Fungal signal peptides

Abstract

The present invention relates to nucleic acid constructs comprising a first polynucleotide encoding a signal peptide, for example from a fungal glycosidase, and a second polynucleotide encoding an alpha-whey protein (ALAB) polypeptide; an expression vector and a host cell comprising the nucleic acid construct; a method for producing an ALAB polypeptide; and a fusion protein comprising an ALAB polypeptide and a signal peptide.

Description

[0001] References to sequence listings

[0002] This application contains a Sequence Listing in computer readable form, which is incorporated herein by reference. Background of the Invention Technical Field

[0003] The present invention relates to a nucleic acid construct comprising a first polynucleotide encoding a signal peptide, for example, from a fungal glycosidase, and a second polynucleotide encoding an alpha-lactalbumin (ALAB) polypeptide; an expression vector and a host cell comprising the nucleic acid construct; a method for producing an ALAB polypeptide; and a fusion protein comprising an ALAB polypeptide and a signal peptide. Background Art

[0004] Product development in industrial biotechnology faces a continuous challenge, namely to increase the production of recombinant proteins on a large scale to reduce costs. In the past few decades, two main approaches have been taken for this purpose. The first approach is based on classical mutagenesis and screening. Here, specific genetic modifications are not predefined, and the main requirement is a screening assay that is sensitive to detecting yield increments. High-throughput screening enables screening of a large number of mutants to find the desired phenotype, i.e., higher recombinant protein production. The second approach includes many strategies, ranging from using stronger promoters and multi-copy strains to ensure high expression of the target gene to using codon-optimized gene sequences to help translation. However, the high-level production of a given protein may trigger several bottleneck problems in the cell mechanism that secrete the target enzyme into the culture medium, which highlights the need for additional optimization strategies.

[0005] Signal peptide (SP) is a short amino acid sequence present at the amino terminus of many newly synthesized polypeptides, which targets these polypeptides into or through the cell membrane, thereby helping maturation and secretion. The amino acid sequence of SP affects the secretion efficiency, and thus affects the yield of the polypeptide manufacturing process. Bioinformatics tools (such as SignalP and SignalP5) can predict SP from the amino acid sequence, but most tools cannot distinguish between various types of SP (Armenteros et al., Nat.Biotechnol. [Natural Biotechnology] 37: 420-423, 2019). In addition, a large amount of redundancy in the amino acid sequence of SP makes it difficult to predict the efficiency of any given SP for producing recombinant proteins on an industrial scale. There is currently no tool that can predict the efficiency of a given SP to guide the secretion of a target protein (POI) (Owji et al., Eur.J.Cell Biol. [European Journal of Cell Biology] 2018, 97, 422-441). In fact, finding an effective SP to secrete POI is still based on trial and error. It has been established that SP-POI matching plays a crucial role in determining secretion efficiency (Peng, C. et al., Front. Bioeng. Biotechnol. 2019, 7, 139), while the underlying basic parameters remain unknown.

[0006] Therefore, SP selection is an important step in manufacturing recombinant proteins, but the optimal combination of signal peptide and mature protein is very context-dependent and cannot be easily predicted.

[0007] Alpha-lactalbumin (ALAB) is the major protein of milk. ALAB forms the regulatory subunit of the lactose synthase (LS) heterodimer, and β1,4-galactosyltransferase (β4Gal-T1) forms the catalytic component. Together, these proteins enable LS to produce lactose by transferring the galactose moiety to glucose. As a monomer, α-lactalbumin binds calcium and zinc ions tightly and may have bactericidal or antitumor activity. A folded variant of α-lactalbumin, called HAMLET, may induce apoptosis in tumor and immature cells.

[0008] Recombinant ALAB has the potential to improve the nutritional value of food, beverages and feed. Recombinant ALAB expression in different organisms, including transgenic goats, has been reported previously (Yuan YG et al., J Anal Methods Chem. [Journal of Chemical Analysis Methods] 2014; 2014: 281031. doi: 10.1155 / 2014 / 281031). Recombinantly produced phytase is widely used as a feed supplement for animals such as poultry and pigs to effectively improve phosphorus utilization and reduce fecal phosphorus excretion. Therefore, for both polypeptide ALAB and phytase, the demand for them in their respective industries is growing.

