Salmonella strains with chromosomal integration landing zones

Abstract

The present invention relates to a modified live attenuated Salmonella strain comprising at least one chromosomal integrated synthetic polynucleotide sequence inserted in a predetermined pseudogenomic position, said sequence comprising at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, wherein the chromosome integration synthetic polynucleotide sequence is located within at least one genomic site, the genomic site being defined by any one of SEQ ID NO: 1-30 or a sequence having at least 70% identity with any one of SEQ ID NO: 1-30. The invention also relates to vaccine compositions comprising the modified strains and various uses and methods thereof.

Description

Technical Field

[0001] The present invention relates to the use of modified Salmonella for delivering heterologous cargo and methods thereof. Background Art

[0002] Microorganisms (such as bacteria) can be genetically engineered to carry and deliver heterologous loads. Many current technologies involving regulation of gene expression are based on plasmids. However, plasmid-based systems have many disadvantages associated with them, including variability between introduced cells, increased metabolic load, reliance on antibiotic resistance genes, and removal from the resulting therapeutic strains.

[0003] One way to overcome these problems is by introducing the desired load into the chromosome of the host organism. Kuhlman and Cox (Nucleic Acids Research, 2010, 38: 6, e92) disclose a system in which the auxiliary plasmid TKRED catalyzes the introduction of a "landing pad" into an arbitrary position in the E. coli chromosome to enable the insertion of a heterologous load. Snoeck et al. (Biotechnology and Bioengineering, 2019, 116: 364-374) also used this method, using serine recombinases to integrate loads into the E. coli chromosome with a landing zone containing homologous att sites at random positions on the genome. In addition, US2014 / 127816 A1 discloses the introduction of recombinase recognition sites in the intergenic regions upstream and downstream of the gene to effectively excise the gene.

[0004] However, genome integration also brings many challenges. For example, for very large constructs, it is laborious and challenging to integrate load into chromosome. In addition, any genome modification / integration may affect strain physiology in an unpredictable manner, thereby changing its effectiveness as a potential therapeutic strain, especially when genes are modified at intergenic sites (such as US2014 / 127816 A1), which has the potential side effect of destroying or otherwise affecting surrounding active genes. Finally, the amount of transcripts that the loop of importing can produce depends on its position in the genome. Therefore, random integration can cause the expected load produced to have uncontrollable and unreliable levels. Therefore, it is necessary in the art to be able to import load into the chromosome of the host organism in an improved manner. Summary of the invention

[0005] The inventors of the present invention have unexpectedly discovered that the generation of Salmonella strains containing at least one chromosomally integrated synthetic polynucleotide sequence at a predetermined genomic location not only enables the efficient and rapid introduction of any desired payload into the strain, but also allows the payload to be introduced into a genomic location of known transcriptional strength, thereby allowing for more controlled delivery of various payloads. In addition, the inventors have identified specific pseudogenome genomic locations that include inactive DNA regions for the insertion of these chromosomally integrated sequences that allow for minimal impact on normal bacterial cell physiology and its ability to serve as a therapeutic strain. By introducing a "landing zone" into a pseudogene (inactive DNA region) within the bacterial chromosome, the inventors have discovered a way to introduce new genes and functions into a Salmonella strain without affecting the surrounding genes, thereby allowing for minimal impact on normal bacterial cell physiology and any therapeutic capabilities of the bacterial strain.

[0006] Therefore, in a first aspect, the present invention discloses a modified live attenuated Salmonella strain, comprising at least one chromosomally integrated synthetic polynucleotide sequence inserted into a predetermined pseudogenomic location, the sequence comprising at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, wherein the chromosomally integrated synthetic polynucleotide sequence is located within at least one genomic site defined by any one of SEQ ID NOs: 1-30 or a sequence having at least 70% identity to any one of SEQ ID NOs: 1-30.

[0007] In a second aspect, the present invention discloses a vaccine composition comprising the modified live attenuated strain disclosed herein.

[0008] In a third aspect, the present invention discloses the use of the modified attenuated live strain disclosed herein for treating cancer.

[0009] In a fourth aspect, the present invention discloses the use of the modified attenuated live strain disclosed herein for treating infectious diseases.

[0010] In a fifth aspect, the present invention discloses the use of the modified attenuated live strain disclosed herein for treating an autoimmune disease or disorder.

[0011] In a sixth aspect, the present invention discloses a method for treating, inhibiting or controlling a neoplastic disease or an infectious disease in a subject, wherein the method comprises administering to the subject a modified, attenuated live Salmonella strain, the strain comprising at least one chromosomally integrated synthetic polynucleotide sequence inserted into a predetermined pseudogenomic location, the sequence comprising at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, wherein the chromosomally integrated synthetic polynucleotide sequence is located within at least one genomic site defined by any one of SEQ ID NOs: 1-30 or a sequence having at least 70% identity to any one of SEQ ID NOs: 1-30.

[0012] In a seventh aspect, the present invention discloses a method for modifying a live attenuated Salmonella strain, the method comprising inserting a synthetic polynucleotide sequence into a predetermined pseudogenomic position of the live attenuated Salmonella strain, the sequence comprising at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, wherein the chromosomally integrated synthetic polynucleotide sequence is located within at least one genomic site, the genomic site being defined by any one of SEQ ID NOs: 1-30 or a sequence having at least 70% identity to any one of SEQ ID NOs: 1-30. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Shown is an alignment of the Salmonella ZH9 strain sequence compared to the reference genome of the Salmonella Ty21a strain.

[0014] Figure 2 The location of the pseudogenes within the genome of the ZH9 strain is shown.

[0015] Figure 3 Possible designs of the synthetic sequences disclosed herein to be chromosomally integrated into a Salmonella strain are shown.

[0016] Figure 4 The reproducibility of small-scale integration rounds in the Salmonella ZH9 strain is shown.

[0017] Figure 5 Optimization of conditions required for successful integration of synthetic sequences into the chromosome of Salmonella ZH9 strain is shown.

[0018] Figure 6 The number of successful integrations in each integration round, verification of integration via colony PCT and the final genomic position of the synthesized sequence in the Salmonella ZH9 genome are shown.

[0019] Figure 7 Optimization of helper plasmid elimination conditions is shown.

[0020] FIG8 shows the growth curves and doubling times of strains with chromosomally integrated synthetic sequences grown in complex medium (lysogeny medium) or minimal medium (M9 medium) at 37° C. for 12 hours.

[0021] Fig. 9 Possible shuttle vector designs for delivering payloads into chromosomally integrated synthetic sequences are shown.

[0022] Fig.10 Shows the use of Fig. 9 The shuttle vector was designed to induce protein production in Salmonella ZH9 strain.

[0023] Fig.11 Shows the use of Fig. 9 The inductive effect of the shuttle vector design on the growth of Salmonella ZH9 strain.

[0024] Fig.12 Shown is the expression of the introduced cargo according to its genomic location, as determined by two assays: the chloramphenicol acetyltransferase (CAT) assay and the mScarlet assay. Also shown is the correlation between these two independent assays.

[0025] Fig.13 The mScarlet fluorescence at three thresholds (OD600 -0.3, 0.5, 1.0) of the Salmonella ZH9 strain that successfully integrated the synthetic sequence disclosed herein is shown.

[0026] Fig.14 Shown is a ranking of the relative transcriptional strength of various strains that integrated the synthetic sequences disclosed herein at different genomic locations.

[0027] Fig.15 and Fig.16 Shown is the procedure followed when subculturing strains AC containing up to three landing pads during four consecutive days, and the results of genome sequencing at each landing pad location on day 4. No changes were observed in any of these.

[0028] Fig.17 and Fig.18 The plasmid used to integrate the fluorescent protein (mScarlet) into the multi-landing zone strain C (three landing zones) and the elimination of each helper plasmid are shown. The remaining strains do not have antibiotic resistance and retain the load. DETAILED DESCRIPTION

[0029] In order to more easily understand the present invention, certain terms are first defined. Additional definitions are set forth throughout the detailed description.

[0030] As used herein, the term "attenuation" refers to bacteria that have been genetically modified so that they do not cause disease in human or animal subjects / models. Therefore, in the context of the present invention, the term refers to altering Salmonella to reduce its pathogenicity, making it harmless to the host while maintaining its viability. This method is commonly used in the development of vaccines because it can elicit a highly specific immune response while maintaining acceptable safety. Attenuation can be achieved by a variety of methods, examples include but are not limited to delivering pathogens under in vitro conditions until toxicity is lost, chemical mutagenesis, and genetic engineering techniques. The attenuated Salmonella strains disclosed herein are attenuated live Salmonella strains.

[0031] As used herein, the terms "chromosomally integrated" and "chromosomal integration" are used interchangeably and refer to the stable incorporation of a nucleic acid sequence into the chromosome of a host cell (i.e., Salmonella). Nucleic acid sequences can be incorporated into chromosomes by a variety of methods. In the context of the present invention, the nucleic acid sequence to be incorporated into the chromosome of Salmonella is a "chromosomally integrated synthetic polynucleotide sequence" or a "landing zone" sequence. Preferably, a nucleic acid sequence encoding a "chromosomally integrated synthetic polynucleotide sequence" or a "landing zone" sequence is incorporated into the chromosome using the classical recombineering scheme disclosed in Datsenko and Wanner, 2000 (PNAS, 97 (12): 6640-6645). In short, cells are first transformed with a helper plasmid, then transformed with a dsDNA cassette, and then the helper plasmid is eliminated and removed. The antibiotic introduced in the recombination is removed by excising the antibiotic after recognizing the FRT element using the protein FLP. Integration can then be verified by a PCR reaction designed to produce an amplicon (~500bp) only in the case of successful recombination.

[0032] As used herein, the terms "pseudogenome", "pseudogene" and "pseudogenomic location" are used interchangeably and refer to the location of an inactive gene or DNA sequence in the host genome (i.e., the genome of the Salmonella strain). Such inactive genes are called "pseudogenes". Pseudogenes can also be referred to as "non-functional" or "inactive" regions or fragments of DNA. The inventors of the present invention have identified pseudogenes. Pseudogenes are regions of DNA that may or may not have once encoded functional genes, but were later inactivated due to mutations (e.g., premature stop codons). Pseudogene regions of DNA are contrasted with intergenic regions of DNA. Intergenic regions of DNA are locations of DNA that contain active or functional genes. Intergenic regions may be active for promoters, terminators, or antisense RNAs. The present invention introduces new genes and functions into pseudogene regions of DNA, rather than integrating new genes into intergenic regions, which have potential unpredictable side effects of destroying or otherwise affecting or interfering with surrounding active / functional genes. For the avoidance of doubt, the landing pads disclosed herein are inserted into the pseudogenomic region, i.e., between the stop codon and the start codon within the pseudogene.

[0033] As used herein, the terms "polynucleotide" and "polynucleotide sequence" are used interchangeably and refer to a polymeric compound comprising covalently linked nucleic acids. The term "nucleic acid" includes DNA and RNA.

[0034] As used herein, the terms "polypeptide," "peptide," and "protein" are used interchangeably and refer to a polymeric form of amino acids of any length, which may include coded and non-coded amino acids, chemically or biochemically modified and / or derivatized amino acids.

[0035] As used herein, the term "defined recombination site" means that the Salmonella strains disclosed herein contain a short specific DNA sequence (site) at which genetic recombination can occur, thereby allowing the introduction of heterologous polynucleotide sequences.

[0036] As used herein, the term "genomic locus" refers to the location of a specific gene or synthetic sequence within the genome of Salmonella.

[0037] As used herein, the term "predetermined genomic location" refers to a pre-planned specific genomic location where a synthetic polynucleotide sequence is introduced into the chromosome of a Salmonella strain. The synthetic polynucleotide sequences of the present invention are not randomly integrated into the bacterial chromosome as previously performed in the art.

[0038] As used herein, the terms "sequence homology" and "sequence identity" are used interchangeably and refer to the percentage of identical residues in the compared sequences when the sequences are aligned. To calculate the sequence homology / identity percentage for any sequence disclosed herein, sequence comparison software can be used, for example, using the default settings on the BLAST software package (V2.10.1).

[0039] As used herein, the term "genetically engineered" means that the bacterium (e.g., Salmonella) has been genetically modified or "engineered" so that it is altered relative to the naturally occurring cell. Such genetic modification can be, for example, the incorporation of additional genetic information into the cell, the modification of existing genetic information, or actually the deletion of existing genetic information. This can be achieved, for example, by transfecting a recombinant plasmid into the cell or by directly modifying the bacterial genome.

[0040] By "inactivating mutation", it is meant the modification of the natural genetic code of a particular gene or gene promoter associated with the gene, such as by changing the nucleotide code or deleting a nucleotide segment or adding non-coding nucleotides or non-natural nucleotides, so that the particular gene is not properly transcribed or translated or expressed as an inactive protein, so that the natural function of the gene is abolished or reduced to an unmeasurable level. Therefore, the mutation of the gene inactivates the function of the gene or the function of the protein encoded by the gene.

[0041] As used herein, the term "transcription intensity" refers to the degree to which a gene at a specific genomic position is transcribed from DNA to RNA. In the context of the present invention, a "gene" is a newly introduced heterologous polynucleotide sequence that is introduced into a chromosomal integration sequence. Transcription intensity can be described as having a low or high transcription intensity. Those skilled in the art will readily recognize that the desired transcription intensity will depend on the load to be delivered to the object. For example, there may be a situation where strict regulation of the load to be delivered is very necessary, i.e., when the load to be delivered has toxic properties.

[0042] The modified Salmonella strain disclosed herein is designed so that heterologous genetic material can be easily introduced into the Salmonella strain, and then delivered to the target object in a reliable and effective manner. Therefore, the strain disclosed herein can serve as a carrier strain for delivering a variety of different "loads". Therefore, when the strain disclosed herein contains heterologous genetic material, the strain is referred to as "recombinant". Therefore, in one embodiment of the present invention, the modified attenuated live Salmonella strain disclosed herein is a recombinant Salmonella strain.

[0043] As used herein, the term "immunogenic" refers to a substance that induces an immune response in a subject. The term "immune response" refers to the action of, for example, lymphocytes, antigen presenting cells, phagocytes, granulocytes, and soluble macromolecules (including antibodies, cytokines, and complement) produced by the above cells or the liver, resulting in selective damage, destruction, or elimination of unwanted cells (e.g., cancer cells) and / or microorganisms associated with infectious diseases in the human body.

