SNP (Single Nucleotide Polymorphism) marker primer for rice anti-imidazolinone herbicide ALS (Acetolactate Synthase) gene and application thereof

Abstract

The invention belongs to the field of biological detection, and particularly relates to an SNP (Single Nucleotide Polymorphism) marker primer of an anti-imidazolinone herbicide ALS (Acetolactate Synthase) gene of rice and application of the SNP marker primer. Specifically, the invention provides an SNP (Single Nucleotide Polymorphism) marker primer for detecting the rice imidazolinone herbicide-resistant gene ALS, and is characterized in that the SNP marker primer comprises an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO.1, a downstream primer F2 with a nucleotide sequence as shown in SEQ ID NO.2, and a downstream primer F2 with a nucleotide sequence as shown in SEQ ID NO.3; the nucleotide sequence of the upstream primer F2 is as shown in SEQ ID NO. 2; and the nucleotide sequence of the downstream primer R is as shown in SEQ ID NO.3. The SNP marker primer provided by the invention has high sensitivity and high specificity.

Description

Technical Field

[0001] The invention belongs to the field of biological detection, and in particular relates to a SNP marker primer of a rice imidazolinone herbicide-resistant ALS gene and an application thereof. Background Art

[0002] Imidazolinone herbicides are a widely used herbicide with strong selectivity, broad spectrum and high activity. They can be mixed with soil before sowing, treated with soil surface before seedlings and sprayed on stems and leaves. They are absorbed by plant roots and leaves, and can control both annual grass and broadleaf weeds and perennial weeds. However, this type of herbicide will also cause phytotoxicity to crops that are generally not resistant (tolerant) to herbicides, which greatly limits the time and space of its use. For example, it is necessary to use herbicides some time before sowing crops to avoid phytotoxicity. Cultivating herbicide-resistant (tolerant) crop varieties can reduce crop phytotoxicity and expand the scope of use of imidazolinone herbicides. Studies have shown that acetolactate synthase (ALS) is the target enzyme of imidazolinone herbicides. When the ALS gene nucleic acid sequence mutates and causes changes in the amino acid residue sites of the encoded protein, it can cause changes in the binding mode of the herbicide and ALS to produce resistance. Therefore, it is of great significance to breed new rice varieties with resistance to imidazolinone herbicides.

[0003] In recent years, Chinese researchers have also developed some rice varieties that are resistant to imidazolinone herbicides. Among them, the earliest approved herbicide-resistant rice variety is Jinjing 818 bred by Tianjin Rice Research Institute. This variety carries genes for resistance to imidazolinone herbicides. The discovery of resistance genes has provided my country with herbicide-resistant genes with independent intellectual property rights. If molecular markers closely linked to resistance genes can be further found, marker-assisted selection can be carried out to guide field breeding and improve breeding selection efficiency.

[0004] Although there is also an electrophoresis method using primer molecules to detect resistance genes in the prior art, most primer designs are relatively complex and the operation is cumbersome, making it difficult to meet the high-throughput requirements for rice selection in rice fields. At the same time, the electrophoresis method has the disadvantages of cumbersome operation, long time consumption and relatively low sensitivity in analyzing the product, which limits the widespread application of PCR technology to a certain extent. Fluorescence quantitative PCR based on the dye method is a new technology for non-destructive detection of early rice growth that is extremely simple to operate, low in cost, short in detection time and suitable for large-throughput multi-sample simultaneous operation. It is not currently widely used in crop breeding.

[0005] Therefore, the development of a molecular marker method for detecting resistance genes that has high throughput, simultaneous detection of multiple samples, high accuracy, flexibility, and ease of operation is of great significance for commercial breeding. Summary of the invention

[0006] In order to solve the problems existing in the prior art, the purpose of the present disclosure is to provide a SNP marker primer for the rice imidazolinone herbicide-resistant ALS gene and its application.

[0007] In order to achieve the above objectives, the present disclosure adopts the following specific scheme:

[0008] In one aspect, the present disclosure provides a SNP marker primer for detecting rice imidazolinone herbicide resistance gene ALS, characterized in that the SNP marker primer comprises:

[0009] Upstream primer F1: nucleotide sequence as shown in SEQ ID NO.1;

[0010] Upstream primer F2: nucleotide sequence is shown in SEQ ID NO.2;

[0011] Downstream primer R: The nucleotide sequence is shown in SEQ ID NO.3.

[0012] On the other hand, the present disclosure provides the use of the aforementioned SNP marker primers in detecting a SNP mutation from G to A at the 1880th base of the rice ALS gene.

[0013] On the other hand, the present disclosure provides a detection kit comprising the aforementioned SNP marker primers.