[0009] Despite the availability of expression systems, there is still a need to improve yields during recombinant production. One major challenge is the fact that both ALAB and phytase have several disulfide bonds, which makes proper expression, folding, and secretion challenging. Therefore, in order to meet the growing demand for recombinant ALAB and phytase, it is necessary to provide a recombinant expression system that improves the yield of ALAB or phytase. Summary of the invention

[0010] The present invention is based on the surprising and inventive discovery that expression of difficult to express proteins (α-lactalbumin and phytase) using fungal signal peptides can improve yield when expressed in fungal host cells.

[0011] Using the signal peptides of the present invention, improved yields of ALAB products were observed compared to expression of the same ALAB products using other signal peptides, for example, using JSP017 SP having SEQ ID NO: 45, ALAB yields could be increased by 53% relative to JSP 002 (Table 9).

[0012] Using the signal peptide of the invention, an improvement in phytase production was observed compared to the expression of the same phytase with other signal peptides, ie the phytase expression was 2.3 times greater (Table 4).

[0013] Notably, increased expression was achieved using several different fermentation protocols at different scales, including microtiter plates (MTP), shake flasks (SF), and laboratory fermenters.

[0014] In a first aspect, the present invention relates to a nucleic acid construct comprising:

[0015] a first polynucleotide encoding a signal peptide having at least 80% sequence identity to SEQ ID NO:45, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:47, or SEQ ID NO:49; and

[0016] a second polynucleotide encoding an alpha-lactalbumin (ALAB) polypeptide having at least 70% sequence identity to the polypeptide sequence of SEQ ID NO: 6;

[0017] The first polynucleotide and the second polynucleotide are operably linked in a translational fusion manner.

[0018] In a second aspect, the present invention relates to expression vectors comprising the nucleic acid construct of the first aspect.

[0019] In a third aspect, the present invention relates to a fungal host cell, the fungal host cell comprising in its genome:

[0020] a) a nucleic acid construct according to the first aspect; and / or

[0021] b) The expression vector according to the second aspect.

[0022] In a fourth aspect, the present invention relates to a method for producing an alpha-lactalbumin (ALAB) polypeptide, the method comprising:

[0023] a) cultivating a host cell according to the third aspect under conditions conducive to production of the ALAB polypeptide; and optionally

[0024] b) recovering the ALAB polypeptide.

[0025] In a fifth aspect, the present invention relates to a method for producing a polypeptide having phytase activity, the method comprising:

[0026] a) cultivating the host cell according to the third aspect under conditions conducive to production of the polypeptide having phytase activity; and optionally

[0027] b) recovering the polypeptide having phytase activity.

[0028] In a sixth aspect, the present invention relates to a fusion polypeptide, comprising:

[0029] a signal peptide having at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:45, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:47 or SEQ ID NO:49, and

[0030] (i) an alpha-lactalbumin polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:6, or

[0031] (ii) a polypeptide with phytase activity having at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:8.

[0032] Sequence review

[0033] SEQ ID NO: 1 is the GH26 (JSP 002) signal peptide coding sequence

[0034] SEQ ID NO: 2 is the GH26 (JSP 002) signal peptide (MFAKLSLLSLLFSSAALG).

[0035] SEQ ID NO: 3 is the GH16 signal peptide coding sequence.

[0036] SEQ ID NO: 4 is the GH16 signal peptide (MRLPLVSSTVALLSSASLVAA).

[0037] SEQ ID NO:5 is the ALAB coding sequence. (without SP)

[0038] SEQ ID NO:6 is the amino acid sequence of ALAB. (without SP)

[0039] SEQ ID NO:7 is the ALAB coding sequence. (with SP GH26)

[0040] SEQ ID NO: 8 is the amino acid sequence of ALAB (with SP GH26)

[0041] SEQ ID NO:9 is the ALAB coding sequence. (with SP GH16)

[0042] SEQ ID NO: 10 is the amino acid sequence of ALAB (with SP GH16)

[0043] SEQ ID NO: 11 is the phytase coding sequence. (without SP)

[0044] SEQ ID NO: 12 is the amino acid sequence of phytase. (without SP)

[0045] SEQ ID NO: 13 is the phytase coding sequence. (with SP GH26)

[0046] SEQ ID NO: 14 is the amino acid sequence of phytase (with SP GH26)