[0044] The terms "tumor," "cancer," and "neoplasia" are used interchangeably and refer to a cell or population of cells whose growth, proliferation, or survival is greater than that of normal corresponding cells, e.g., a cell proliferation or differentiation disorder. Typically, the growth is uncontrolled. The term "malignancy" refers to invasion of nearby tissues. The term "metastasis" refers to the spread or dissemination of a tumor, cancer, or neoplasia to another site, location, or area of ​​a subject, where the site, location, or area is different from the primary tumor or cancer.

[0045] The term "effective amount" or "pharmaceutically effective amount" refers to a sufficient amount of an agent that can provide a desired biological or therapeutic result, i.e., the amount of the Salmonella described herein that can achieve the desired effect. The result can be one or more of the signs, symptoms, or causes of the disease, or any other desired change in a biological system, to alleviate, improve, mitigate, reduce, delay, and / or relieve the disease. With respect to cancer, an effective amount may include an amount sufficient to cause tumor shrinkage and / or reduce tumor growth rate (e.g., inhibit tumor growth) or prevent or delay other unwanted cell proliferation. In some embodiments, an effective amount is an amount sufficient to delay progression or prolong survival or induce cancer or tumor stabilization. With respect to infectious diseases, an effective amount may include an amount sufficient to reduce the viral or bacterial load of a subject.

[0046] In some embodiments, the therapeutically effective amount is an amount sufficient to prevent or delay recurrence. This can be particularly advantageous in cancer patients. The therapeutically effective amount can be administered in one or more administrations. In the context of cancer, the therapeutically effective amount of a drug or composition can result in one or more of the following: (i) a reduction in the number of cancer cells; (ii) a reduction in tumor size; (iii) to a certain extent, inhibit, block or slow down and preferably stop cancer cell infiltration into peripheral organs; (iv) inhibit (i.e., to a certain extent, slow down and preferably stop) tumor metastasis; (v) inhibit tumor growth; (vi) prevent or delay the occurrence and / or recurrence of tumors; and / or (vii) to a certain extent alleviate one or more symptoms associated with cancer.

[0047] For example, for the treatment of tumors, a "therapeutically effective dose" can induce a tumor to shrink by at least about 5%, such as at least about 10%, or about 20%, or about 60% or more relative to baseline measurements. Baseline measurements can be derived from untreated subjects.

[0048] A therapeutically effective amount of a therapeutic compound can reduce symptoms, or otherwise improve the subject's symptoms altogether. One of ordinary skill in the art will be able to determine such an amount based on factors such as the size of the subject, the severity of the subject's symptoms, and the specific composition or route of administration selected.

[0049] The terms "vaccine composition" and "vaccine" are used interchangeably and refer to biological preparations that provide active acquired immunity against specific infectious diseases. Typically, vaccines contain agents similar to the microorganisms that cause the infection or "exogenous" agents. This exogenous agent will be recognized by the vaccine-recipient immune system, which will further destroy the agent and produce "memory" against the virus, inducing a persistent level of protection against future viral infections from the same or similar subspecies. Through the route of vaccination, including those vaccine compositions of the present invention, it is conceivable that once the vaccinated object encounters the same microorganism against which the object is vaccinated again, the individual's immune system can thereby recognize the microbial isolate and trigger a more effective anti-infective defense. The active acquired immunity induced in the object by the vaccine can be humoral immunity and / or cellular immunity. In the context of the present invention, the "exogenous" agent can be part of a virus, bacterium, fungus or parasite. Alternatively, the "exogenous" agent can be a cancer antigen, such as a tumor-associated antigen.

[0050] As used herein, the term "subject" is intended to include human and non-human animals. The method is particularly suitable for treating human patients suffering from a condition that can be treated by enhancing an immune response. In a specific embodiment, the method is particularly suitable for the treatment of cancer in vivo.

[0051] The use of alternatives (eg, "or") should be understood to mean one, both, or any combination of the alternatives. As used herein, the indefinite article "a" or "an" should be understood to mean "one or more" of any stated or listed components.

[0052] As used herein, "about" means within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" may mean 1 standard deviation or greater than 1 standard deviation according to practice in the art. Alternatively, "about" may mean a range of up to 20%. When a particular value is provided in the application and claims, unless otherwise stated, the meaning of "about" should be considered to be within an acceptable error range for that particular value.

[0053] The inventors of the present invention have developed standardized methods in which various payloads can be introduced into specific chromosomal regions of different Salmonella strains, which have known transcriptional strengths, while having no or minimal effects on strain viability and / or therapeutic efficacy. Thus, the modified strains disclosed herein allow for the introduction of payloads with different transcriptional requirements, thereby making the strains disclosed herein suitable for a range of therapeutic applications. This approach has multiple advantages over plasmid-based expression systems, such as reduced cell-to-cell variability, reduced metabolic burden, reduced reliance on antibiotic resistance genes, and permanent expression within the strain.

[0054] Therefore, in a first aspect, the present invention discloses a modified live attenuated Salmonella strain, the strain comprising at least one chromosomal integration synthetic polynucleotide sequence inserted into a predetermined pseudogenomic position, the sequence comprising at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, wherein the chromosomal integration synthetic polynucleotide sequence is located within at least one genomic site, the genomic site being defined by any one of SEQ ID NO: 1-30 or a sequence having at least 70% identity to any one of SEQ ID NO: 1-30. These sites are detailed in Table 1.

[0055] The pseudogenomic positions of the present invention are provided in Table 1. In one embodiment, the pseudogenomic positions of the present invention have 70% sequence identity with the genomic positions provided in Table 1. In one embodiment, the pseudogenomic positions of the present invention have 75% sequence identity with the genomic positions provided in Table 1. In one embodiment, the pseudogenomic positions of the present invention have 80% sequence identity with the genomic positions provided in Table 1. In one embodiment, the pseudogenomic positions of the present invention have 85% sequence identity with the genomic positions provided in Table 1. In one embodiment, the pseudogenomic positions of the present invention have 90% sequence identity with the genomic positions provided in Table 1. In one embodiment, the pseudogenomic positions of the present invention have 95% sequence identity with the genomic positions provided in Table 1. In one embodiment, the pseudogenomic positions of the present invention have 96% sequence identity with the genomic positions provided in Table 1. In one embodiment, the pseudogenomic positions of the present invention have 97% sequence identity with the genomic positions provided in Table 1. In one embodiment, the pseudogenomic positions of the present invention have 98% sequence identity with the genomic positions provided in Table 1. In one embodiment, the pseudogenomic positions of the present invention have 99% sequence identity with the genomic positions provided in Table 1.

[0056] Thus, in one embodiment, the chromosomally integrated synthetic polynucleotide sequence is located within at least one genomic site defined by any one of SEQ ID NOs: 1-30, or a sequence having at least 75% identity to any one of SEQ ID NOs: 1-30, at least 80% identity to any one of SEQ ID NOs: 1-30, at least 85% identity to any one of SEQ ID NOs: 1-30, at least 90% identity to any one of SEQ ID NOs: 1-30, at least 91% identity to any one of SEQ ID NOs: 1-30, at least 92% identity to any one of SEQ ID NOs: 1-30, at least 93% identity to any one of SEQ ID NOs: 1-30, at least 94% identity to any one of SEQ ID NOs: 1-30, at least 95% identity to any one of SEQ ID NOs: 1-30, at least 96% identity to any one of SEQ ID NOs: 1-30, at least 97% identity to any one of SEQ ID NOs: 1-30, at least 98% identity to any one of SEQ ID NOs: 1-30, at least 99% identity to any one of SEQ ID NOs: 1-31, at least 100% identity to any one of SEQ ID NOs: 1-32, at least 101% identity to any one of SEQ ID NOs: 1-33, at least 102% identity to any one of SEQ ID NOs: 1-34, at least 103% identity to any one of SEQ ID NOs: 1-35, at least 104% identity to any one of SEQ ID NOs: 1-36, at least 105% identity to any one of SEQ ID NOs: 1-37, at least 106% identity to any one of SEQ ID NOs: 1 NO: 1-30, a sequence that is at least 97% identical to any one of SEQ ID NO: 1-30, a sequence that is at least 98% identical to any one of SEQ ID NO: 1-30, or a sequence that is at least 99% identical to any one of SEQ ID NO: 1-30. It should be understood that the chromosomally integrated synthetic polynucleotide sequence can be located within at least one genomic site defined by any one of SEQ ID NO: 1-30 (i.e., one, more than one, or any combination thereof).

[0057] As used herein, the terms "sequence homology" and "sequence identity" are used interchangeably and refer to the number of identical residues in a given alignment of a DNA sequence, RNA sequence or amino acid sequence over a defined length. In order to calculate the sequence identity percentage of any sequence disclosed herein, sequence comparison software can be used, for example, using the default settings on the BLAST software package (V2.10.1).

[0058] "Chromosomally integrated synthetic polynucleotide sequences" may also be referred to as "landing zones" (LPs), allowing any desired payload to be quickly and efficiently integrated into an area of ​​known transcriptional strength in the Salmonella genome, thereby allowing controlled delivery of the payload. The synthetic polynucleotide sequence is inserted into a predetermined pseudogenomic location. As described above, knowing the location where the sequence will be inserted enables a high level of control over the subsequent transcriptional level of the introduced payload, thereby avoiding the unpredictable nature of previous chromosomal integration methods. Previous problems with chromosomal integration methods include that random integration may interfere with host physiology in an unpredictable manner and thus alter its effectiveness as a potential therapeutic strain. The sequence of the present invention is inserted into at least one pseudogenomic location within the Salmonella genome. A pseudogenomic location is a genomic location of the Salmonella genome in which some DNA fragments once contained coding regions that were lost due to mutations and therefore stopped the expression of specific genes.

[0059] The "chromosomally integrated synthetic polynucleotide sequence" or "landing zone" can be incorporated into the Salmonella chromosome by any suitable method known to the skilled person. In a specific embodiment, the "chromosomally integrated synthetic polynucleotide sequence" or "landing zone" sequence is incorporated into the Salmonella chromosome using the classical recombineering scheme disclosed in Datsenko and Wanner, 2000 (PNAS, 97 (12): 6640-6645), wherein the cells are first transformed with a helper plasmid and then with a dsDNA cassette. The helper plasmid is then eliminated and removed. The antibiotic introduced during the recombination is removed by using the protein FLP to excise the antibiotic after recognizing the FRT element. The plasmid expressing FLP is then eliminated and removed.

[0060] For example, the "chromosomal integration synthetic polynucleotide sequence" or "landing zone" sequence can be introduced into the Salmonella chromosome by the following method. Auxiliary plasmids containing beta, gam and exo genes can be introduced into Salmonella strain ZH9 by electroporation. Individual clones can be grown overnight in LB medium supplemented with appropriate antibiotics and aromatic amino acids. The sample can be diluted 1:500 with fresh LB containing antibiotics, amino acids and arabinose to induce auxiliary gene expression. The sample can be grown to the middle of the exponential growth phase and then prepared into electrocompetent. The sample can be electroporated with a double-stranded DNA box. Integration can be confirmed by colony PCR using primers outside the integration region. Successful recombinants are then grown at 43°C without antibiotic selection to induce plasmid elimination. This can be verified by replicate plating of individual clones in medium containing and not containing antibiotics. The final antibiotic resistance within the chromosome can be removed by transformation with plasmid pCP20 (which contains FLP), and the plasmid can then be eliminated.

[0061] It should be noted that in the context of the present invention, plasmids are needed both for the initial introduction of the "chromosomally integrated synthetic polynucleotide sequence" or "landing zone" sequence into the genome and for the initial introduction of the desired payload into the chromosome. However, the present invention avoids the need to use plasmids for Salmonella strains to accommodate the final therapeutic payload (e.g., expression of therapeutic proteins). In the latter case, expression is affected by the number of plasmids (which is variable within the population), may bring cellular burden, and antibiotic resistance markers are usually required. The strains disclosed herein overcome the above disadvantages by incorporating the payload into the chromosome because all auxiliary plasmids are thereby eliminated.

[0062] In one embodiment, the chromosomally integrated synthetic polynucleotide sequence can be located within the sequence of the known genes shown in Table 1. The gene can be selected from the list including ratB, mglA, pbpG, wcaD, wcaK, treA, hvaA, astA, eha, dbpA, Fhue, yceJ, hpcC, fepE, ybbW, ushA, riC, proV, steA or torA.

[0063] Although the genomic sites of Table 1 are loci of enteric Salmonella serotype strains, particularly Salmonella ZH9 strains, it should be understood that the present invention is not limited to the specific pseudogenes present in these genomic locations in the ZH9 strain. Therefore, the present invention also provides a chromosomal synthetic polynucleotide sequence located within at least one genomic site, the at least one genomic site being defined by: any one of SEQ ID NOs: 1-30, or a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to any one of SEQ ID NOs: 1-30. It will be readily understood by those skilled in the art that although the specific pseudogenes present in Salmonella strains may be different, the genomic regions associated with these inactive DNA regions are conserved between different strains. Therefore, in each Salmonella strain, there will be a genomic region including any one of the specific gene sites of Table 1 and the inactive DNA regions on either side of the site.

[0064] Jacobsen et al., 2011 (Microb Ecol, 62: 487-504) defined the pan-genomic sequence of enteric Salmonella strains, demonstrating that not only is there a high degree of homology between Salmonella strains, but also that the variation between different strains is mainly seen in the Salmonella pathogenicity island. In addition, the same study was further conducted and showed genes unique to each serotype (see S2 Supplementary Materials). None of these identified genes are present in Table 1, demonstrating the applicability of the invention disclosed herein to various Salmonella strains.

[0065] Table 1 (Genomic loci from the genome of Salmonella enterica Typhi Ty2; GenBank ID: AE014613):

[0066]

[0067]

[0068] The chromosomal integration synthetic sequence comprises at least one restricted recombination site to allow the introduction of a load. Methods by which this can be achieved are well known to those skilled in the art, for example, by shuttle plasmids or by split plasmid (shuttle and auxiliary) methods. Recombination sites are well known in the art, and in the context of the present invention, are included in restricted sequences on two different molecules (i.e., the chromosomal integration synthetic sequence in the Salmonella genome and the carrier carrying the load) so that a heterologous load can be integrated into the modified Salmonella strains described herein. "Cargo" can be a heterologous DNA or a heterologous RNA.