[0014] In another aspect, the present disclosure provides a method for detecting allele typing at base 1880 of the rice ALS gene, characterized in that the detection method comprises the following steps:

[0015] Extracting genomic DNA from samples to be tested;

[0016] Using the genomic DNA of the sample to be tested as a template, the aforementioned SNP marker primers are used to perform a fluorescent quantitative PCR reaction, wherein the upstream primer F1 and the downstream primer R constitute a primer system 1, and the upstream primer F2 and the downstream primer R constitute a primer system 2, and the primer system 1 and the primer system 2 are used to perform a PCR reaction once respectively;

[0017] If there is only the fluorescence detection result of reaction system 1 in the amplification results, and the Ct value is less than or equal to 32, the rice sample tested is determined to be a homozygous body without the imidazolinone herbicide resistance gene ALS1880G, and is a sensitive genotype; if there is only the fluorescence detection result of reaction system 2, and the Ct value is less than or equal to 32, the rice sample tested is determined to be a homozygous body containing the imidazolinone herbicide resistance gene ALS1880A, and is a tolerant type; if there are fluorescence detection results of both reaction systems 1 and 2, and the Ct value is less than or equal to 32, the rice sample tested is determined to be a heterozygous body containing the imidazolinone herbicide resistance gene ALS1880G / A, and is a tolerant type.

[0018] On the other hand, the present disclosure provides a molecular marker-assisted selection method for obtaining rice with resistance to imidazolinone herbicides, characterized in that the method includes: using the aforementioned SNP marker primers to perform genotype detection, backcrossing heterozygous individual plants containing resistance genes with the recurrent parent, and thus through multiple backcrossings, selecting homozygous individual plants containing resistance genes through genotype detection in the last generation of self-pollinated populations to cultivate rice with imidazolinone herbicide resistance.

[0019] On the other hand, the present disclosure provides a method for identifying and increasing the purity of hybrid rice seeds, characterized in that the method uses the typing results obtained by the aforementioned method to statistically analyze the purity of hybrid rice seeds. If the proportion of heterozygous rice hybrid seeds is less than 85%, it is necessary to spray herbicides in the field to remove impurities; if the proportion of heterozygous rice hybrid seeds is 85% or more, it is not necessary to spray herbicides in the field to remove impurities.

[0020] The beneficial effects of this application are at least as follows:

[0021] The present invention provides a novel SNP marker primer for detecting rice imidazolinone herbicide resistance gene ALS, which can be combined with a fluorescent quantitative PCR method to quickly detect the genotyping of the 1880th base of the rice ALS gene, has the advantages of high sensitivity and high specificity, and is easy to operate. The sensitivity can reach 1ng / μL or lower. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the result of fluorescence quantitative PCR of Jinxiangyu No. 1 in reaction system 1.

[0023] Figure 2 This is the result of fluorescence quantitative PCR of Jinxiangyu No. 1 in reaction system 2.

[0024] Figure 3 The results of fluorescence quantitative PCR of Jinjing 818 in reaction system 1 are shown.

[0025] Figure 4 The results of fluorescence quantitative PCR of Jinjing 818 in reaction system 2 are shown.

[0026] Figure 5 The fluorescence quantitative PCR results of the tested varieties in reaction system 1.

[0027] Figure 6 The fluorescence quantitative PCR results of the tested varieties in reaction system 2.

[0028] Figure 7 This is the gene sequencing result of Jinxiangyu No. 1.

[0029] Figure 8This is the gene sequencing result of Jinjing 818.

[0030] Fig. 9 This is the gene sequencing result of F1-1. DETAILED DESCRIPTION

[0031] I. Terminology

[0032] In order to make the present disclosure more easily understood, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meaning commonly understood by those skilled in the art to which the present disclosure belongs.

[0033] As used herein, the articles "a" and "an" refer to one or more than one (ie, at least one) of the grammatical object to which the article refers. For example, "an element" means one element or more than one element.

[0034] The term "and / or" should be understood to mean either or both of the alternatives.

[0035] The terms “comprising” or “including” generally imply the inclusion of explicitly stated features, but not the exclusion of other elements.

[0036] The term "about" generally refers to a variation within a range of 0.5%-10% above or below a specified value, for example, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below a specified value.

[0037] As used herein, the expressions "cell," "cell line," and "cell culture" are used interchangeably, and all such names include progeny thereof. Thus, the words "transformants" and "transformed cells" include the primary subject cell and cultures derived therefrom, without regard to the number of transfers. It should also be understood that all progeny may not be exactly identical in terms of DNA content, due to intentional or unintentional mutations. Mutant progeny having the same function or biological activity as screened for in the originally transformed cell are included. Where different names are intended, this is clear from the context.

[0038] "Optional" or "optionally" means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and where it does not occur.

[0039] The term "SNP" stands for Single Nucleotide Polymorphism, which refers to the DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level. The SNP site refers to the specific location where a single nucleotide variation occurs in the DNA sequence.

