characterized in that: The SLAMP reaction buffer comprises: Tris-HCl, KCl, (NH4)2SO4, MgSO4 and Triton X-100.

7. A kit for detecting Anopheles elizabethii as claimed in claim 2, characterized in that: The reaction system of the kit is composed of: 2-50mM Tris-HCl pH8.8 2-20 mM KCl 2-20mM(NH4)2SO4 2~20mM MgSO4 0.1~0.5%Triton X-100 0.2~1M Betaine 1~1.6mM dNTP 5~10U Bst DNA polymerase 100~150μmol / L colorimetric reagent 1~2μM primer EA-SF 1-2 μM primer EA-SR; The reaction solvent was ultrapure water.

8. The method for detecting Anopheles elizabethii for non-disease diagnosis purposes of the kit of claim 7, comprising the following steps: Step 1: Mix the nucleic acid sample to be detected and the reaction system of the kit to prepare an amplification reaction solution; Step 2: The amplification reaction solution prepared above is reacted at 60-65° C. for 20-80 min, and whether the sample contains Anopheles Elizabethella is determined based on the color development result.

9. Use of the SLAMP primer set according to claim 1 in the detection of Anopheles elizabethii for non-disease diagnosis purposes.

10. Use of the kit according to any one of claims 2 to 7 in the detection of Anopheles elizabethii for non-disease diagnosis purposes.

Images