[0069] For the purposes disclosed herein, the defined recombination sites can be any suitable recombination sites. However, preferably, the defined recombination sites are attB recombination sites. Each attB site comprises a cleavage region, typically comprising 2 bp, which imparts site specificity. For example, the cleavage site can be TT, GC, CT, TA, AT or CC, all of which are orthogonal in nature. The shuttle vector containing the heterologous load to be introduced into the Salmonella genome also contains homologous attP sites on both sides of the load, which allows it to be inserted into the chromosome insertion synthesis sequence in the Salmonella genome in a polar manner (i.e., attB_TT will only react with attP_TT).

[0070] In order to mediate the recognition of the site on the chromosomal integration synthesis sequence and the shuttle vector carrying the load, an enzyme called a recombinase is needed. The technician will readily understand that the selected recombinase will depend on the selected recombination site. The selected recombinase can be inducible or constitutively expressed. In a preferred embodiment, at least one of the restricted recombination sites is the attB recombination site, and the recombinase is a serine recombinase. In one embodiment, the serine recombinase is selected from the list including PhiC31, Bxb1, TG1, TP901, A118, SPBc, Wβ, PhiBT1, Phi370.1, BL3, FC1, K38, R4, PhiRV or MR11. In a preferred embodiment, the serine recombinase is PhiC31 or Bxb1. In a more preferred embodiment, the serine recombinase is PhiC31. Therefore, in a preferred embodiment, the attB recombination site is according to any one of SEQ IDNO:31 to 36 PhiC31 attB recombination site. In another preferred embodiment, the attB recombination site is a Bxbl attB recombination site according to any one of SEQ ID NOs: 37 to 42. As outlined above, the shuttle vector containing the heterologous cargo to be introduced into the Salmonella genome also contains homologous attP sites on either side of the cargo, which allows its insertion into the chromosomal insertion synthesis sequence within the Salmonella genome in a polar manner (i.e., attB_TT will only react with attP_TT, attB_GC will only react with attP_GC, etc., the sites are indicated in bold in the sequence provided at the end of the specification).

[0071] It is desirable to strictly control the expression of serine recombinase to prevent leakage expression of recombinase, while also being robust enough to allow reproducible, high-throughput loading into strains. Any expression system that can achieve the above can be used in the present invention. For example, the expression system can be selected from LacI expression system, TetR expression system, BetI expression system or PhIF expression system (Meyer et al., Nature Chemical Biology, 15: 196-204, 2019). In a preferred embodiment, the expression system is a TetR expression system.

[0072] The inserted chromosomal integration synthetic polynucleotide sequence can also include an insulator region flanking (i.e., located on either side) the restricted recombination site. The insulator region includes a strong bidirectional terminator, and is therefore important for preventing any transcription machinery from interfering with the introduced synthetic sequence, and vice versa. As used herein, the term "bidirectional terminator" refers to a polynucleotide sequence that can terminate RNA polymerase transcription in the sense or antisense direction. Any insulator region that can achieve the above can be used. Preferably, the insulator region can have a sequence according to any one of SEQ ID NO:43-59, or a sequence with at least 70% identity to the sequence. More preferably, the insulator region can have a sequence according to SEQ ID NO:44 (DT5), SEQ ID NO:57 (DT101), SEQ ID NO:56 (DT100), SEQ ID NO:48 (DT42) or SEQ ID NO:49 (DT54). In yet another more preferred embodiment, the chromosomal integration synthetic sequence may be flanked by insulator regions according to SEQ ID NO: 44 (DT5) and SEQ ID NO: 57 (DT101), or sequences having at least 70% identity thereto. Alternatively, the chromosomal integration synthetic sequence may be flanked by insulator regions according to SEQ ID NO: 56 (DT100) and SEQ ID NO: 44 (DT5), or sequences having at least 70% identity thereto. Alternatively, the chromosomal integration synthetic sequence may be flanked by insulator regions according to SEQ ID NO: 48 (DT42) and SEQ ID NO: 49 (DT54), or sequences having at least 70% identity thereto. The insulator region can have a sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to any sequence according to SEQ ID NO: 43-59. It should be noted that during any preclinical testing and experiments, the chromosomal integration synthetic sequence can also include antibiotic markers to select clones that have successfully integrated. Therefore, two FRT sites located on both sides of the antibiotic marker will also exist as a way to remove the antibiotic marker after cloning confirmation. In one embodiment, the antibiotic marker is removed using a FLP recombinase that recognizes the FRT site and removes the DNA located between the two FRT sites. The remaining sequence is referred to as a "scar" sequence. The antibiotic marker can be selected from a list including CmR, CarbR or KanR.Therefore, in one embodiment, the present invention provides a modified attenuated live Salmonella strain, the strain comprising at least one chromosomal integration synthetic polynucleotide sequence inserted into a predetermined pseudogenomic position, the synthetic polynucleotide sequence comprising a FRT site, a first attB attachment site placed upstream of the FRT site, and a second attB attachment site located downstream of the FRT site, wherein the first attB attachment site is located near the 5' terminator region and the second attB attachment site is located near the 3' terminator region. As described above, the modified attenuated live Salmonella strain may also comprise an insulator region.

[0073] To integrate the synthetic sequence into the Salmonella genome, two standardized amplification sites can be used to add recombination overhangs to the 5' and 3' ends of the sequence specific for each location of interest.

[0074] Modified strains disclosed herein may include more than one chromosomal integrated synthetic polynucleotide sequence. Modified strains disclosed herein may include two integrated synthetic polynucleotide sequences. Modified strains disclosed herein may include three integrated synthetic polynucleotide sequences. Modified strains disclosed herein may include four integrated synthetic polynucleotide sequences. Modified strains disclosed herein may include five integrated synthetic polynucleotide sequences. Modified strains disclosed herein may include six integrated synthetic polynucleotide sequences. In a preferred embodiment, modified strains disclosed herein include three integrated synthetic polynucleotide sequences. Different synthetic polynucleotide sequences can be used to import the same type of load in different genomic locations (e.g., genomic locations of different transcription intensities), or can be used to import multiple types of loads into the same strain.

[0075] Modified strains disclosed herein may include a single chromosome-integrated synthetic polynucleotide sequence. In a preferred embodiment, modified strains disclosed herein may include a single chromosome-integrated synthetic polynucleotide according to SEQ ID NO:60. Alternatively, modified strains disclosed herein may include multiple chromosome-integrated synthetic polynucleotide sequences. In order to minimize internal recombination events (wherein the modified strain includes multiple chromosome-integrated synthetic polynucleotide sequences), the synthetic sequence may include different attB sites and / or terminator regions. In a preferred embodiment, modified strains disclosed herein may include multiple chromosome-integrated synthetic polynucleotide sequences according to SEQ ID NO:60, 61, 62, or any combination thereof.

[0076] Thus, in one embodiment, the chromosomally integrated synthetic polynucleotide sequence may comprise a sequence according to SEQ ID NO: 60, 61, 62, or a sequence having at least 70% identity to SEQ ID NO: 60, 61, 62, or any combination thereof.For example, the chromosomally integrated synthetic polynucleotide sequence may comprise a sequence according to SEQ ID NO: 60, 61, 62, or a sequence having at least 75% identity to SEQ ID NO: 60, 61, 62; the chromosomally integrated synthetic polynucleotide sequence may comprise a sequence according to SEQ ID NO: 60, 61, 62, or a sequence having at least 80% identity to SEQ ID NO: 60, 61, 62; the chromosomally integrated synthetic polynucleotide sequence may comprise a sequence according to SEQ ID NO: 60, 61, 62, or a sequence having at least 85% identity to SEQ ID NO: 60, 61, 62; the chromosomally integrated synthetic polynucleotide sequence may comprise a sequence according to SEQ ID NO: 60, 61, 62, or a sequence having at least 90% identity to SEQ ID NO: 60, 61, 62; the chromosomally integrated synthetic polynucleotide sequence may comprise a sequence according to SEQ ID NO: 60, 61, 62, or a sequence having at least 90% identity to SEQ ID NO: 60, 61, 62 NO:60, 61, 62 has at least 91% identity; the chromosomally integrated synthetic polynucleotide sequence may comprise a sequence according to SEQ ID NO:60, 61, 62, or a sequence having at least 92% identity with SEQ ID NO:60, 61, 62; the chromosomally integrated synthetic polynucleotide sequence may comprise a sequence according to SEQ ID NO:60, 61, 62, or a sequence having at least 93% identity with SEQ ID NO:60, 61, 62; the chromosomally integrated synthetic polynucleotide sequence may comprise a sequence according to SEQ ID NO:60, 61, 62, or a sequence having at least 94% identity with SEQ ID NO:60, 61, 62; the chromosomally integrated synthetic polynucleotide sequence may comprise a sequence according to SEQ ID NO:60, 61, 62, or a sequence having at least 95% identity with SEQ ID NO:60, 61, 62; the chromosomally integrated synthetic polynucleotide sequence may comprise a sequence according to SEQ ID NO:60, 61, 62, or a sequence having at least 95% identity with SEQ ID NO:60, 61, 62 IDNO:60, 61, 62 has a sequence with at least 96% identity; the chromosomally integrated synthetic polynucleotide sequence may include a sequence according to SEQ ID NO:60, 61, 62, or a sequence with at least 97% identity with SEQ ID NO:60, 61, 62; the chromosomally integrated synthetic polynucleotide sequence may include a sequence according to SEQ ID NO:60, 61, 62, or a sequence with at least 98% identity with SEQ ID NO:60, 61, 62; or the chromosomally integrated synthetic polynucleotide sequence may include a sequence according to SEQ ID NO:60, 61, 62, or a sequence with at least 99% identity with SEQ ID NO:60, 61, 62.

[0077] The modified strain disclosed herein may comprise a synthetic sequence according to SEQ ID NO:60. The modified strain disclosed herein may comprise a synthetic sequence according to SEQ ID NO:60, wherein SEQ ID NO:60 is flanked by insulator regions according to SEQ ID NOs:44 and 57. The modified strain disclosed herein may comprise a synthetic sequence according to SEQ ID NO:61. The modified strain disclosed herein may comprise a synthetic sequence according to SEQ ID NO:61, wherein SEQ ID NO:61 is flanked by insulator regions according to SEQ ID NOs:56 and 44. The modified strain disclosed herein may comprise a synthetic sequence according to SEQ ID NO:62. The modified strain disclosed herein may comprise a synthetic sequence according to SEQ ID NO:62, wherein SEQ ID NO:62 is flanked by insulator regions according to SEQ ID NOs:48 and 49.

[0078] The modified strain disclosed herein may comprise a synthetic sequence according to SEQ ID NO: 60 and a synthetic sequence according to SEQ ID NO: 61. The modified strain disclosed herein may comprise a synthetic sequence according to SEQ ID NO: 60 and a synthetic sequence according to SEQ ID NO: 62. The modified strain disclosed herein may comprise a synthetic sequence according to SEQ ID NO: 61 and a synthetic sequence according to SEQ ID NO: 62. The modified strain disclosed herein may comprise a synthetic sequence according to SEQ ID NO: 60, a synthetic sequence according to SEQ ID NO: 61, and a synthetic sequence according to SEQ ID NO: 62.

[0079] SEQ ID NO:60, 61 and 62 may also comprise an antibiotic marker, as described above. Thus, the modified strain disclosed herein may comprise a synthetic sequence according to SEQ ID NO:63, 64 or 65.

[0080] As mentioned above, the attenuated live strain to be modified can be any Salmonella enterica strain. In a preferred embodiment, the attenuated live strain is Salmonella enterica serotype Typhi strain. Alternatively, the attenuated live strain can be Salmonella enterica serotype Typhimurium strain. In one embodiment, the attenuated live strain is selected from Ty21a, CVD 908-htrA, CVD 909, Ty800, M01ZH09 (" ZH9 "), x9633, x639, x9640, x8444, ZH9PA, DTY88, MD58, WT05, ZH26, SL7838, SL7207, VNP20009, A1-R or any combination thereof. In a preferred embodiment, the attenuated live strain is M01ZH09. These attenuated live strains are easily available, and are easily identified and commonly used by those skilled in the art. For example, EP2801364A1 discloses Ty21a, CVD908-htrA, CVD909, Ty800, M01ZH09, χ9633, χ9640 and χ8444. In addition, EP3917565A1 discloses in detail the ZH9 strain and its derivatives, including ZH9PA. Further references to these strains can be found in the literature, in particular in Petrovska 2004, Hindle 2002, Lehouritis 2017 and Kimura 2010. Also intended to be included are any derivatives or variants of the strains, including genetically engineered or genetically modified strains.

[0081] The Salmonella strain disclosed herein can be a non-natural bacteria that is genetically engineered. For example, the attenuated live strain can include an attenuated mutation in the Salmonella pathogenicity island 2 (SPI-2) gene and / or an attenuated mutation in a second gene. Suitable genes and details of such modified strains are described in WO2000 / 68261, the entire contents of which are incorporated herein by reference.

[0082] In one embodiment, the SPI-2 gene is a ssa gene. For example, the present invention includes attenuating mutations in one or more of ssaV, ssaJ, ssaU, ssaK, ssaL, ssaM, ssaO, ssaP, ssaQ, ssaR, ssaS, ssaT, ssaD, ssaE, ssaG, ssaI, ssaC, and ssaH. Preferably, the attenuating mutation is in the ssaV or ssaJ gene. More preferably, the attenuating mutation is in the ssaV gene.

[0083] The non-natural bacteria of genetic engineering can also comprise attenuated mutation in the second gene, and it can be in or not in the SPI-2 region.The mutation can be outside the SPI-2 region and participate in the biosynthesis of aromatic compounds.For example, the present invention includes attenuated mutation in the aro gene.In a preferred embodiment, the aro gene is aroA or aroC.More preferably, the aro gene is aroC.

[0084] In another embodiment, the genetically engineered non-natural bacteria can be derived from a Salmonella species and can include inactivating mutations of one or more genes selected from pltA, pltB, cdtB and ttsA, and also include attenuating mutations of one or more genes selected from aroA and / or aroC and / or ssaV. The details of the genes and mutations are as described in WO 2019 / 110819, the entire contents of which are incorporated herein by reference.

[0085] It is envisaged that inactivating mutations (e.g. deletions) in the genes pltA, pltB and cdtB will prevent the production of typhoid toxin by Salmonella species and that inactivating mutations (e.g. deletions) in ttsA will prevent the secretion of typhoid toxin by Salmonella species. It is envisaged that the non-natural bacterium may in particular be derived from Salmonella enterica.