[0040] The term "molecular marker" can be used to refer to a genetic marker or its encoded product (e.g., protein) used as a reference point when identifying a linkage site. The marker can be derived from a genomic nucleotide sequence or an expressed nucleotide sequence (e.g., from spliced ​​RNA, cDNA, etc.), or from an encoded polypeptide. The term also refers to a nucleic acid sequence complementary to or flanking a marker sequence, such as a nucleic acid used as a probe or primer pair capable of amplifying a marker sequence. A "molecular marker probe" is a nucleic acid sequence or molecule that can be used to identify the presence of a marker locus, such as a nucleic acid probe complementary to a marker locus sequence. Alternatively, in some aspects, a marker probe refers to any type of probe that can distinguish (i.e., genotype) a specific allele present in a marker locus. When nucleic acids specifically hybridize in a solution, such as according to the Watson-Crick base pairing rule, they are "complementary". When located on an insertion-deletion region, some markers described herein are also referred to as hybridization markers, such as non-collinear regions described herein. This is because, by definition, an insertion zone is a polymorphism relative to a plant that is not inserted. Therefore, the marker only needs to indicate whether an insertion-deletion region exists. Such hybridization markers may be identified using any suitable marker detection technology, such as, for example, SNP technology is used in the examples provided herein.

[0041] The term "homozygous" refers to a single cell or plant with the same alleles at one or more or all loci. When the term is used to refer to a specific locus or gene, it means that at least the locus or gene has the same allele. As used herein, the term "homozygous" refers to a genetic condition that exists when the same allele resides in the corresponding locus on the homologous chromosome. Therefore, for a diploid organism, the two alleles are the same, for a tetraploid organism, the four alleles are the same, and so on. As used herein, the term "heterozygous" refers to a single cell or plant with different alleles at one or more or all loci. When the term is used to refer to a specific locus or gene, it means that at least the locus or gene has different alleles. Therefore, for a diploid organism, the two alleles are not the same, for a tetraploid organism, the 4 alleles are not the same (i.e., at least one allele is different from the other alleles), and so on. As used herein, the term "heterozygous" refers to a genetic condition that exists when different alleles are located at the corresponding loci on the homologous chromosome. In certain embodiments, the proteins, genes or coding sequences described herein are homozygous.

[0042] As used herein, the term "hybrid" refers to any individual cell, tissue, or plant resulting from a cross between parents that differ in one or more genes.

[0043] As used herein, the term "seed" refers to the mature grain of rice produced for the purpose of propagating the species.

[0044] II. Detailed description of specific implementation methods

[0045] In one aspect, the present disclosure provides a SNP marker primer for detecting rice imidazolinone herbicide resistance gene ALS, characterized in that the SNP marker primer comprises:

[0046] Upstream primer F1: nucleotide sequence as shown in SEQ ID NO.1;

[0047] Upstream primer F2: nucleotide sequence is shown in SEQ ID NO.2;

[0048] Downstream primer R: The nucleotide sequence is shown in SEQ ID NO.3.

[0049] On the other hand, the present disclosure provides the use of the aforementioned SNP marker primers in detecting a SNP mutation from G to A at the 1880th base of the rice ALS gene.

[0050] On the other hand, the present disclosure provides a detection kit comprising the aforementioned SNP marker primers.

[0051] In some embodiments, the detection kit further comprises a PCR reaction solution.

[0052] In some embodiments, the PCR reaction solution includes a qPCR mix and a fluorescent dye.

[0053] In some embodiments, the fluorescent dye is LC-Green.

[0054] In another aspect, the present disclosure provides a method for detecting allele typing at base 1880 of the rice ALS gene, characterized in that the detection method comprises the following steps:

[0055] Extracting genomic DNA from samples to be tested;

[0056] Using the genomic DNA of the sample to be tested as a template, the aforementioned SNP marker primers are used to perform a fluorescent quantitative PCR reaction, wherein the upstream primer F1 and the downstream primer R constitute a primer system 1, and the upstream primer F2 and the downstream primer R constitute a primer system 2, and the primer system 1 and the primer system 2 are used to perform a PCR reaction once respectively;

[0057] If there is only the fluorescence detection result of reaction system 1 in the amplification results, and the Ct value is less than or equal to 32, the rice sample tested is determined to be a homozygous body without the imidazolinone herbicide resistance gene ALS1880G, and is a sensitive genotype; if there is only the fluorescence detection result of reaction system 2, and the Ct value is less than or equal to 32, the rice sample tested is determined to be a homozygous body containing the imidazolinone herbicide resistance gene ALS1880A, and is a tolerant type; if there are fluorescence detection results of both reaction systems 1 and 2, and the Ct value is less than or equal to 32, the rice sample tested is determined to be a heterozygous body containing the imidazolinone herbicide resistance gene ALS1880G / A, and is a tolerant type.

[0058] In some embodiments, the reaction conditions of the fluorescent quantitative PCR are: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 3 s, and extension at 60°C for 15 s, for a total of 35 cycles.