[0047] SEQ ID NO: 15 is the phytase coding sequence. (with SP GH16)

[0048] SEQ ID NO: 16 is the amino acid sequence of phytase (with SP GH16)

[0049] SEQ ID NO: 17 is the intron between SP GH16 / SP GH26 and ALAB coding sequences

[0050] SEQ ID NO: 18 is the coding sequence GH16 SP-intron-ALAB

[0051] SEQ ID NO: 19 is the coding sequence GH26 SP-intron-ALAB

[0052] SEQ ID NO: 20 is the GH26 polypeptide coding sequence from Aspergillus luchuensis

[0053] SEQ ID NO:21 is a GH26 polypeptide from Aspergillus ryukyuensis

[0054] SEQ ID NO:22 is the GH16 polypeptide coding sequence from Aspergillus ryukyuensis

[0055] SEQ ID NO:23 is a GH16 polypeptide from Aspergillus ryukyuensis

[0056] SEQ ID NO:24 is the reference GH13 signal peptide coding sequence

[0057] SEQ ID NO:25 is a reference GH13 signal peptide

[0058] SEQ ID NO: 26 is the reference cutinase (JSP004) signal peptide coding sequence

[0059] SEQ ID NO: 27 is the reference cutinase (JSP004) signal peptide

[0060] SEQ ID NO:28 is the reference GH72 signal peptide coding sequence

[0061] SEQ ID NO:29 is a reference GH72 signal peptide

[0062] SEQ ID NO:30 is SP GH16-ALAB expression cassette (promoter-SPGH16-intron-ALAB-terminator)

[0063] SEQ ID NO:31 is SP GH26-ALAB expression cassette (promoter-SPGH26-intron-ALAB-terminator)

[0064] SEQ ID NO: 32 is SP GH72-ALAB expression cassette (promoter-SPGH72-intron-ALAB-terminator)

[0065] SEQ ID NO: 33 is the SP GH16-phytase expression cassette (promoter-SPGH16-phytase-terminator)

[0066] SEQ ID NO:34 is the HA442 primer

[0067] SEQ ID NO:35 is the HA451 primer

[0068] SEQ ID NO:36 is the HA283 primer

[0069] SEQ ID NO:37 is the HA444 primer

[0070] SEQ ID NO:38 is the HA450 primer

[0071] SEQ ID NO:39 is the HA445 primer

[0072] SEQ ID NO:40 is the HA442 primer

[0073] SEQ ID NO:41 is the HA233 primer

[0074] SEQ ID NO:42 is the HA268 primer

[0075] SEQ ID NO:43 is the HA489 primer

[0076] SEQ ID NO: 44 is the LYA1_4 (JSP017, Aspergillus ryukyuensis) signal peptide coding sequence

[0077] SEQ ID NO: 45 is LYA1_4 (JSP017, Aspergillus yukyuensis) signal peptide (MKYAAALTAVAALAARAAA)

[0078] SEQ ID NO: 46 is the pepsin A (JSP019, Aspergillus niger) signal peptide coding sequence

[0079] SEQ ID NO:47 is the pepsin A (JSP019, Aspergillus niger) signal peptide (MVVFSKTAALVLGLSSAVSA)

[0080] SEQ ID NO: 48 is the GH28_9 endo-1,4-α-polygalacturonase (JSP008, Aspergillus ryukyuensis) signal peptide coding sequence

[0081] SEQ ID NO: 49 is GH28_9 endo-1,4-α-polygalacturonase (JSP008, Aspergillus ryukyuensis) signal peptide (MHFLQNAFVAATMGAALAAA)

[0082] definition

[0083] In light of this detailed description, the following definitions apply. Note that the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0084] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0085] Alpha-lactalbumin: The term "alpha-lactalbumin", "alpha-lactalbumin", "alpha-LA", "alpha-LAB", "ALAB" or "LALBA" means a polypeptide that forms a functional regulatory subunit of the lactose synthase (LS) heterodimer. ALAB forms the regulatory subunit of the lactose synthase (LS) heterodimer, and β1,4-galactosyltransferase (β4Gal-T1) forms the catalytic component. Together, these proteins enable LS to produce lactose by transferring a galactose moiety to glucose. Non-limiting examples of ALAB polypeptides are bovine ALAB and human ALAB. ALAB quantification can be performed as described in the "Semi-quantification by MALDI-TOF MS" and "Size Exclusion Chromatography" sections of the Examples.