[0086] As will be appreciated by those skilled in the art, genes can be mutated by many methods well known in the art, such as homologous recombination using a recombinant plasmid targeting a gene of interest, in which case an engineered gene having homology to the target gene is incorporated into a suitable nucleic acid carrier (e.g., plasmid or phage), and the carrier is transfected into a target cell. The homologous engineered gene is then recombined with the native gene to replace or mutate the native gene to achieve the desired inactivation mutation. This modification can be located in the coding portion or any regulatory portion of the gene, such as a promoter region. As will be appreciated by those skilled in the art, any suitable gene modification technology can be used to mutate a gene of interest, such as a CRISPR / Cas system, such as CRISPR / Cas9, TALENS.

[0087] Therefore, those skilled in the art will be familiar with the various methods and techniques for genetically engineering bacterial strains. These techniques include those required for the introduction of heterologous genes into bacteria by chromosome integration or by the introduction of stable autosomal self-replicating genetic elements. Exemplary methods for genetically modifying (also referred to as "conversion" or "engineering") bacterial cells include phage infection, transduction, conjugation, lipofection or electroporation. General discussion of these and other methods in molecular and cellular biochemistry can be found in such standard textbooks: Molecular Cloning: A Laboratory Manual, 3rd Edition. (Sambrook et al., Hallbor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Edition (Ausubel et al., ed., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); It is incorporated herein by reference.

[0088] The predetermined genomic location in which the chromosomal integration synthetic polynucleotide sequence is inserted can be a genomic location of low transcription intensity or high transcription intensity. In some embodiments, the predetermined genomic location is a genomic location of low transcription intensity. In some embodiments, the predetermined genomic location is a genomic location of high transcription intensity. Technicians will easily recognize that the transcription intensity of the position will depend on the load to be delivered. For example, in the case where the load to be delivered may have toxicity, it may be desirable to insert into a genomic region with low transcription intensity to more strictly control its delivery. On the other hand, in the case where the load to be delivered requires high-level expression to be effective and / or has the relevant side effects minimized, it may be more desirable to insert into a genomic region with high transcription intensity.

[0089] The present invention enables any load of interest to be integrated into the genome of the Salmonella strain to be delivered to an object in need thereof. Therefore, according to the needs of the object, the load can be a series of different molecules or compounds. The load can be therapeutic or non-therapeutic. For example, a heterologous polynucleotide sequence can be a DNA or RNA sequence encoding an immunogenic compound or a therapeutic compound (e.g., a cancer therapeutic agent). Alternatively, a heterologous polynucleotide sequence can be a DNA or RNA sequence encoding a protein related to the function of bacteria or the ability of bacteria to act as a delivery vector, for example, a heterologous polynucleotide sequence can encode a protein required for successful transduction. A heterologous polynucleotide sequence can be an RNA molecule intended to be delivered to a target cell, in which case the RNA molecule is subsequently translated into a protein by a cell machine of a host cell (e.g., a mammalian cell). A heterologous polynucleotide sequence can encode a protein related to the lysis of a bacterial cell, so as to release an RNA molecule or a desired protein. In the case where a heterologous polynucleotide sequence is an RNA sequence, the RNA molecule can be an mRNA molecule. In the case where a heterologous polynucleotide sequence is an RNA sequence, the RNA molecule can be an siRNA molecule. In the case where a heterologous polynucleotide sequence is an RNA sequence, the RNA molecule can be an shRNA molecule. In case the heterologous polynucleotide sequence is an RNA sequence, the RNA molecule may be a miRNA molecule.

[0090] In a preferred embodiment, the heterologous polynucleotide sequence may encode an immunogenic compound or a cancer therapeutic agent. The term "immunogenic compound" refers to any compound that triggers an immune response in a subject in need thereof. For example, the immunogenic compound may be an antigen derived from a bacterial, viral, fungal or parasitic source that triggers an immune response in the subject against the specific antigen. Alternatively, the immunogenic compound may be a tumor-associated antigen. Tumor-associated antigens are antigenic substances produced in tumor cells that trigger an immune response in the subject. Therefore, the present invention may be a cancer vaccine comprising a modified strain disclosed herein, the modified strain comprising a polynucleotide sequence encoding a tumor-associated antigen. Tumor-associated antigens may be selected from CD133, CD138, BCMA (B cell maturation antigen), EGFR (epidermal growth factor receptor), EpCAM (epithelial cell adhesion molecule), GD2, GPC3, HER2, HerinCAR-PD1, MSLN (mesothelin), MG7, MUC1, LMP1, PSMA (prostate-specific membrane antigen), PSCA (prostate stem cell antigen), alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, epithelial tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE) and p53. Alternatively, the heterologous polynucleotide sequence may encode a cancer therapeutic agent. The skilled person will readily recognize that the specific cancer therapeutic agent to be encoded will depend on the specific needs of the subject to be treated. For example, a cancer therapeutic agent may encode a therapeutic antibody. As used herein, the term "therapeutic antibody" includes the entire antibody and any antigen-binding fragment (i.e., antigen-binding portion) or single chain thereof that produces a therapeutic effect. In one embodiment, the therapeutic antibody may be a monoclonal antibody. As used herein, the term "monoclonal antibody" refers to a preparation of antibody molecules of a single molecular composition. A monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope. The monoclonal antibody can be a human antibody or a humanized antibody. Alternatively, the cancer therapeutic agent can be a cytokine or chemokine intended to modulate the immune system of a subject in need thereof.

[0091] The use of chromosomally integrated synthetic polynucleotide sequences in the genome of a Salmonella strain allows for the introduction of larger DNA / RNA constructs into the Salmonella chromosome. The size of the heterologous polynucleotide can be in the range of 1 Kbp to 10 Kbp. For example, the size of the heterologous polynucleotide can be in the range of 1 Kbp to 2 Kbp, the size of the heterologous polynucleotide can be in the range of 1 Kbp to 3 Kbp, the size of the heterologous polynucleotide can be in the range of 1 Kbp to 4 Kbp, the size of the heterologous polynucleotide can be in the range of 1 Kbp to 5 Kbp, the size of the heterologous polynucleotide can be in the range of 1 Kbp to 6 Kbp, the size of the heterologous polynucleotide can be in the range of 1 Kbp to 7 Kbp, the size of the heterologous polynucleotide can be in the range of 1 Kbp to 8 Kbp, the size of the heterologous polynucleotide can be in the range of 1 Kbp to 9 Kbp, the size of the heterologous polynucleotide can be in the range of 2 Kbp. bp to 3Kbp, the size of the heterologous polynucleotide may be in the range of 2Kbp to 4Kbp, the size of the heterologous polynucleotide may be in the range of 2Kbp to 5Kbp, the size of the heterologous polynucleotide may be in the range of 2Kbp to 6Kbp, the size of the heterologous polynucleotide may be in the range of 2Kbp to 7Kbp, the size of the heterologous polynucleotide may be in the range of 2Kbp to 8Kbp, the size of the heterologous polynucleotide may be in the range of 2Kbp to 9Kbp, the size of the heterologous polynucleotide may be in the range of 2Kbp to 10Kbp, 3Kbp to 4Kbp, the size of the heterologous polynucleotide may be in the range of 3Kbp to 5Kbp The size of the heterologous polynucleotide may be in the range of 3Kbp to 6Kbp, the size of the heterologous polynucleotide may be in the range of 3Kbp to 7Kbp, the size of the heterologous polynucleotide may be in the range of 3Kbp to 8Kbp, the size of the heterologous polynucleotide may be in the range of 3Kbp to 9Kbp, the size of the heterologous polynucleotide may be in the range of 3Kbp to 10Kbp, the size of the heterologous polynucleotide may be in the range of 4Kbp to 5Kbp, the size of the heterologous polynucleotide may be in the range of 4Kbp to 6Kbp, the size of the heterologous polynucleotide may be in the range of 4Kbp to 7Kbp, the size of the heterologous polynucleotide may be in the range of The size of the heterologous polynucleotide may be in the range of 4 Kbp to 8 Kbp, the size of the heterologous polynucleotide may be in the range of 4 Kbp to 9 Kbp, the size of the heterologous polynucleotide may be in the range of 4 Kbp to 10 Kbp, the size of the heterologous polynucleotide may be in the range of 5 Kbp to 6 Kbp, the size of the heterologous polynucleotide may be in the range of 5 Kbp to 7 Kbp, the size of the heterologous polynucleotide may be in the range of 5 Kbp to 8 Kbp, the size of the heterologous polynucleotide may be in the range of 5 Kbp to 9 Kbp, the size of the heterologous polynucleotide may be in the range of 5 Kbp to 10 Kbp, the size of the heterologous polynucleotide may be in the range of 6 Kbp to 7 Kbp,The size of the heterologous polynucleotide may be in the range of 6Kbp to 8Kbp, the size of the heterologous polynucleotide may be in the range of 6Kbp to 9Kbp, the size of the heterologous polynucleotide may be in the range of 6Kbp to 10Kbp, the size of the heterologous polynucleotide may be in the range of 7Kbp to 8Kbp, the size of the heterologous polynucleotide may be in the range of 7Kbp to 9Kbp, the size of the heterologous polynucleotide may be in the range of 7Kbp to 10Kbp, the size of the heterologous polynucleotide may be in the range of 8Kbp to 9Kbp, the size of the heterologous polynucleotide may be in the range of 8Kbp to 10Kbp, the size of the heterologous polynucleotide may be in the range of 9Kbp to 10Kbp. In a preferred embodiment, the size of the heterologous polynucleotide may be in the range of 1Kbp to 2Kbp.

[0092] In a second aspect, the present invention provides a vaccine composition comprising the modified attenuated live strain disclosed herein. The vaccine composition may be a cancer vaccine. The vaccine composition may be a viral vaccine or a bacterial vaccine.

[0093] The vaccine composition may also include a pharmaceutically acceptable carrier, excipient or adjuvant. The phrase "pharmaceutically or pharmacologically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic or other adverse reactions when properly administered to animals (e.g., humans). Such formulations are known to those skilled in the art. In addition, for animal (e.g., human) administration, it should be understood that the formulation should meet sterility, pyrogenicity, general safety and purity standards (if applicable) when applicable.

[0094] As used herein, "pharmaceutically acceptable carriers, excipients or adjuvants" include any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegrants, lubricants, sweeteners, flavoring agents, dyes and the like, and combinations thereof, as known to those of ordinary skill in the art (see, e.g., Remington's Pharmaceutical Sciences, 18th edition. Mack Printing Company, 1990, pp. 1289-1329). Examples include, but are not limited to, disodium hydrogen phosphate, soy peptone, potassium dihydrogen phosphate, ammonium chloride, sodium chloride, magnesium sulfate, calcium chloride, sucrose, borate buffer, sterile saline solution (0.9% NaCl) and sterile water.

[0095] In a third aspect, the present invention provides use of the modified attenuated live strain disclosed herein for preventing or treating cancer.

[0096] The modified attenuated live strain disclosed herein can be used to prevent, treat or delay the recurrence of the neoplastic disease relevant to solid tumor or hematological malignancy.Such diseases include sarcoma, carcinoma, adenocarcinoma, melanoma, myeloma, blastoma, glioma, lymphoma or leukemia.In a preferred embodiment, neoplastic disease is relevant to solid tumor.In a specific aspect, neoplastic disease is relevant to the cancer selected from prostate cancer, liver cancer, kidney cancer, lung cancer, breast cancer, colorectal cancer, bladder cancer, pancreatic cancer, brain cancer, liver cancer, lymphoma, leukemia, gastric cancer, cervical cancer, ovarian cancer, thyroid cancer, melanoma, malignant epithelial tumor, head and neck cancer, skin cancer or sarcoma.

[0097] Neoplasia, tumors and cancers include benign, malignant, metastatic and non-metastatic types, and include any stage (I, II, III, IV or V) or grade (G1, G2, G3, etc.) of a neoplasia, tumor or cancer, or a neoplasia, tumor, cancer or metastasis that is progressing, worsening, stable or in remission. In one embodiment, the neoplastic disease is benign. In another embodiment, the neoplastic disease is malignant. In another embodiment, the neoplastic disease is metastatic. In another embodiment, the neoplastic disease is non-metastatic.

[0098] Cancers that may be treated according to the present invention include, but are not limited to, cells or neoplasms of the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestinal tract, gums, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testicles, tongue, or uterus. In addition, the cancer may specifically be, but is not limited to, the following histological types: neoplasms, malignant; malignant epithelial tumors; undifferentiated type; giant cell and spindle cell carcinomas; small cell carcinomas; papillary carcinomas; squamous cell carcinomas; lymphoepithelial carcinomas; basal cell carcinomas; pilomatricomas; transitional cell carcinomas; papillary transitional cell carcinomas; adenocarcinomas; gastrinomas; cholangiocarcinomas; hepatocellular carcinomas; combined hepatocellular carcinomas and cholangiocarcinomas; trabecular adenocarcinomas; adenoid cystic carcinomas; adenocarcinomas in adenomatous polyps; adenocarcinomas, familial polyposis coli; solid carcinomas; malignant carcinoid tumors; bronchiolar-alveolar adenocarcinomas ; papillary adenocarcinoma; chromophobe cell carcinoma; oncocytic carcinoma; oncocytic adenocarcinoma; basophilic cell carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinomas; nonencircling sclerosing carcinoma; adrenocortical cell carcinoma; endometrioid carcinoma; carcinoma of skin appendages; apocrine carcinoma; sebaceous gland carcinoma; cervical gland carcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; invasive ductal carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget's disease, breast; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma with squamous metaplasia; malignant thymoma; malignant stromal tumor of the ovary; malignant thecoma cell tumor; malignant granulosa cell tumor of the ovary; malignant testicular blastoma; Sertoli cell carcinoma; Leydig cell carcinoma tumour, malignant; malignant lipid cell tumor; malignant paraganglioma; malignant extramammary paraganglioma; pheochromocytoma; glomus sarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; malignant blue nevus; sarcoma; fibrosarcoma; malignant fibrous histiocytoma; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; malignant stromal tumor; Brenner's tumor tumour, malignant; malignant phyllodes tumor; synovial sarcoma; malignant mesothelioma; dysgerminoma; embryonal carcinoma; malignant teratoma; malignant ovarian thyroid tumor; choriocarcinoma; malignant mesonephroma; hemangiosarcoma; malignant hemangioendothelioma; Kaposi's sarcoma; malignant hemangiopericytoma; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; malignant chondroblastoma; mesenchymal chondrosarcoma; giant cell tumor of bone; Ewing's sarcoma;malignant odontogenic tumors; ameloblastic odontoma; malignant ameloblastoma; ameloblastic fibrosarcoma; malignant pinealoma; chordoma; malignant glioma; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrous astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroglioma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumors; malignant meningioma; neurofibrosarcoma; malignant neurilemoma; malignant granular cell tumor; malignant lymphoma; Hodgkin's lymphoma lymphoma; Hodgkin's disease; granulomatous tumor; small lymphocytic malignant lymphoma; large cell diffuse malignant lymphoma; follicular malignant lymphoma; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphocytic leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryocyte leukemia; myeloid sarcoma; and hairy cell leukemia.