[0059] On the other hand, the present disclosure provides a molecular marker-assisted selection method for obtaining rice with resistance to imidazolinone herbicides, characterized in that the method includes: using the aforementioned SNP marker primers to perform genotype detection, backcrossing heterozygous individual plants containing resistance genes with the recurrent parent, and thus through multiple backcrossings, selecting homozygous individual plants containing resistance genes through genotype detection in the last generation of self-pollinated populations to cultivate rice with imidazolinone herbicide resistance.

[0060] On the other hand, the present disclosure provides a method for identifying and increasing the purity of hybrid rice seeds, characterized in that the method uses the typing results obtained by the aforementioned method to statistically analyze the purity of hybrid rice seeds. If the proportion of heterozygous rice hybrid seeds is less than 85%, it is necessary to spray herbicides in the field to remove impurities; if the proportion of heterozygous rice hybrid seeds is 85% or more, it is not necessary to spray herbicides in the field to remove impurities.

[0061] For purposes of clarity and concise description, features are described herein as part of the same or separate embodiments, however, it will be understood that the scope of the present disclosure may include embodiments having a combination of all or some of the described features.

[0062] Example

[0063] Hereinafter, the present disclosure will be described in more detail with reference to specific examples; however, the examples are only for illustrative purposes and have no limiting effect on the present disclosure.

[0064] Example 1: Development of ALS1880 G / A SNP loci associated with resistance to imidazolinone herbicides in rice

[0065] The inventors sequenced and analyzed the ALS genes of a large number of rice varieties and unexpectedly discovered a SNP site ALS1880 that is closely related to resistance to imidazolinone herbicides. This SNP site has obvious differences between resistant and sensitive varieties. Specifically, the SNP marker is a base polymorphism site G / A, which is located at the 1880 site of the rice ALS gene. The imidazolinone herbicide-resistant rice variety Jinjing 818 is a homozygous mutant ALS1880A, and the sensitive rice variety Jinxiangyu No. 1 is a homozygous wild-type ALS1880G. The nucleotide sequence of this SNP site is shown in SEQ ID NO.4.

[0066] Example 2: Establishment of a molecular marker system for detecting the gene ALS1880 G / A SNP associated with resistance to imidazolinone herbicides in rice

[0067] The experimental methods not specifically described in this example are conventional methods in molecular biology. The 2xPerfectStart IIProbe qPCR SuperMix UDG used in this example was produced by Beijing Quanshijin Biotechnology Co., Ltd., LC-Green fluorescent dye was produced by Idaho Company in the United States, and the rest were conventional biochemical reagents.

[0068] Two sets of SNP molecular marker primers were designed based on the candidate SNP sites. The primer pair of molecular marker ALS1880G (system 1) included an upstream primer F1 and a downstream primer R: their nucleotide sequences were shown in SEQ ID NO.1 and SEQ ID NO.3, respectively; the primer pair of molecular marker ALS1880A (system 2) included an upstream primer F2 and a downstream primer R: their nucleotide sequences were shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0069] Using the two sets of primers mentioned above, Jinjing 818, a rice variety containing imidazolinone herbicide resistance genes, and Jinxiangyu No. 1, a sensitive variety, were selected for initial screening and verification of the ALS1880 marker. The specific steps are as follows:

[0070] 1. Extract DNA of the rice gene to be tested

[0071] Appropriate amounts of leaf tissues of the rice varieties to be tested (Jinxiangyu No. 1 and Jinjing 818) were taken, and the whole genome DNA was extracted using the CTAB method. The quality of the extracted DNA was tested by agarose electrophoresis and Nanodrop2100, respectively, and it was found that the extracted genomic DNA met the relevant quality requirements, that is, agarose electrophoresis showed a single DNA band, indicating no obvious degradation and diffusion; Nanodrop2100 detected A 260 / 280 Between 1.8 and 2.0, indicating that the DNA sample has no protein contamination; A 260 / 230The value is between 2.0-2.2, indicating that the salt ion concentration of the DNA sample is low. There is no obvious light absorption at 270nm, indicating that the DNA sample is not contaminated by phenol. Dilute the DNA sample to 10ng / μL, 5ng / μL, and 1ng / μL for later use.

[0072] 2. PCR detection

[0073] Using the DNA extracted in step 1 as a template, two sets of primers developed in Example 1 for detecting the rice imidazolinone herbicide resistance gene ALS1880 marker were simultaneously performed for fluorescence quantitative PCR amplification. The specific PCR system is as follows:

[0074] The total volume of the fluorescence quantitative PCR reaction system 1 and 2 is 25 μL, respectively containing 12.5 μL 2x PerfectStart II Probe qPCR Super Mix UDG, 0.025 μL of each upstream and downstream primer at a concentration of 100 μM, 0.4 μL LC-Green fluorescent dye, 7.05 μL ddH2O; the template is 5.0 μL of genomic DNA at a concentration of 1-100 ng / μL. The reaction system in this embodiment is a stable one-tube fluorescence quantitative PCR system, which can achieve pre-mixing of all components except the template in advance, and the pre-mixed reagents can be stored at -20±5°C for 12 months.