[0086] cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription from a mature, spliced ​​mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The initial primary RNA transcript is a precursor to mRNA, which is processed through a series of steps (including splicing) and then appears as a mature, spliced ​​mRNA.

[0087] Coding sequence: The term "coding sequence" means a polynucleotide that directly specifies the amino acid sequence of a polypeptide. The boundaries of the coding sequence are usually determined by an open reading frame, which begins with a start codon (such as ATG, GTG, or TTG) and ends with a stop codon (such as TAA, TAG, or TGA). The coding sequence may be genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0088] Control sequences: The term "control sequences" means nucleic acid sequences involved in regulating the expression of polynucleotides in a particular organism or in vitro. Each control sequence can be native (i.e., from the same gene) or heterologous (i.e., from different genes) to the polynucleotide encoding the polypeptide, and is native or heterologous to each other. Such control sequences include, but are not limited to, leader sequences, polyadenylation sequences, prepropeptides, propeptides, signal peptides, promoters, terminators, enhancers, and transcription or translation initiator and terminator sequences. At a minimum, control sequences include promoters and transcription and translation termination signals. These control sequences can be provided with multiple linkers for the purpose of introducing specific restriction sites that are conducive to connecting the control sequences to the coding region of the polynucleotide encoding the polypeptide.

[0089] Expression: The term "expression" means any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0090] Expression vector: "Expression vector" refers to a linear or circular DNA construct comprising a DNA sequence encoding a polypeptide, the coding sequence being operably linked to a suitable control sequence capable of affecting the expression of the DNA in a suitable host. Such control sequences may include a promoter that affects transcription, an optional operator sequence that controls transcription, a sequence encoding a suitable ribosome binding site on mRNA, an enhancer, and a sequence that controls the termination of transcription and translation.

[0091] Extension: The term "extension" means the addition of one or more amino acids at the amino and / or carboxyl terminus of a polypeptide, wherein the "extended" polypeptide has phytase activity or wherein the extended polypeptide is an ALAB polypeptide that forms a functional regulatory subunit of a lactose synthase (LS) heterodimer. One skilled in the art will recognize that a polypeptide having a given amino acid sequence and enzymatic activity can be produced with one or several additional amino acids at the N- and / or C-terminus, and such a polypeptide can have substantially the same enzymatic activity. Such extended polypeptides are intended to be encompassed within the present invention.

[0092] Fragment: As used in the context of a polypeptide, the term "fragment" means a polypeptide having one or more amino acids deleted at its amino and / or carboxyl terminus, wherein the fragment has phytase activity, or wherein the fragment is an ALAB fragment that forms a functional regulatory subunit of a lactose synthase (LS) heterodimer. The fragment may be naturally produced during expression and / or purification of the polypeptide, or may be the result of expression of a modified nucleotide sequence expressing the fragment or the result of targeted removal of amino acids from the amino and / or carboxyl terminus.

[0093] Fungal glycosidase: The term "fungal glycosidase" means any glycosidase that hydrolyzes O- and S-glycosyl compounds, is encoded by an N-terminal signal peptide and is naturally expressed by a fungal species (EC 3.2.1). The term "fungal glycosidase" also includes, but is not limited to, fungal mannanase (EC 3.2.1.78) and fungal glucanase (EC 3.2.1.39). Other non-limiting examples are alpha-amylase (EC 3.2.1.1), beta-amylase (EC 3.2.1.2) and lysozyme (EC 3.2.1.17).