[0099] In a preferred embodiment, the cancer can be selected from prostate cancer, liver cancer, kidney cancer, lung cancer, breast cancer, colorectal cancer, bladder cancer, pancreatic cancer, brain cancer, hepatocellular carcinoma (liver cancer), lymphoma, leukemia, gastric cancer, cervical cancer, ovarian cancer, thyroid cancer, melanoma, malignant epithelial tumors, head and neck cancer, skin cancer or sarcoma. In another preferred embodiment, the cancer is selected from lung cancer, kidney cancer, bladder cancer, ovarian cancer, liver cancer, gastric cancer, colorectal cancer, head and neck cancer or breast cancer.

[0100] In a fourth aspect, the present invention provides a use of the modified attenuated live strain disclosed herein for treating infectious diseases. Infectious diseases can be caused by viruses, bacteria, fungi or parasites.

[0101] In a fifth aspect, the present invention provides the use of the modified attenuated live strain disclosed herein for treating an autoimmune disease or disorder.

[0102] Therefore, the present invention can be used to achieve therapeutic benefit in the object in need thereof.Therapeutic benefit or beneficial effect is any objective or subjective, instantaneous, temporary or long-term improvement of the patient's condition or pathology, or with cell proliferation or cell hyperproliferative disorders (such as neoplasia, tumor or cancer or metastasis) or by infectious diseases or by the onset of adverse symptoms related to or caused by autoimmune diseases / disorders, severity, duration or the reduction of frequency.This can lead to an increase in survival rate.For example, when there is a gradual or partial reduction in severity, duration or frequency of one or more related conditions, adverse symptoms or complications, or one or more cell proliferation or cell hyperproliferative disorders (such as neoplasia, tumor or cancer or metastasis or the characteristic of infectious diseases or autoimmune diseases / disorders) physiology, biochemistry, cell performance or characteristic are suppressed or reversed, the method of the present invention according to the present invention achieves a satisfactory clinical endpoint. The therapeutic benefit or improvement in the context of cancer can therefore be, but is not limited to, the destruction of target proliferative cells (e.g., neoplasia, tumor or cancer or metastasis), or the ablation of one or more, most or all conditions, adverse symptoms or complications associated with or caused by cell proliferation or cell hyperproliferative disorders (such as neoplasia, tumor or cancer or metastasis). However, the therapeutic benefit or improvement does not need to cure or completely destroy all target proliferative cells (e.g., neoplasia, tumor or cancer or metastasis) or ablate all conditions, adverse symptoms or complications associated with or caused by cell proliferation or cell hyperproliferative disorders (e.g., neoplasia, tumor or cancer or metastasis). For example, by inhibiting the progression or deterioration of a tumor or cancer, partially destroying a tumor or cancer cell mass or stabilizing a tumor or cancer mass, size or cell number can reduce mortality and prolong life, even if it only lasts for a few days, weeks or months, even if a tumor or cancer mass, size or cell part or most of it is still retained. In the context of infectious diseases, the therapeutic benefit or improvement can be, but is not limited to, viral, bacterial, fungal or parasitic load reduction. In the context of an autoimmune disease / disorder, a therapeutic benefit or improvement may be, but is not limited to, a decrease in inflammatory markers or a reduction in autoantibody titers.

[0103] Attenuated live Gram-negative bacteria can be administered orally. As used herein, the terms "oral" or "oral administration" are used interchangeably, and refer to the oral administration of Salmonella via the object in need thereof. However, it is also contemplated that other methods of administration can be used in some cases. Therefore, in some cases, the modified attenuated live Salmonella of the present invention can be administered by injection, infusion, continuous infusion, intravenous, intradermal, intraarterial, intralesional, intravaginal, intrarectal, intramuscular, intraperitoneal, subcutaneous, subconjunctival, mucosal, pericardial, umbilical, intraocular, intracranial, intraarticular, intraprostatic, intrapleural, intratracheal, intranasal, via catheter, via lavage or other methods known to those of ordinary skill in the art or any combination thereof (see, e.g., Remington's Pharmaceutical Sciences, 18th edition. Mack Printing Company, 1990). Alternatively, in the context of treating neoplastic diseases, preferred routes of administration are intratumoral and peritumoral.

[0104] In one embodiment, the modified strain disclosed herein can be administered in combination with another therapeutic agent, which depends on the disease to be treated. For example, the modified strain can be administered in combination with immunotherapy, chemotherapy, radiotherapy, antiviral therapy, antibacterial therapy, antifungal therapy, or antiparasitic therapy. Chemotherapeutic agents include, but are not limited to, alkylating agents, plant alkaloids, antitumor antibiotics, antimetabolites, and / or topoisomerase inhibitors, or any combination thereof.

[0105] In preferred embodiments, the immunotherapy is a checkpoint inhibitor, antigen-specific T cells, therapeutic antibodies, or a cancer vaccine.

[0106] Immunotherapy can be a checkpoint inhibitor, and the term "checkpoint inhibitor" refers to a blocker for a checkpoint molecule in this article. The blocker can be an antagonist, an inhibitor, or a blocking antibody. Therefore, the blocker can be a small molecule or a biological drug, and in certain cases a monoclonal antibody. In a preferred embodiment, the checkpoint inhibitor is directed to CTLA-4, PD-1, PD-L1, LAG-3, TIM-3, BTLA, TIGIT, VISTA, or any combination thereof.

[0107] Checkpoint inhibitors can be therapeutic antibodies for specific cancers or tumors of subjects in need thereof. In a specific embodiment, the therapeutic antibody can be a monoclonal antibody, and more preferably a humanized or human monoclonal antibody. Methods for obtaining such monoclonal antibodies are known to those skilled in the art. Therapeutic antibodies can block abnormal proteins in cancer cells, attach to specific proteins on cancer cells, or be conjugated to cytotoxic molecules (e.g., anticancer drugs). The latter marks cancer cells to the immune system so that abnormal cells can then be targeted and destroyed by cellular components of the immune system. Examples of monoclonal antibodies for checkpoint inhibitors include, but are not limited to, ipilimumab Nivolumab and pembrolizumab

[0108] In another embodiment, immunotherapy can be adoptive cell therapy, wherein immune cells are transferred to patients / objects, and the most common reason is its improved functionality and characteristics. The cells to be transferred can be derived from the object (autologous) or from another object (allogeneic). The example of this adoptive cell therapy is not limited to engineered or unengineered macrophages, engineered or unengineered γδT cells, engineered or unengineered natural killer cells. Therefore, adoptive cell therapy includes but is not limited to tumor infiltrating lymphocytes (TIL) therapy, engineered T cell receptor (TCR) therapy and / or natural killer (NK) cell therapy, and its details will be well known to those skilled in the art (Adoptive cellular therapies: the current landscape, Rohaan et al. 2019, Virchows Arch. 474 (4): 449-461).

[0109] Immunotherapy can be CAR T cell therapy. CAR T cell therapy can be allogeneic or autologous. In some cases, CAR T cell therapy can be directed to the antigen CD19 present in B cell-derived cancer. Therefore, this therapy can be particularly suitable for B cell-derived cancers, such as acute lymphoblastic leukemia (ALL) and diffuse large B cell lymphoma (DLBCL). In other cases, CAR T cell therapy will be directed to tumor-associated antigens (TAA), and is therefore more suitable for treating solid tumors. Examples of such antigens include, but are not limited to, CD133, CD138, BCMA, CEA, EGFR, EpCAM, GD2, GPC3, HER2, HerinCAR-PD1, MSLN, MG7, MUC1, LMP1, PSMA and PSCA. Such technology will be well known to those skilled in the art, and readers can refer to a review entitled "Adoptive cellular therapies: the current landscape" for further information (Rohaan et al. 2019, Virchows Arch. 474 (4): 449-461).

[0110] The above-mentioned additional therapeutic agent can be administered before the modified Salmonella strain disclosed herein. The above-mentioned additional therapeutic agent can be administered after the modified Salmonella strain disclosed herein. The above-mentioned additional therapeutic agent can be administered substantially simultaneously with the modified Salmonella strain disclosed herein. When it is intended to administer the modified Salmonella strain disclosed herein for the purpose of activating the immune system of the subject, it is preferably administered before administering the additional therapeutic agent. Therefore, the modified Salmonella strain can act as an initiator. The modified Salmonella strain and the additional therapeutic agent can act in an additive or synergistic manner to improve the clinical outcome of the subject in need thereof.

[0111] In a sixth aspect, the present invention provides a method for treating, inhibiting or controlling a neoplastic disease or an infectious disease in a subject, wherein the method comprises administering to the subject a modified, attenuated live Salmonella strain, the strain comprising at least one chromosomally integrated synthetic polynucleotide sequence inserted into a predetermined pseudogenomic location, the sequence comprising at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, wherein the chromosomally integrated synthetic polynucleotide sequence is located within at least one genomic site defined by any one of SEQ ID NOs: 1-30 or a sequence having at least 70% identity to any one of SEQ ID NOs: 1-30.

[0112] In one embodiment, the chromosomally integrated synthetic polynucleotide sequence is located within at least one genomic site consisting of any one of SEQ ID NOs: 1-30 or at least 75% identical to any one of SEQ ID NOs: 1-30, at least 80% identical to any one of SEQ ID NOs: 1-30, at least 85% identical to any one of SEQ ID NOs: 1-30, at least 90% identical to any one of SEQ ID NOs: 1-30, at least 91% identical to any one of SEQ ID NOs: 1-30, at least 92% identical to any one of SEQ ID NOs: 1-30, at least 93% identical to any one of SEQ ID NOs: 1-30, at least 94% identical to any one of SEQ ID NOs: 1-30, at least 95% identical to any one of SEQ ID NOs: 1-30, at least 96% identical to any one of SEQ ID NOs: 1-30, at least 97% identical to any one of SEQ ID NOs: 1-30, at least 98% identical to any one of SEQ ID NOs: 1-30, at least 99% identical to any one of SEQ ID NOs: 1-30, at least 100% identical to any one of SEQ ID NOs: 1-30, at least 101% identical to any one of SEQ ID NOs: 1-30, at least 102% identical to any one of SEQ ID NOs: 1-30, at least 103% identical to any one of SEQ ID NOs: 1-30, at least 104% identical to any one of SEQ ID NOs: 1-30, at least 105% identical to any one of SEQ ID NOs: 1-30 The invention is defined by a sequence that is at least 97% identical to any one of SEQ ID NOs: 1-30, at least 98% identical to any one of SEQ ID NOs: 1-30, or at least 99% identical to any one of SEQ ID NOs: 1-30.

[0113] In a seventh aspect, the present invention provides a method for modifying a live attenuated Salmonella strain, the method comprising inserting a synthetic polynucleotide sequence into a predetermined pseudogenomic position of the live attenuated Salmonella strain, the sequence comprising at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, wherein the chromosomally integrated synthetic polynucleotide sequence is located within at least one genomic site, the genomic site being defined by any one of SEQ ID NO: 1-30 or a sequence having at least 70% identity to any one of SEQ ID NO: 1-30 (Table 1).

[0114] In one embodiment, the chromosomally integrated synthetic polynucleotide sequence is located within at least one genomic site consisting of any one of SEQ ID NOs: 1-30, or at least 75% identical to any one of SEQ ID NOs: 1-30, at least 80% identical to any one of SEQ ID NOs: 1-30, at least 85% identical to any one of SEQ ID NOs: 1-30, at least 90% identical to any one of SEQ ID NOs: 1-30, at least 91% identical to any one of SEQ ID NOs: 1-30, at least 92% identical to any one of SEQ ID NOs: 1-30, at least 93% identical to any one of SEQ ID NOs: 1-30, at least 94% identical to any one of SEQ ID NOs: 1-30, at least 95% identical to any one of SEQ ID NOs: 1-30, at least 96% identical to any one of SEQ ID NOs: 1-30, at least 97% identical to any one of SEQ ID NOs: 1-30, at least 98% identical to any one of SEQ ID NOs: 1-30, at least 99% identical to any one of SEQ ID NOs: 1-31, at least 100% identical to any one of SEQ ID NOs: 1-32, at least 101% identical to any one of SEQ ID NOs: 1-33, at least 102% identical to any one of SEQ ID NOs: 1-34, at least 103% identical to any one of SEQ ID NOs: 1-35, at least 104% identical to any one of SEQ ID NOs: 1-36, at least 105% identical to any one of SEQ ID NOs: 1-37, at least 106% identical to any one of SEQ ID NOs: 1-38, at The invention is defined by a sequence that is at least 97% identical to any one of SEQ ID NOs: 1-30, at least 98% identical to any one of SEQ ID NOs: 1-30, or at least 99% identical to any one of SEQ ID NOs: 1-30.

[0115] Defined recombination sites will be present in the synthetic polynucleotide sequence. Appropriate recombination sites will be present to allow any payload to be introduced into the landing zone after integration into the chromosome. The landing zone of the present invention can contain specific attB recombination sites in pseudogenomic positions that have previously been introduced into the genome. The payload can be surrounded by attP recombination sites that react uniquely to specific attB sequences in the genome. If there are two or more attB sequences in the genome, the payload will only be inserted into the attB sequence that matches.

[0116] The inventors of the present invention have unexpectedly discovered that any desired cargo of interest can be efficiently and easily integrated into a region of the chromosome of a Salmonella strain that has previously been characterized for gene expression (enabling control of transcription intensity) by introducing at least one chromosomally integratable synthetic polynucleotide that is inserted into a predetermined pseudogenomic location of the Salmonella strain. Furthermore, the inventors have shown that modifying the Salmonella strain in this manner does not affect strain growth, viability, or its potential downstream therapeutic effects.