[0075] The PCR reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 3 s, extension at 60°C for 15 s and fluorescence collection, for a total of 35 cycles.

[0076] 3. Test results

[0077] The results of fluorescence quantitative PCR of Jinxiangyu No. 1 reaction system 1 are as follows Figure 1 As shown, the results of fluorescence quantitative PCR in Jinxiangyu No. 1 reaction system 2 are as follows Figure 2 As shown, the above data show that Jinxiangyu No. 1 is a homozygous wild-type ALS1880G, a sensitive variety, and the test results are consistent with the phenotype;

[0078] The results of fluorescence quantitative PCR in Jinjing 818 reaction system 1 are as follows Figure 3 As shown, the results of Jinjing 818 reaction system 2 fluorescence quantitative PCR are as follows Figure 4 As shown, Jinjing 818 is a homozygous mutant ALS1880A and a tolerant variety, and the results are consistent with the phenotype.

[0079] In summary, the marker ALS1880 can accurately detect rice resistance to imidazolinone herbicides. Its detection sensitivity can reach 1ng / μL or lower. The typing results were compared with the PCR product sequencing results and the results of the seedling herbicide resistance trait identification of field rice varieties. It was also found that the typing results of the marker were consistent with the phenotypic results of the herbicide resistance trait identification. So far, we have obtained SNP molecular marker primers and detection systems for detecting the rice imidazolinone herbicide resistance gene ALS. The specific primers are as follows:

[0080] The molecular marker is ALS1880, and the base of its polymorphic site is G or A. The marker combination includes two specific primers and one universal primer, wherein the specific primers are TATTACATCTTTGAAAGTGCCACCAC (upstream primer F1: SEQ ID NO.1) and GTTATTACATCTTTGAAAGTGCCACCAT (upstream primer F2: SEQ ID NO.2), and the universal primer is CAGGACCATACCTGTTGGATGTGATA (downstream primer R: SEQ ID NO.3). The amplified product is 62 bp.

[0081] Using the above primers, through the above fluorescence quantitative PCR reaction, if there is and only the fluorescence detection result of reaction system 1 in the amplification result, and the Ct value is less than or equal to 32, the rice sample detected is judged to be a homozygote without the imidazolinone herbicide resistance gene ALS1880G, and is a sensitive genotype; if there is and only the fluorescence detection result of reaction system 2, and the Ct value is less than or equal to 32, the rice sample detected is judged to be a homozygote containing the imidazolinone herbicide resistance gene ALS1880A, and is a tolerant type; if the fluorescence detection results of reaction systems 1 and 2 simultaneously satisfy the Ct value less than or equal to 32, the rice sample detected is judged to be a heterozygote containing the imidazolinone herbicide resistance gene ALS1880G / A, and is a tolerant type.

[0082] Example 3: Verification of the effect of SNP markers of ALS gene related to resistance to imidazolinone herbicides in rice

[0083] The effect of the ALS1880 SNP marker related to resistance to rice imidazolinone herbicides was verified using the hybrid offspring F1 population. The breeding populations used in this example are F1-1, F1-2, F1-3...F1-23, which are the first generation of the hybrid of the rice variety Jinjing 818 containing the resistance gene and the sensitive variety Jinxiangyu No. 1, and the surviving varieties screened by spraying imidazolinone herbicides, and then the breeding population obtained by breeding technology, a total of 23 strains, all of which are phenotypically tolerant.

[0084] The DNA of the aforementioned tested species was extracted and the PCR reaction was performed using the PCR detection system in Example 2. The results of the fluorescence quantitative PCR in reaction system 1 are as follows: Figure 5 As shown, the results of fluorescence quantitative PCR in reaction system 2 are as follows Figure 6 As shown, all 23 strains tested were tolerant and homozygous for ALS1880A. The test results were consistent with the phenotypes, as shown in Table 1.

[0085] Table 1. Test results of hybrid strains

[0086]

[0087]

[0088] It can be seen that the consistency rate between different genotypes and phenotypes in Table 1 is 100%, that is, the selection of ALS gene and herbicide resistance in rice using the SNP marker of the present invention is effective.

[0089] Example 4: Verification of the effect of SNP marker 1880 of the ALS gene related to resistance to imidazolinone herbicides in rice by sequencing

[0090] The effect of the ALS1880 SNP marker related to rice imidazolinone herbicide resistance was verified by sequencing. The breeding populations used in this example were Jinxiangyu No. 1, Jinjing 818, and F1-1, and the PCR sequencing system was referred to Example 2. The nucleic acid amplification product was commissioned to Shanghai Biotech for Sanger sequencing.