[0094] Fusion polypeptide: The term "fusion polypeptide" is a polypeptide in which one polypeptide is fused to the N-terminus and / or C-terminus of a polypeptide of the present invention. A fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to a polynucleotide of the present invention or by fusing two or more polynucleotides of the present invention together. Techniques for producing fusion polypeptides are known in the art and include connecting coding sequences encoding polypeptides so that they are in frame and expression of the fusion polypeptide is under the control of one or more identical promoters and terminators. Fusion polypeptides can also be constructed using intein technology, in which fusion polypeptides are produced after translation (Cooper et al., 1993, EMBO J. [Journal of the European Molecular Biology Association] 12: 2575-2583; Dawson et al., 1994, Science [Science] 266: 776-779). The fusion polypeptide may further comprise a cleavage site between the two polypeptides. When the fusion protein is secreted, the site is cleaved, thereby releasing the two polypeptides. Examples of cleavage sites include, but are not limited to, those disclosed in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3:568-576; Svetina et al., 2000, J. Biotechnol. 76:245-251; Rasmussen-Wilson et al., 1997, Appl. Environ. Microbiol. 63:3488-3493; Ward et al., 1998, J. Biotechnol. 76:245-251; 95, Biotechnology 13:498-503; and Contreras et al., 1991, Biotechnology 9:378-381; Eaton et al., 1986, Biochemistry 25:505-512; Collins-Racie et al., 1995, Biotechnology 13:982-987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6:240-248; and Stevens, 2003, Drug Discovery World 4:35-48.

[0095] Glucanase: The term "glucanase" means a glucanase comprising a signal peptide at the N-terminus, which glucanase has endo-b-1,3-glucanase activity (EC 3.2.1.39). A non-limiting example of a glucanase is an Aspergillus yukyuensis glucanase. The signal peptide sequence derived from the Aspergillus yukyuensis glucanase is referred to as "GH16" or "GH16 SP", represented by SEQ ID NO: 4, and is derived from the Aspergillus yukyuensis glucanase polypeptide having SEQ ID NO: 23.

[0096] Heterologous: With respect to a host cell, the term "heterologous" means that the polypeptide or nucleic acid is not naturally present in the host cell. With respect to a polypeptide or nucleic acid, the term "heterologous" means that the control sequence (e.g., a promoter) of the polypeptide or nucleic acid is not naturally associated with the polypeptide or nucleic acid, i.e., the control sequence is from a gene other than the gene encoding the mature polypeptide.

[0097] Host strain or host cell: "Host strain" or "host cell" refers to an organism into which an expression vector, bacteriophage, virus or other DNA construct (including a polynucleotide encoding a polypeptide of interest (e.g., amylase)) has been introduced. Exemplary host strains are microbial cells (e.g., bacteria, filamentous fungi and yeast) capable of expressing the polypeptide of interest and / or fermenting sugars. The term "host cell" includes protoplasts produced by a cell.

[0098] Introduced: In the context of inserting a nucleic acid sequence into a cell, the term "introduced" means "transfection," "transformation," or "transduction," as known in the art.

[0099] Isolated: The term "isolated" means a polypeptide, nucleic acid, cell or other specific material or component that has been separated from at least one other material or component (including but not limited to other proteins, nucleic acids, cells, etc.). Thus, the isolated polypeptide, nucleic acid, cell or other material is in a form that does not exist in nature. An isolated polypeptide includes but is not limited to a culture medium containing a secretory polypeptide expressed in a host cell.

[0100] Mannanase: The term "mannanase" means a mannanase comprising a signal peptide at the N-terminus, which mannanase has endo-1,4-β-mannanase activity (EC 3.2.1.78). A non-limiting example of a mannanase is an Aspergillus ryukyuensis mannanase. The Aspergillus ryukyuensis mannanase derived signal peptide sequence is referred to as "GH26" or "GH26 SP", represented by SEQ ID NO: 2, and is derived from the Aspergillus ryukyuensis mannanase polypeptide having SEQ ID NO: 21.

[0101] Mature polypeptide: The term "mature polypeptide" means a polypeptide in mature form after translation and any post-translational modifications such as N-terminal processing (e.g., removal of signal peptides), C-terminal truncation, glycosylation, phosphorylation, etc. It is known in the art that a host cell can produce a mixture of two or more different mature polypeptides (i.e., having different C-terminal and / or N-terminal amino acids) expressed by the same polynucleotide. It is also known in the art that different host cells process polypeptides differently, and thus a host cell expressing a polynucleotide can produce different mature polypeptides (e.g., having different C-terminal and / or N-terminal amino acids) when compared to another host cell expressing the same polynucleotide. Therefore, due to such differentiated expression of host cells, mature polypeptides of the present invention may have slight differences at the N- and / or C-termini. Mature polypeptides that lack one or more amino acids at the N- and / or C-termini can be regarded as "fragments" of full-length polypeptides.