[0117] The invention is further described with reference to the following non-limiting examples.

[0118] Example

[0119] Example 1: Validation of the ZH9 strain genome and computational selection of landing zone locations

[0120] The ZH9 Salmonella strain obtained from Glycerol Master Stock was grown continuously in vLBaro medium at 37°C and 200 rpm for 8 days, with subcultures every 12 hours. Aliquots were taken on days 1, 4, and 8, and the genome was subsequently sequenced. This assay allowed the establishment of a working protocol to evaluate the genome sequence of the ZH9 strain in the presence or absence of the landing zone sequence.

[0121] The genome sequence of ZH9 was aligned with the reference genome (Ty21a Salmonella strain) and the differences were analyzed (see Figure 1 As expected, major differences were found in the genes aroC and ssaV. Other minor changes were identified, although these did not affect known / characterized genetic elements.

[0122] After the reference genome was established, the locations of 218 pseudogenomes in the chromosomes were determined (see Figure 2 ). Specific pseudogenomes were then identified that had known transcriptional strengths and were therefore particularly suitable for insertion into heterologous payloads.

[0123] Example 2: Design and integration of landing pad sequences into the Salmonella chromosome

[0124] The landing zone DNA sequence contains: an antibiotic marker (CmR) to select for successfully integrated clones; two FRT sites to remove the marker after clones have been confirmed; two PhiC31 attB sites (containing unique TT and TC cleavage sites) to bind any cargo incorporated into the landing zone after integration into the chromosome; and two insulator regions containing strong terminators to prevent transcriptional read-through from the genome from affecting the integrated cargo. Recombination overhangs specific for each location of interest are added using two standardized amplification sites (5' and 3') (see Figure 3 ).

[0125] Small-scale experiments were performed using landing zone amplicons with overhangs for positions t0483, t0889, t1243, t1607, t2152, t2560, t3159, t3720, and t3930. Integration was verified by PCR reactions designed to produce amplicons (~500 bp) only in the case of successful recombination (see Figure 4 ). For position t2560, the integration conditions were optimized using a landing zone amplicon with an overhang. To evaluate the optimal integration conditions, during the preparation of electrocompetent cells, cells were plated at OD 600The cells were concentrated 100x or 300x at about 0.6 and electroporated with 250ng or 500ng of DNA. Successful integration was assessed using primers that anneal outside the chromosomal location. The optimal conditions were found to be 500ng of DNA in 100x cells (see Figure 5 ).

[0126] Seventy-two different ZH9 mutant strains were generated, each containing a single landing pad sequence in the pseudogene position as verified by colony PCR. The different landing pad sequences were spaced apart in the ZH9 chromosome (see Figure 6 ).

[0127] To eliminate the helper plasmid after recombination, cells were grown at 42°C for 16 hours and then replicate plated in antibiotic (kanamycin) or non-selective medium. Cells that have successfully eliminated the helper plasmid will appear to grow only in the "no antibiotic" plates (see Figure 7 ).

[0128] Example 3: Impact of landing zone on growth of Salmonella

[0129] Samples were grown for 12 h at 37°C in either complex medium (lysogeny broth) or minimal medium (M9 medium). No significant growth differences were observed in the growth curves of all strains grown in either rich or minimal medium. Growth rates and maximum cell densities were comparable between all strains containing landing zones (see Fig. 8A and Figure 8B ).

[0130] Example 4: Generation of shuttle vectors to deliver cargo into landing pads for chromosomal integration

[0131] Use shuttle vectors containing serine recombinases (e.g., PhiC31) to deliver cargo to the landing zone in a targeted manner (see Fig. 9 ). Once the cargo is introduced, the vector is removed from the therapeutic strain. The expression of PhiC31 must be tightly controlled to prevent leaky expression of the recombinase and robustness to allow reproducible, high-throughput loading into the strain. To this end, four different expression systems were tested: LacI, TetR, BetI, and PhlF. The best expression system was found to be TetR, which provides a tight repression of expression while minimizing the effect on strain growth upon induction (see Fig.10 and Fig.11 ).

[0132] Example 5: Expression of load based on genomic location

[0133] The expression of the cargo based on its genomic location was evaluated in a total of 70 different ZH9 strains, each containing one landing pad, by two independent assays.

[0134] The first assay was performed using chloramphenicol acetyltransferase (CAT), an antibiotic resistance gene against chloramphenicol. Strains containing landing pads were challenged with antibiotics, and the OD during exponential growth was measured. 600 Samples with higher expression contained more copies of CAT and therefore grew faster.

[0135] The second assay was performed using mScarlet, a bright red fluorescent protein. Strains containing landing pads were grown in rich medium and the fluorescence output (OD 600 ~0.5, shown here). Samples with higher expression have higher fluorescence levels.

[0136] For landing zone characterization using mScarlet, samples were electroporated with 5 nM pShutTeR. Positive clones (determined by colony PCR) were streaked 4 times in vLB without antibiotics (2 single clones per round). Plasmid elimination was determined by replica plating in media supplemented with kanamycin (or without kanamycin, 12 clones per strain).

[0137] Final clones were isolated and stored as glycerol strain pools. Cells were then grown overnight in vLBaro and subcultured in triplicate. Growth measurements were monitored every 15 minutes, and mScarlet fluorescence was monitored at the following thresholds: OD600 was approximately 0.3, 0.5, 1.0. For each cell unit, fluorescence was normalized and samples were compared (normalized using GraphPad built-in algorithm, where samples were normalized to (x-xmin) / xmax*100).

[0138] The two independent assays described above were used to validate a total of 70 different ZH9 strains, each containing one landing zone (see Fig.12 and Fig.13 ).

[0139] The above experiment allowed the ranking of several landing zone strains by their relative transcriptional strength (see Fig.14 ), among which samples LP19 (t0687) and LP23 (t0771) were considered the best candidates for integrating payloads with high relative expression levels.

[0140] Example 6: Construction of strains containing multiple landing zones

[0141] S. enterica ZH9 strains containing one, two, or three landing pads were constructed via recombineering using sequential integration rounds.

[0142] First, a ZH9 strain containing landing pad LP1 (SEQ ID NO: 63) entering the t0687 site (SEQ ID NO: 5) was constructed. The antibiotic resistance cassette was removed using FLP. Then, the helper pCP20 plasmid expressing FLP was eliminated from the resulting strain (strain A).

[0143] Strains with two landing zones were generated using strain A as a template by integrating a landing zone with LP2 (SEQ ID NO: 64) into the t0771 site (strain B1) or a landing zone with LP3 (SEQ ID NO: 65) into the t1716 site (strain B2). As previously described, antibiotic resistance markers were removed using FLP, and all helper plasmids were eliminated from the final strain. Finally, a single strain containing three landing zones was generated by using strain B1 or B2 as a template and integrating the remaining landing zones into the corresponding positions (e.g., integrating LP2 into site t0771 when strain B2 was used as a template). Antibiotic resistance markers and helper plasmids were removed from the final strain (strain C).

[0144] All four strains were confirmed by genome sequencing.

[0145] Example 7: Evaluation of genome stability of strains containing up to three landing pads

[0146] Grow a Salmonella enterica ZH9 strain containing one, two, or three landing zones from a glycerol strain bank overnight in 10 mL vLB medium. Then dilute the sample 1:100 in fresh 10 mL vLB medium and restart growth. Repeat this process for up to four days.

[0147] Aliquots were taken on days 1 and 4, and genomic DNA from each sample was extracted and sequenced. Samples were compared on both days, and landing zone positions were screened for mutations or rearrangements. After 4 days of continuous growth in rich medium, no instability was observed for any landing zone or any strain ( Fig.15 ).

[0148] Example 8: Loading a strain containing three landing zones

[0149] The DNA sequence encoding mScarlet (red fluorescent protein) was loaded into the shuttle vector after the introduction of the corresponding attachment site attP, allowing the cargo to be loaded into the LP1 position of strain C. The shuttle vector contains an I-SceI cleavage site, a chloramphenicol resistance marker and a pSC101 replication origin.

[0150] A helper plasmid containing the PhiC31 loop as described in Example 4 was introduced into strain C. This plasmid contains the carbenicillin resistance gene and the p15A replication origin. Strain C containing the helper plasmid was then transformed at the TT / TC attachment site (site t0687) using a shuttle vector containing mScarlet.

[0151] The helper plasmid containing the serine recombinase was eliminated spontaneously after overnight subculturing at 37°C in vLB medium. However, the shuttle vector was eliminated only after transformation of strain C-mScarlet with an I-SceI expression plasmid, which cuts the shuttle vector and promotes its elimination. Interestingly, when two variants of the I-SceI expression plasmid were tested, elimination became more efficient when the lambda repressor was placed upstream of i-scei. This helper plasmid was then eliminated spontaneously by overnight subculturing at 37°C.

[0152] The final strain (strain C-mScarlet) was unable to grow in the presence of any antibiotics and contained mScarlet integrated into position LP1 of strain C ( Fig.16 ).

[0153] Sequence forming part of the specification

[0154] SEQ ID NO: 1:

[0155]

[0156] SEQ ID NO:2:

[0157]

[0158] SEQ ID NO:3:

[0159] ACCGATAAAGTCATCCCTGAACTAAAACAGTGGCAACAGAGCCCGCTGGAGAAGGTTTATCCCGTCGTCTGGCTGGACGCTATTCATTATAAAAACCGTGAGGATGGCCGTTATCAGAGCAAGGCGGTTTATACCGTTCTGGCACTGAATCTAGAAGGCAAAAAAGAAGTTCTGGGCCTATATCTGTCGGAAAGTGAAGGTGCTAACTTTTGGTTA

[0160] SEQ ID NO:4:

[0161] AGTGCCAGAACGGTATAAACCGCCTTGCTCTGATAACGGCCATCCTCACGGTTTTTATAA

[0162] SEQ ID NO:5:

[0163]

[0164] SEQ ID NO:6:

[0165]

[0166] SEQ ID NO:7:

[0167]

[0168] SEQ ID NO:8:

[0169] AAGGCGGGCAACGGCATAGACATGAGTAACCTGTGCATCTTCGTTCTCACCCGGACGGTGTACCAGCTTCTCTTCCAGACCAAACTCGAAGCTGAAATCGTCACCTTCACGGACAACGCGCGCGGAAAGGCTGGCAATCTGTCCGGAACGGCGGGCAAGGTCGATCATTCCCCGGTAGCCAATAATTAACTGAACGTTTTTTTGCCTGACTTTTCGTTTTTGTTTCCGAACGGCAGCAGATAGGCATGACCGAGCGCGCCGCCGGGTTCCAGCCCAAGCTGGGAACACTGAACGATGGCGCTGACAAAACTCATGGTGTCACAGTCACCCAGCGCCGGAACTTTTCGGATTTCCGTTGTGGC

[0170] SEQ ID NO:9:

[0171]

[0172] SEQ ID NO:10:

[0173]

[0174] SEQ ID NO:11:

[0175]

[0176] SEQ ID NO:12:

[0177] ATGCTGTACAGGGCGCGGCCACGCCCCGTACAGCGGGTACCACAGATAAAACGAGCCTCAGTGAGGAAGAGAATATGTTACTCAAAAAACAGGTGTTATTTCCAGCAACCAAAAAAGCGTTTGGTCTTTTCCGTGACCCGTTCGCCGACGAAGCCATGCAGGGTTCTGATGATGTGTTCACCACACCAGACATTCGCTACGTGCGTGAGGCGTTGTACCAGACAGCCCGTCATGGTGGGTTTATGGCCGTCATCGGTGAGTCCGGTGCGGGTAAATCCACGCTGCGCCGTGACCTGACTGAACGTATCAACCGCGAGAATGCGCCAGTGATTGTTATCGAGCCATACATCATCGCTATGGAAGACAACGATGTGAAAGGGAAAACTCTGAAGGCAGCAGCGATTGCCGAAGCCATTATCAGTACCATCGCACCACTGGAAAGCATCAGACGCAGTCAGGACGCCCGCTTTCGCCAGTTGCATCGCGTCCTGAAAGACAGCAACCAGGCGGGGTTCAGCCACGTTCTGGTGATTGAGGAGGCTCACAGTTTGCCCATTCCGACACTGAAACACCTCAAACGCTTTTTTGAGCTGGAGTCCGGTTTCAAAAAGCTGCTGTCCATCGTGCTGATTGGCCAGCCGGAACTGGCGACAAAACTCTCTGAACGCAACATGGAAGTCCGCGAAGTCGTTCAGCGCTGTGAGGTGGTCGAACTTCTGCCTCTGGACAATCACCTTGAAGAATTTCTGACGTTCAAACTGCAACGGGCCGGTAAACAACTGACGGACATTATGGACGCCAGCGCAGTGGATGCCATACGTACCCGCCTGAGCAATCCGGGAAGTCATCGTAAAAATATGGTCAGCCTGCTGTATCCGCTGGCCGTCAGTAACCTGGTAATAGCCGCCATGAATCTGGCCGCTGAAATCGGGGTTCCACAGGTCAACGCTGACGTTGTCAAAGGGGTTTAA

[0178] SEQ ID NO:13:

[0179] ATGAAAAAAGTAGTGGTGTTATCTGCGGTAGCCGCAGCCGTGATGATGGCTGGAGCCGCCAACGCAGCAGAAATCTATAACAAGGATGGCAATAAACTGGATTTGTATGGCAAGGTCGACGGCCTGCATTATTTTTCCAGTAATCATAGTACGGATGGCGATCAATCTTATATCCGTATGGGTATTAAAGGCGAGACTCAAATTACCGATCAACTAACCGGTTTTGGACAGTGGGAGTATCAGGTCAACGCCAATCGTCCGGAAGATGGTGACTCCAGCGGTTCCCCGCAAAGCTGGACGCGTCTCGGTTTTGCTGGTTTGGCATTTGCCGATATGGGGTCTGTTGATTATGGTCGTAACTATGGCGTGTTATACGACATTGGTTCATGGACTGACGTACTGCCTGAATTTGGTAATATTACCTGA

[0180] SEQ ID NO:14:

[0181]

[0182] SEQ ID NO:15:

[0183] TTCTTTTACGGTTAACGCTTCTGTTTTTTTCTTCTTCTCCAGCACCATCTGGCGACGAGGATCGAGTCCCTCAGTTAACCATGATCTAAAGTACTGACGGCGTTCCCTGGCATGAGATAGTGATATGGTTGGATAATCGCCAATCGTCAGTTGAGCAGCGTTCCCGTTCCATCTGTATCGGTAAAAGAATGTTATACTGCCGGATGTAGAGAGCCTGACATTGAGACCATGAGCGTCTGAGATGACCTTGATTTGGTCTCTTTTTTTGCCAGGAGCCTTTCTTAATTTTGTATCGGCAAGCAATGTGTACACTCCATAAGAGGATATACACATCTGTGTATACAT

[0184] SEQ ID NO:16:

[0185] GTGTCTCAGCCTTGTCCCTGTGGTAGCGCTGACGAGTATAGCCTATGTTGTGGTCGTATTGTGTCCGGAGAACGAGTAGCACCCGATCCGTCACATCTCATGCGCTCTCGTTACTGCGCTTTTGTGATGAAAGACGCAGATTACTTAATTAAGAGCTGGCATCCAACTTGCAATGCGGCCGCGTTTCGTGATGATATCATCGCCGGATTTGCCAATACCAGGTGGCTCGGCCTGACTATTTTTGAACATACCTAGTCAGAAGCAGAAAATACAGGGTATGTTAGTTTTATCGCGCGTTTTTCCGAACAAGGGAAAAACGGGGCGATTATCGAACGTTCTCGTTTTATCAAAGAAAACGGTCAGTGGTATTATATTGACGGTACCCGCCCGCAGTTGGGTCGAAATGATCCCTGCCCGTGCGGTTCAGGCAAAAAATTTAAAAAGTGCTGCGGCCAGTGA

[0186] SEQ ID NO:17:

[0187]

[0188] SEQ ID NO:18:

[0189] ATGCAATTTAAAAATACTCCACAACGTTATGGCGTAGTTTCCGCCGCCCTCCACTGGCTGACCGCCCTAGTGGTCTATGGCATGTTTGCGTTGGGTTTATGGATGGTCACGCTCAGTTATTACGACGGCTGGTATCACTAGGCGCCGGAAATACATAAAAGTATTGGCATGTTACTGATGATGGCGCTGATCGTGCGTATTATCTGGCGGCTTTATTCTCCGCCGCCCGTTGCGTTGACCAGCTATTCCCGTTTAACGCGCATTGGCGCCGCCGCGGGTCATATCCTTCTGTATCTCCTGCTCTTTGCGATAATCATTAGCGGCTACCTGATTTCCACCGCCGACGGTAAACCGATTAGCGTCTTTGGCTGGTTTGAGATTCCGGCCACGCTTACGGACGCGGGCGCGCAGGCTGACATCGCCGGAACACTGCATCTGTGGTTTGCCTGGTCGCTGGTCATTATCTCGCTCTCGCATGGGGTTATGGCGCTAAAACACCATTTCATCGATAAAGACGACACACTGAAACGTATGACAGGAATGTCGTCATCTGACTATGGAGCTCAAAAATGA

[0190] SEQ ID NO:19:

[0191]

[0192] SEQ ID NO:20:

[0193]

[0194] SEQ ID NO:21:

[0195] TCATAATAATTGCGGTGGCGCAAATCGTCGTTGCTGCAAAAGAGGAAGTTGCTCCCGCACCTGGTCTATTCGTTCTCTGAATATTTCCGCGACGATCAGCGCCGGACGATCGGCTGCCGCGGCTATCGTTACCCCCAACGGTCGATAATACGACTTTGACCAATATTACGATTACCACACTCCCCGGCCGCAATCATATAGCAGGTGGTATCCAGCGCTCTCGCCGCCAGCAGCGTCGACCACTGCTGCTCTTTCAACGGGCCGCGAACCCAGCCCGTCGGCAGCGCCAATACGTCAGCCCCCTGTAAAGCCAGCGCTAACGCCATATCCGGAAAGCGCAGGTCATAACAGGTCATAAGACCCACCTTAACCCCCTCCACGTCCAGCACAGGCGCGATAACGGTTCCGGCATCAATACTTTGGGATTCTTGCATCGAAAACGCATCATAGAGATGCAGCTTCGCGTAACGCGCGACAATGTGACCCGCCCGTAGCGCCACCAGCATATTAACCGCCCGTCCAGGCGTTGACGGGACAAGGATAGTGAATATCGTCGTCATATTATTATGAGCGCTTTCTTCCAGAAGCCGCGTCATAAACGCGCCATCCAGCGGCTGCGCGGCGCGAATCGGCAGGTCAAGGTCGATGTCATCTCGCGCTAATATCCCCTCAGGCAACACCAGAAGCGATACGCCGCGGCCCGCCGCCTGAGCCATTAACGAAACGCAAACTTGCACATTCTCTTCCCATACAGAACTCACCACAAACTGCCCGGCTGCAACGAACAT

[0196] SEQ ID NO:22:

[0197]

[0198] SEQ ID NO:23:

[0199]

[0200] SEQ ID NO:24:

[0201]

[0202] SEQ ID NO:25:

[0203] ATGCTGTTACAGACGCTGGAAGAGAAGCTGGCGACGCTACGCCAACGCTGCGCGCCGCTGGCGTAACATGCGACGTTAAGCGCGCGCTTTGACCGACACCTTTTCCGTACCCGCAGTACTCTGTTGCAGGGATATCTGGAAGAGGCAGACGCCAATCTCGCCGCGTTGCGTCAGGCGGTAAAACATGAGCAACTGCCGCAAGTCGCCTGGCTGGCGGAACATCTGGCTTCGCAACTGGAGGCGATATCGCGTGAAACCGCCGCCTGGTCGCTGCGCCAGTGGGATGCCGCCGCACCAGGGCTTGGCCGTTGGCAGCGCAGACGAATACAGCATCAGGAGTTTGAATGTCGACTGCTGGCGATGACACAGGAGCGCAAAATTCGTCTGGCGCAGGCGACCGGCCTTGTCGAACAACAAACGCTGCAAAAGGAAGTCGAGATCTATGAAGGACGGCTGGCGCGCTGCCGACATGCGCTGGAGAAAATAGAAAACGTACTGGCGCGTTTACCCCGTTAA

[0204] SEQ ID NO:26:

[0205]

[0206] SEQ ID NO:27:

[0207] ATGAAGTCATCTCATTTTTGTAAACTGGCAGTAACTGCATCTTTAGTTATGGGAATTGTCTCCGGCGCTCAAGCCGCGGGTAGCAACACAGCAAAGGTTACTTTCCTTGGTAATATTGTTGATTCCCCCTGCTCTGTCACATTGGATACGGAAGATCAAACAGTCAATATGGGCTCAAGTATCGGTAATGGCACGCTGAGTAATGGTAAAACGACCATCAACAATGCCCGTACCTTTCATATCGATCTTGAGGGTTGTACCTAGGCTACCGAGAAAAATATGAATGTGGTATTCACTACAGGTAGTGGAACCACAGCGGCTACAGGCGCCACGGATAATCTCGCGCTGATGAAGACTGACGGCACTGGCGCTATTAGCAACATAAGCCTGGCAATCGGCGATGCAGGCAAAAACAATATCAAACTGGGCGATACCTATACACAGGCCATTGCGGACCTGGACAGAGATACCATCCTTGATGAGAAGCAAAGCCTGAATTTCACCGCCTGGCTGGTTGGCGCAGCAACCGGCACCGTAGGCACAGGTGAATTCAGCAGCGCCGCCAACGTCACTATCTCTTACCTGTAA

[0208] SEQ ID NO:28:

[0209] ATGGGTGAATTTTCGACACTTCTTCAGCAAGGAAACGGCTGGTTCTTCATTCCCAGCGCCATTTTATTAGGTATTTTGCACGGGCTTGAACCAGGGCACTCCAAAACCATGATGGCGGCTTTTATCATTGCCATTAAAGGTACGGTTAAACAGGCTGTCATGCTCGGTCTGGCAGCAACGCTTTCTCATACCGCGATCGTCTGGTTAATCGCGCTGGGTGGGATGTATCTTAGCCGGGCATTCACCGCACAATCAGTGGAACCATGGCTGCAGTTAATTTCTGCGATCATTATTCTGAGCACCGCGTGCTGGATGTTCTGGCGGACATGACGAGGCGAGCAGCAGTGGCTGGCGGGAAACCACCATCACGACCACCATCACGACCACCATTACGACCATGACCATGACCATGACCATGACCATGACCATGACCATGACCATGACCATGACCATCATGGTCACATACATCCGGAAGGCGCAACGTCAAAAGCGTATCAGGATGCCCATGAACGCGCCCATGCTGCCGATATTCAACGCCGTTTTGATGGTCAAACAGTGAATAATGGACAGATCCTGCTGTTCGGCCTGACCGGAGGGCTTATCCCCTGTCCGGCTGCGATCACCGTTTTACTGATTTGTATCCAGCTTAAAGCGTTTACGCTGGGTGCCACGATGGTGCTGAGCTTTAGTCTTGGCCTGGCATTAACGCTGGTGACGGTAGGCGTTGGCGCGGCGATAAGCGTTCAACAGGCAGCAAAGCGCTGGAGTGGTTTTTCGACGCTTGCCCGGCGGGCGCCCTATTTTTCGAGCATTCTGATTGGTCTGGTCGGCGTGTATATGGGAATTCATGGCTATACCGGGATCATGCAGTAA

[0210] SEQ ID NO:29:

[0211] ATGCCGCACTGCCAGGACAACACCAAACGTGAGTTCACACATCTGGTTAGAGTTTCTCTGGCTTACCGCAAAATTGAGTGGGAACACGTTTCAACAGGCACTTCAGGTGCTGATGACTGACGTGCGCCGCTGGAAGCATAA

[0212] SEQ ID NO:30:

[0213] TCAATACACCTCCGAGGCTAAAAAGTAGCCTTCGCCATGCTGTGTGACCAGCAGTTCCGGCGTAATTTTATGACGTAAGCGGCGAACCAGGACATCAATCGTGCGGAGATCCGGGGTCTCTACGCGGCGGGCGGAAAGCATTCGCAGCAGACGTTCGCGATGCAGCACTTTGCCTGGGTTGGTCACAAAGGCCAGCAGCAGCTCGTACTCCGCGCGCGTAAGCTTAATGGCTTCACCGTTGTGCTCCAGCGTGTGATTCATCACGTTCAGGCAGTAGCCGGAAAACATATAGCAGTTTTCACTGGCATTTTGCGGCGTGGGGCGGGCCAGATCGATACGCCACAAAAGATTTTTCACCCGCACTACCAGCTCGCGCAGTTCCAGCGGCTTGGTGACGTAGTCGTCCGCGCCCATCTCCAGCCCGACGATGCGGTCGATTTGGTCGCAACGCCCCGTCACCAGAATAATGCCCACCGTGGAGCGTTCGCGTAGCGCCCTGGTCAGCATCAACCCGTTTTCATCGGGGAGGTTGATATCCAGCAGGATCAGCGAAACGTGCTCATGCTCCATGATGTCACGCGCAGGCCCGCGCCGCTGTCGGTCACCGAAACGCGATACCCCTCCTGCTCAAAATAGGCCTGTAACCTGGCCTGAGTAACAGGTTCATCCTCAACAATAACAATGTGATGTGACAT

[0214] SEQ ID NO:31:

[0215]

[0216] SEQ ID NO:32:

[0217]

[0218] SEQ ID NO:33:

[0219]

[0220] SEQ ID NO:34:

[0221]

[0222] SEQ ID NO:35:

[0223]

[0224] SEQ ID NO:36:

[0225]

[0226] SEQ ID NO:37:

[0227]

[0228] SEQ ID NO:38:

[0229]

[0230] SEQ ID NO:39:

[0231]

[0232] SEQ ID NO:40:

[0233]

[0234] SEQ ID NO:41:

[0235]

[0236] SEQ ID NO:42:

[0237]

[0238] SEQ ID NO:43:

[0239] CCGGCTTATCGGTCAGTTTCACCTGATTTACGTAAAAACCCGCTTCGGCGGGTTTTTGCTTTTGGAGGGGCAGAAAGATGAATGACTGTCCACGACGCTATACCCAAAAGAAAAAAAAAAAACCCCGCCCCTGACAGGGCGGGGTTTTTTTT

[0240] SEQ ID NO:44:

[0241] TCCGGCAATTAAAAAAGCGGCTAACCACGCCGCTTTTTTTACGTCTGCACTCGGTACCAAATTCCAGAAAAGAGGCCTCCCGAAAGGGGGGCCTTTTTTCGTTTTGGTCC

[0242] SEQ ID NO:45:

[0243] TTCAGCCAAAAAACTTAAGACCGCCGGTCTTGTCCACTACCTTGCAGTAATGCGGTGGACAGGATCGGCGGTTTTCTTTTCTCTTCTCAACTCGGTACCAAAGACGAACAATAAGACGCTGAAAAGCGTCTTTTTTCGTTTTGGTCC

[0244] SEQ ID NO:46:

[0245] GCTGATGCCAGAAAGGGTCCTGAATTTCAGGGCCCTTTTTTTACATGGATTGCTCGGTACCAAATTCCAGAAAAGAGACGCTTTCGAGCGTCTTTTTTCGTTTTGGTCC

[0246] SEQ ID NO:47:

[0247] GATCTAACTAAAAAGGCCGCTCTGCGGCCTTTTTTCTTTTCACTGTAACAACGGAAACCGGCCATTGCGCCGGTTTTTTTTGGCCT

[0248] SEQ ID NO:48:

[0249] AGTTAACCAAAAAGGGGGGATTTTATCTCCCCTTTAATTTTTCCTCGCAGATAGCAAAAAAGCGCCTTTAGGGCGCTTTTTTACATTGGTGG

[0250] SEQ ID NO:49:

[0251] GGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGCTCGGTACCAAATTCCAGAAAAGACACCCGAAAGGGTGTTTTTTCGTTTTGGTCC

[0252] SEQ ID NO:50:

[0253] TACCACCGTCAAAAAAAACGGCGCTTTTTAGCGCCGTTTTTATTTTTCAACCTTCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC

[0254] SEQ ID NO:51:

[0255] ACATTTAATAAAAAAAGGGCGGTCGCAAGATCGCCCTTTTTTACGTATGACACAGTGAAAAATGGCGCCCATCGGCGCCATTTTTTTATG

[0256] SEQ ID NO:52:

[0257] TGCTCGTACCAGGCCCCTGCAATTTCAACAGGGGCCTTTTTTTATCCAATTCCATCGGGTCCGAATTTTCGGACCTTTTCTCCGC

[0258] SEQ ID NO:53:

[0259] CTTATTCCATAACAAAGCCGGGTAATTCCCGGCTTTGTTGTATCTGAACAATAAATGGATGCCCTGCGTAAGCGGGGCATTTTTCTTCCT

[0260] SEQ ID NO:54:

[0261] AGCGTCAAAAGGCCGGATTTTCCGGCCTTTTTTATTAGGCAGCATGCTGCCAGGTGATCCCCCTGGCCACCTCTTTT

[0262] SEQ ID NO:55:

[0263] TAATCATTCTTAGCGTGACCGGGAAGTCGGTCACGCTACCTCTTCTGAAGAAACAGCAAACAATCCAAAACGCCGCGTTCAGCGGCGTTTTTTCTGCTTTTCT

[0264] SEQ ID NO:56:

[0265] GTGAAGTGAAAAATGGCGCACATTGTGCGCCATTTTTTTTGTCTGCCGTTTACCGCTTCTCTGAAAATCAACGGGCAGGTCACTGACTTGCCCGTTTTTTTATCCCTTCTCCACACCG

[0266] SEQ ID NO:57:

[0267] TCTTTAAAAAGAAACCTCCGCATTGCGGAGGTTTCGCCTTTTGATACTCTGTCTGAAGTAATTCTTGCCGCAGTGAAAAATGGCGCCCATCGGCGCCATTTTTTTATGCTTCCATTAGAAAGCAAAAAGCCTGCTAGAAAGCAGGCTTTTTTGAATTTGGCTCCTCTGAC

[0268] SEQ ID NO:58:

[0269] AAAGTTCTGAAAAAGGGTCACTTCGGTGGCCCTTTTTTATCGCCACGGTTTGAGCAGTGCACTTGCTTAAAATCCCGCCAGCGGCGGGATTTTTTATTGTCCGGTTTAAGACA

[0270] SEQ ID NO:59:

[0271] GCAGACAAAAAAAATGGCGCACAATGTGCGCCATTTTTCACTTCACAGGTACTATTGTTTTGAATTGAAAAGGGCGCTTCGGCGCCCTTTTTGCATTTGTTGACGGCATATATTTGTATATCGAAGCGCCCTGATGGGCGCTTTTTTTATTTAATCGATAACCAGA

[0272] SEQ ID NO:60:

[0273] CCAGATCGTTCCTCAGGTGACCTCGAGTCCGGCAATTAAAAAAGCGGCTAACCACGCCGCTTTTTTTACGTCTGCACTCGGTACCAAATTCCAGAAAAGAGGCCTCCCGAAAGGGGGGCCTTTTTTCGTTTTGGTCCCCGCGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTACCGCGGTGCGGGTGCCAGGGCGTGCCCTCGGGCTCCCCGGGCGCGTACTCCACGTCAGAGGAGCCAAATTCAAAAAAGCCTGCTTTCTAGCAGGCTTTTTGCTTTCTAATGGAAGCATAAAAAAATGGCGCCGATGGGCGCCATTTTTCACTGCGGCAAGAATTACTTCAGACAGAGTATCAAAAGGCGAAACCTCCGCAATGCGGAGGTTTCTTTTTAAAGACTGCAGCAGCGATTGAGACTCAGCGAAC

[0274] SEQ ID NO:61:

[0275] CCAGATCGTTCCTCAGGTGACCTCGAGGTGAAGTGAAAAATGGCGCACATTGTGCGCCATTTTTTTTGTCTGCCGTTTACCGCTTCTCTGAAAATCAACGGGCAGGTCACTGACTTGCCCGTTTTTTTATCCCTTCTCCACACCGCGGTGCGGGTGCCAGGGCGTGCCCGTGGGCTCCCCGGGCGCGTACTCCACGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTACCGGTGCGGGTGCCAGGGCGTGCCCCAGGGCTCCCCGGGCGCGTACTCCACGGACCAAAACGAAAAAAGGCCCCCCTTTCGGGAGGCCTCTTTTCTGGAATTTGGTACCGAGTGCAGACGTAAAAAAAGCGGCGTGGTTAGCCGCTTTTTTAATTGCCGGACTGCAGCAGCGATTGAGACTCAGCGAAC

[0276] SEQ ID NO:62:

[0277] CCAGATCGTTCCTCAGGTGACCTCGAGAGTTAACCAAAAAGGGGGGATTTTATCTCCCCTTTAATTTTTCCTCGCAGATAGCAAAAAAGCGCCTTTAGGGCGCTTTTTTACATTGGTGGCGGTGCGGGTGCCAGGGCGTGCCCCTGGGCTCCCCGGGCGCGTACTCCACGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCCGGTGCGGGTGCCAGGGCGTGCCCCCGGGCTCCCCGGGCGCGTACTCCACGGACCAAAACGAAAAAACACCCTTTCGGGTGTCTTTTCTGGAATTTGGTACCGAGCCTTTGGTCGAAAAAAAAAGCCCGCACTGTCAGGTGCGGGCTTTTTTCTGTGTTTCCCTGCAGCAGCGATTGAGACTCAGCGAAC

[0278] SEQ ID NO:63:

[0279]

[0280] SEQ ID NO:64:

[0281]

[0282] SEQ ID NO:65:

[0283]

[0284] References

[0285] Petrovska L, Aspinall RJ, Barber L, Clare S, Simmons CP, Stratford R, Khan SA, Lemoine NR, Frankel G, Holden DW and Dougan G. Salmonella enterica serovar Typhimurium interaction with dendritic cells: impact of the sifA gene. Cellular Microbiology, 2004;6:1071 - 1084.

[0286] Hindle Z, Chatfield SN, Phillimore J, Bentley M, Johnson J, Cosgrove CA, Ghaem - Maghami M, Sexton A, Khan M, Brennan FR, Everest P, Wu T, Pickard D, Holden DW, Dougan G, Griffin GE, House D, Santangelo JD, Khan SA, Shea JE, Feldman RG, and Lewis DJ. Characterization of Salmonella enterica derivatives harboring defined aroC and Salmonella pathogenicity island 2 type III secretion system (ssaV) mutations by immunization of healthy volunteers. Infect Immun. 2002;70(7):3457 - 67.

[0287] Lehouritis P, Hogan G, and Tangney M. Designer Bacteria as Intratumoural Enzyme Biofactories, Advanced Drug Delivery Reviews. 2017.

[0288] Kimura H,Zhang L,Zhao M,Hayashi K,Tsuchiya H,Tomita K,Bouvet M,Wessels J,and Hoffman RM.Targeted therapy of spinal cord glioma with agenetically modified Salmonella typhimurium.Cell Proliferation.2010;43:41-48.

Claims

1. A modified live attenuated Salmonella strain, comprising at least one chromosomally integrated synthetic polynucleotide sequence inserted into a predetermined pseudogenomic location, the sequence comprising at least one defined recombination site for introduction of a heterologous polynucleotide sequence encoding a polypeptide, wherein the chromosomally integrated synthetic polynucleotide sequence is located within at least one genomic site defined by any one of SEQ ID NOs: 1-30 or a sequence having at least 70% identity to any one of SEQ ID NOs: 1-30.

2. The modified strain of claim 1, wherein the chromosomally integrated synthetic polynucleotide sequence is located within at least one genomic site defined by any one of SEQ ID NOs: 1-30 or a sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to any one of SEQ ID NOs: 1-30.

3. The modified strain according to claim 1 or 2, wherein the defined recombination site is an attB recombination site.

4. The modified strain according to claim 2, wherein the attB recombination site is a PhiC31 attB recombination site and / or a Bxbl attB recombination site.

5. The modified strain according to any one of claims 1 to 4, wherein the chromosome-integrated synthetic polynucleotide sequence further comprises insulator regions on both sides of the defined recombination site.

6. The modified strain according to claim 5, wherein each insulator region is selected from any one of SEQ ID NOs: 43-59 or a sequence having at least 70% identity with any one of SEQ ID NOs: 43-59.

7. The modified strain of claim 6, wherein each insulator region is selected from any one of SEQ ID NOs: 43-59 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to any one of SEQ ID NOs: 43-59.

8. The modified strain according to any one of claims 1 to 7, wherein the attenuated live strain comprises two, three, four, five or six chromosomally integrated synthetic polynucleotides inserted into predetermined genomic locations.

9. The modified strain according to claim 8, wherein the attenuated live strain comprises three chromosomally integrated synthetic polynucleotides.

10. The modified strain according to any one of claims 1 to 9, wherein the chromosomally integrated synthetic polynucleotide sequence has a sequence according to SEQ ID NO: 60, 61, 62 or a sequence having at least 70% identity thereto.

11. The modified strain according to claim 10, wherein the chromosomally integrated synthetic polynucleotide sequence has a sequence according to SEQ ID NO: 60, 61, 62 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to any one of SEQ ID NO: 60, 61, 62.

12. The modified strain according to any one of claims 1 to 11, wherein the live attenuated strain is a Salmonella enterica strain.

13. The modified strain according to claim 12, wherein the live attenuated strain is a Salmonella enterica serotype Typhi strain or a Salmonella enterica serotype Typhimurium strain.

14. The modified strain according to claim 13, wherein the attenuated live strain is selected from y21a, CVD 908-htrA, CVD 909, Ty800, M01ZH09, x9633, x639, x9640, x8444, ZH9PA, DTY88, MD58, WT05, ZH26, SL7838, SL7207, VNP20009, A1-R or any combination thereof.

15. The modified strain according to any one of claims 1 to 14, wherein the attenuated live strain is a genetically engineered strain.

16. The modified strain according to claim 12, wherein the live attenuated strain comprises an attenuating mutation in the Salmonella pathogenicity island 2 (SPI-2) gene and / or an attenuating mutation in a second gene, preferably wherein the SPI-2 is the ssaV gene and the second gene is the aroC gene.

17. The modified strain according to any one of claims 1 to 16, wherein the predetermined genomic location is a genomic location of low transcription intensity or high transcription intensity.

18. The modified strain according to any one of claims 1 to 17, wherein the heterologous polynucleotide sequence encodes an immunogenic compound and / or a cancer therapeutic agent.

19. The modified strain according to any one of claims 1 to 18, wherein the size of the heterologous polynucleotide is in the range of 1 Kbp to 10 Kbp.

20. The modified strain of claim 19, wherein the size of the heterologous polynucleotide is in the range of 1 Kbp to 2 Kbp.

21. A vaccine composition comprising the modified live attenuated strain according to any one of claims 1 to 20.

22. The vaccine composition according to claim 21, further comprising a pharmaceutically acceptable carrier, excipient or adjuvant.

23. The modified strain of any one of claims 1 to 20 for therapeutic use.

24. The modified strain for use according to claim 23, wherein the treatment is the treatment of cancer.

25. The modified strain for use according to claim 24, wherein the cancer is selected from prostate cancer, liver cancer, kidney cancer, lung cancer, breast cancer, colorectal cancer, bladder cancer, pancreatic cancer, brain cancer, hepatocellular carcinoma, lymphoma, leukemia, gastric cancer, cervical cancer, ovarian cancer, thyroid cancer, melanoma, malignant epithelial tumors, head and neck cancer, skin cancer or sarcoma, preferably wherein the cancer is selected from lung cancer, kidney cancer, bladder cancer, gastric cancer, colorectal cancer, head and neck cancer or breast cancer.

26. The modified strain for use according to claim 23, wherein the treatment is the treatment of an infectious disease.

27. The modified strain for use according to claim 23, wherein the treatment is the treatment of an autoimmune disease or disorder.

28. The vaccine composition according to claim 21 or 22, or the modified strain for use according to any one of claims 23 to 27, wherein the modified strain is formulated for oral administration, intratumoral administration, peritumoral administration, intradermal administration, subcutaneous administration or intraperitoneal administration.

29. The vaccine composition according to claim 21 or 22, or the modified strain for use according to any one of claims 23 to 27, wherein the modified strain is administered in combination with immunotherapy, chemotherapy, radiotherapy, antiviral therapy, antibacterial therapy, antifungal therapy or antiparasitic therapy.

30. The vaccine composition according to claim 29, or the modified strain for use according to claim 29, wherein the immunotherapy is a checkpoint inhibitor, antigen-specific T cells, therapeutic antibodies or cancer vaccines.

31. A method for treating, inhibiting or controlling a neoplastic disease or an infectious disease in a subject, wherein the method comprises administering to the subject a modified, attenuated live Salmonella strain comprising at least one chromosomally integrated synthetic polynucleotide sequence inserted into a predetermined pseudogenomic location, the sequence comprising at least one defined recombination site for introduction of a heterologous polynucleotide sequence encoding a polypeptide, wherein the chromosomally integrated synthetic polynucleotide sequence is located within at least one genomic site defined by any one of SEQ ID NOs: 1-30 or a sequence having at least 70% identity to any one of SEQ ID NOs: 1-30.

32. The method of claim 31 , wherein the chromosomally integrated synthetic polynucleotide sequence is located within at least one genomic site defined by any one of SEQ ID NOs: 1-30 or a sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to any one of SEQ ID NOs: 1-30.

33. The method according to claim 31 or 32, wherein the modified attenuated live strain is as defined in any one of claims 1 to 20, or is for use as defined in any one of claims 23 to 27.

34. A method for modifying a live attenuated Salmonella strain, the method comprising inserting a synthetic polynucleotide sequence into a predetermined pseudogenomic position of the live attenuated Salmonella strain, the sequence comprising at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, wherein the chromosomally integrated synthetic polynucleotide sequence is located within at least one genomic site defined by any one of SEQ ID NOs: 1-30 or a sequence having at least 70% identity to any one of SEQ ID NOs: 1-30.

35. The method of claim 34, wherein the chromosomally integrated synthetic polynucleotide sequence is located within at least one genomic site defined by any one of SEQ ID NOs: 1-30 or a sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to any one of SEQ ID NOs: 1-30.

36. The method according to claim 34 or 35, wherein the modified attenuated live strain is as defined in any one of claims 1 to 20.

Images