[0091] The gene sequencing results are shown in Figure 7-9 Among them, the sequencing results of Jinxiangyu No. 1 are as follows Figure 7 As shown, there is no obvious double peak at the site shown, that is, the ALS1880 base is GG homozygous; the sequencing results of Jinjing 818 are as follows Figure 8 As shown, there is no obvious double peak at the site shown, that is, the ALS 1880 base is AA homozygous; the sequencing results of F1-1 are as follows Fig. 9 As shown, there is no obvious double peak at the indicated site, that is, the ALS1880 base is homozygous for AA.

[0092] In combination with Examples 3 and 4, it can be seen that the 1880 SNP marker system of the ALS gene related to rice imidazolinone herbicide resistance provided by the present disclosure has accurate directionality for variety selection.

[0093] Comparative Example 1: Comparison of detection effects between traditional electrophoresis and the SNP marker system disclosed in this application

[0094] When the traditional electrophoresis method is used to detect SNP sites related to rice ALS gene resistance, two pairs of primers must be designed to establish two reaction systems for PCR amplification. The amplified products are separated by agarose gel electrophoresis, and then the DNA bands are visualized by EB staining or other staining methods. Finally, the genotype is determined based on the position and brightness of the bands in the two reaction systems. The operation steps are complicated and time-consuming, and the detection sensitivity is low and the specificity is poor.

[0095] The detection effects of the traditional electrophoresis method and the SNP marker system disclosed in this application were compared on the same test sample. The detection process of the SNP marker system of this application refers to Example 2, and the detection process of the traditional electrophoresis method is as follows:

[0096] Rice varieties Jinxiangyu No. 1 (sensitive type) and Jinjing 818 (tolerant type) were selected as experimental materials. The genomic DNA was extracted by CTAB method, and the concentration of the extracted DNA was detected on Nanodrop2100, and diluted to 10ng / μL, 5ng / μL, and 1ng / μL respectively according to the test results.

[0097] PCR amplification, the specific primers for ALS1880 SNP site are TGTCCTTGAATGCGCCCCTAC (upstream primer F3: SEQ ID NO.5), TGTCCTTGAATGCGCCCCTAT (upstream primer F4: SEQ ID NO.6), and the universal primer is GAGGCAATCATCGCTACTGG (downstream primer R2: SEQ ID NO.7), wherein the combination of upstream primer F3 and downstream primer R2 amplifies the wild-type ALS1880G, and the combination of upstream primer F4 and downstream primer R2 amplifies the mutant ALS1880A (primer information refers to patent CN107267656A). The amplified product fragments are all 547 bp, which is different from the 62 bp short fragment amplification in Example 2 of the present disclosure. The total volume of the PCR system includes 2 μL of DNA template, 2 μL of 10x PCR buffer, 2 μL of MgCl2 (5 mmol), 2 μL of dNTP (2 mmol / L), 2 μL of upstream primer, 2 μL of downstream primer, 0.2 μL of Tag enzyme, and 7.8 μL of ddH2O. The reaction program amplification conditions are 94°C for 5 min; 94°C for 30 s, 55°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 10 min extension, which is different from the two-step rapid PCR program in Example 2 of the present disclosure. The amplified products are separated by agarose gel electrophoresis and photographed in a gel imager, which is different from the electrophoresis and gel imaging in Example 2 of the present disclosure.

[0098] Compare the results of the two detection methods:

[0099] The electrophoresis results showed that the 10 ng / μL concentration DNA amplification product bands of Jinxiangyu No. 1 and Jinjing 818 were clearly distinguishable on the gel, and the genotypes could be accurately determined, while the 5 ng / μL and 1 ng / μL amplification product bands were not clearly distinguishable on the gel, and the genotypes could not be accurately determined.

[0100] At the same time, compared with the fluorescent quantitative PCR method of the disclosed embodiment, the traditional electrophoresis method is cumbersome to operate, and multiple steps such as electrophoresis and staining are required, which is time-consuming. It takes about 4-5 hours from DNA extraction to result determination, while the disclosed embodiment 2 only requires nucleic acid extraction and PCR amplification, and the PCR amplification program only takes 40 minutes, and the entire experimental process only takes 1-2 hours; the traditional method requires secondary treatment of the PCR product, which is very easy to contaminate the experiment. Once the experiment is contaminated, the typing result will no longer be accurate, and the method disclosed in the present invention performs PCR amplification and fluorescence reading in a closed system, without product analysis, greatly reducing the risk of experimental contamination; the traditional electrophoresis method has low sensitivity, and it is easy to have false negatives or misjudgment results for low-concentration DNA templates. In this experiment, the detection of 5ng / μL and 1ng / μL concentrations of DNA is indistinguishable, and the method disclosed in the present invention can accurately detect 5ng / μL and 1ng / μL concentrations of DNA, and the sensitivity is much higher than that of the traditional method. The main parameters of its performance comparison are compared in Table 2.

[0101] Table 2. Comparison of main parameters between traditional electrophoresis and the disclosed method

[0102] Comparison Items Traditional electrophoresis The disclosed method Sensitivity Low, 5ng / μL DNA cannot be detected High, 1ng / μL stable detection Specificity Low, easy to cause product contamination High, not easy to cause pollution Total experiment time Long, 4-5 hours Short, 1-2 hours Ease of operation Complex, requiring electrophoresis, staining, etc. Simple, no product handling required

[0103] Comparative Example 2: Comparison of the detection effects of KASP markers and the SNP marker system disclosed in this application

[0104] Among the methods for detecting SNP mutations in rice ALS gene, the KASP marker method has its unique features in the design of primers and reaction systems. This example compares the detection effects of the KASP marker and the SNP marker system disclosed in this application on the same test sample. Among them, the detection process of the SNP marker system of this application refers to Example 2. The KASP marker detection process is as follows.

[0105] Rice varieties Jinxiangyu No. 1 (sensitive type) and Jinjing 818 (tolerant type) were selected as experimental materials. Genomic DNA was extracted using the CTAB method, and the concentration of the extracted DNA was detected on Nanodrop2100, and diluted to 10 ng / μL, 5 ng / μL, and 1 ng / μL respectively according to the test results.

[0106] PCR amplification, the primers for ALS1880 SNP site were GAAGGTGACCAAGTTCATGCTCATGTGCTGCCTATGATCCCAAA (PrimerX: SEQ ID NO.8), GAAGGTCGGAGTCAA CGGATT CATGTGCTGCCTATGATCCCAAG (PrimerY: SEQ ID NO.10), the universal primer is GAGGCAATCATCGCTACTGG (PrimerC: SEQ ID NO.9), wherein PrimerX is connected to the FAM fluorescent label sequence (the underlined part is the FAM fluorescent label sequence), PrimerY is connected to the HEX fluorescent label sequence (the underlined part is the HEX fluorescent label sequence), and PrimerC is a universal primer. A corresponding reaction system was established, and KASP labeled primers were used to perform genotyping on the DNA extracted above: the genotyping experiment was run in Roche LightCycler480 (real-time fluorescence quantitative PCR system), and 10 μL of the reaction system was added to a 96-well PCR microwell reaction plate. The reaction system included: 1 μL of DNA template, 0.14 μL of KASPAssay mix (LGC, KBS-2100-100-OLI), 5 μL of KASP Master mix (LGC, KBS-1016-016), and water was added to make up the final system of 10 μL. PCR operation program and fluorescence scanning: the first step is pre-denaturation at 94°C for 15 min; the second step is denaturation, annealing, and extension at 94°C for 20 s, and from 61°C to 55°C (0.6°C decrease per cycle) for 60 s, for a total of 10 cycles; the third step is denaturation, annealing, and extension at 94°C for 20 s, and 55°C for 60 s, for a total of 26 cycles; the fourth step is scanning the fluorescence analysis data at 37°C for 1 min, and the fluorescence analysis data were obtained by Roche The LightCycler480 instrument scans the fluorescence signals of the PCR amplification products and analyzes the scanned fluorescence signals. The analysis results are converted into scatter plots and fluorescence values ​​for genotyping. The scatter plots and FAM / HEX fluorescence values ​​of each PCR amplification product are obtained by analysis. The instrument processes these fluorescence values ​​to generate a scatter plot and a fluorescence plot of the sample products in the 96-well plate corresponding to each point in the scatter plot. Each point in the scatter plot represents the fluorescence value of a corresponding sample. The ordinate represents the HEX fluorescence value (533nm-580nm), and the abscissa represents the FAM fluorescence value (465nm-510nm).

[0107] Compare the results of the two detection methods:

[0108] In terms of genotype determination accuracy and sensitivity, the SNP marker system of the present application accurately determined the different genotypes of Jinxiangyu No. 1 and Jinjing 818, which was completely consistent with the known resistance phenotype. However, during the detection process, the KASP marker could not determine the genotype results of some low-concentration (such as 1 ng / μL) samples.

[0109] In terms of ease of operation, the SNP labeling system of Example 2 of the present disclosure uses a simple primer combination and a stable reaction system, with few operating steps and easy to master. However, due to its unique primer design and reaction system requirements, the KASP labeling method requires precise mixing of multiple components during the reagent preparation process, which is relatively complex to operate and is prone to affecting the test results due to operational errors.

[0110] In terms of detection time, the SNP labeling system of the present application is efficient and fast from DNA extraction to result determination, which only takes 1-2 hours. However, due to the complexity of the reaction procedure of the KASP labeling method, the entire detection process takes a long time, which takes about 3-4 hours from DNA extraction to result determination.

[0111] In terms of cost, the primers and reagents used in Example 2 of the present disclosure are relatively low in cost, which is particularly advantageous in large-scale detection. The special primers and reagents used in the KASP labeling method are relatively expensive, which increases the economic cost of detection.

[0112] The main parameters for performance comparison of the two methods are shown in Table 3.

[0113] Table 3. Comparison of main parameters between traditional electrophoresis method and the disclosed method

[0114] Comparison Items KASP Mark The disclosed method Sensitivity There is a deviation, 1ng / μL sample cannot be detected Accurate, stable judgment at 1ng / μL and above Ease of operation Complex, high requirements for reagent preparation Simple, few steps Total detection time Long, 3-4 hours Short, 1-2 hours cost High, special primers and reagents cost Low, low cost for conventional primers and reagents

[0115] In summary, the SNP marker system disclosed in this application has obvious advantages over the patented KASP marker in terms of sensitivity, ease of operation, detection time and cost.

[0116] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0117] The above-mentioned embodiments only express several implementation methods of the present disclosure, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present disclosure, and these all belong to the protection scope of the present disclosure. Therefore, the protection scope of the patent of the present disclosure shall be subject to the attached claims.

[0118] Table 4. Sequence information

[0119]

Claims

1. A SNP marker primer for rapid detection of rice imidazolinone herbicide resistance gene ALS, characterized in that: The SNP marker primers include: Upstream primer F1: nucleotide sequence as shown in SEQ ID NO.1; Upstream primer F2: nucleotide sequence is shown in SEQ ID NO.2; Downstream primer R: The nucleotide sequence is shown in SEQ ID NO.

3.

2. Use of the SNP marker primers according to claim 1 in detecting a SNP mutation from G to A at the 1880th base of the rice ALS gene.

3. A detection kit comprising the SNP marker primer according to claim 1.

4. The detection kit according to claim 3, wherein The detection kit also contains a PCR reaction solution.

5. The detection kit according to claim 4, wherein The PCR reaction solution includes a qPCR mixed solution and a fluorescent dye; Preferably, the fluorescent dye is LC-Green.

6. A method for detecting a SNP mutation from G to A at base 1880 of a rice ALS gene, characterized in that: The detection method comprises the following steps: Extracting genomic DNA from samples to be tested; Using the genomic DNA of the sample to be tested as a template, a fluorescent quantitative PCR reaction is performed using the SNP marker primers described in claim 1, wherein the upstream primer F1 and the downstream primer R constitute a primer system 1, the upstream primer F2 and the downstream primer R constitute a primer system 2, and the primer system 1 and the primer system 2 are used to perform a PCR reaction; If there is only the fluorescence detection result of reaction system 1 in the amplification results, and the Ct value is less than or equal to 32, the rice sample tested is judged to be a homozygote without the imidazolinone herbicide resistance gene ALS1880 G, and is a sensitive genotype; if there is only the fluorescence detection result of reaction system 2, and the Ct value is less than or equal to 32, the rice sample tested is judged to be a homozygote containing the imidazolinone herbicide resistance gene ALS1880 A, and is a tolerant type; if there are fluorescence detection results of both reaction systems 1 and 2, and the Ct value is less than or equal to 32 at the same time, the rice sample tested is judged to be a heterozygote containing the imidazolinone herbicide resistance gene ALS1880 G / A, and is a tolerant type.

7. The method according to claim 6, wherein: The reaction conditions of the fluorescent quantitative PCR were as follows: pre-denaturation at 95° C. for 3 min; denaturation at 94° C. for 3 s, and extension at 60° C. for 15 s, for a total of 35 cycles.

8. A method for obtaining rice with imidazolinone herbicide resistance by molecular marker-assisted selection, characterized in that: The method comprises: using the SNP marker primers described in claim 1 to perform genotype detection, backcrossing heterozygous plants containing resistance genes with recurrent parents, and thus selecting homozygous plants containing resistance genes through genotype detection in the last generation of self-pollination population through multiple backcrossings to cultivate rice with imidazolinone herbicide resistance.

9. A method for identifying and increasing the purity of hybrid rice seeds, characterized in that: The method is to use the typing results obtained by the method of claim 6 to statistically analyze the purity of hybrid rice seeds. If the proportion of heterozygous rice hybrid seeds is less than 85%, it is necessary to spray herbicides in the field to remove impurities; if the proportion of heterozygous rice hybrid seeds is 85% or more, it is not necessary to spray herbicides in the field to remove impurities.

10. The method according to claim 9, characterized in that The method for identifying and increasing the purity of hybrid rice seeds comprises the following steps: identifying the purity of F1 hybrids under net-isolated pollination or natural pollination conditions, and spraying herbicides at the seedling stage to remove impurities and increase seed purity.

Images