[0102] In one aspect, the mature polypeptide is amino acids 1 to 123 of SEQ ID NO: 6. In some aspects, the mature polypeptide is amino acids 19 to 141 of SEQ ID NO: 8, and amino acids 1 to 18 of SEQ ID NO: 8 are a signal peptide.

[0103] In some aspects, the mature polypeptide is amino acids 22 to 144 of SEQ ID NO: 10, and amino acids 1 to 21 of SEQ ID NO: 10 is a signal peptide.

[0104] In one aspect, the mature polypeptide is amino acids 1 to 411 of SEQ ID NO: 12. In some aspects, the mature polypeptide is amino acids 19 to 429 of SEQ ID NO: 14, and amino acids 1 to 18 of SEQ ID NO: 14 are a signal peptide.

[0105] In some aspects, the mature polypeptide is amino acids 22 to 432 of SEQ ID NO: 16, and amino acids 1 to 21 of SEQ ID NO: 16 is a signal peptide.

[0106] Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" means a polynucleotide that encodes a mature polypeptide having phytase activity, or an ALAB polypeptide that forms a functional regulatory subunit of a lactose synthase (LS) heterodimer.

[0107] In one aspect, the mature polypeptide coding sequence is nucleotides 1 to 369 of SEQ ID NO: 5. In one aspect, the mature polypeptide coding sequence is nucleotides 55 to 423 of SEQ ID NO: 7, and nucleotides 1 to 54 of SEQ ID NO: 7 encode a signal peptide. In one aspect, the mature polypeptide coding sequence is nucleotides 64 to 432 of SEQ ID NO: 9, and nucleotides 1 to 63 of SEQ ID NO: 9 encode a signal peptide.

[0108] In one aspect, the mature polypeptide coding sequence is nucleotides 110 to 478 of SEQ ID NO: 18, and nucleotides 1 to 63 of SEQ ID NO: 18 encode a signal peptide, and nucleotides 64 to 109 of SEQ ID NO: 18 are introns.

[0109] In one aspect, the mature polypeptide coding sequence is nucleotides 101 to 469 of SEQ ID NO: 19, and nucleotides 1 to 54 of SEQ ID NO: 19 encode a signal peptide, and nucleotides 55 to 100 of SEQ ID NO: 19 are introns. In one aspect, the mature polypeptide coding sequence is nucleotides 1 to 1233 of SEQ ID NO 11. In one aspect, the mature polypeptide coding sequence is nucleotides 55 to 1287 of SEQ ID NO: 13, and nucleotides 1 to 54 of SEQ ID NO: 13 encode a signal peptide. In one aspect, the mature polypeptide coding sequence is nucleotides 64 to 1296 of SEQ ID NO: 15, and nucleotides 1 to 63 of SEQ ID NO: 15 encode a signal peptide.

[0110] Native: The term "native" means a nucleic acid or polypeptide that occurs naturally in a host cell.

[0111] Nucleic acid: The term "nucleic acid" encompasses DNA, RNA, heteroduplexes, and synthetic molecules capable of encoding polypeptides. Nucleic acids can be single-stranded or double-stranded, and can be chemically modified. The terms "nucleic acid" and "polynucleotide" are used interchangeably. Because the genetic code is degenerate, more than one codon can be used to encode a specific amino acid, and the present compositions and methods encompass nucleotide sequences that encode a specific amino acid sequence. Unless otherwise indicated, nucleic acid sequences are presented in a 5' to 3' orientation.

[0112] Nucleic acid construct: The term "nucleic acid construct" means a single-stranded or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene or modified in a manner not originally found in nature to contain a segment of nucleic acid or is synthetic and comprises one or more control sequences operably linked to the nucleic acid sequence.

[0113] Obtained polypeptide / peptide / polynucleotide: The term "obtained" or "derived" when used in reference to a polynucleotide sequence, ALAB sequence, polypeptide sequence, mannanase sequence, glucanase sequence, phytase sequence, variant sequence or signal peptide sequence means that the molecule was originally isolated from a given source and the molecule can be used in its native sequence or the molecule has been modified by methods known to those skilled in the art.

[0114] Operably linked: The term "operably linked" means that the specified components are in a relationship (including but not limited to juxtaposition) that allows them to function in an intended manner. For example, a regulatory sequence is operably linked to a coding sequence so that expression of the coding sequence is under the control of the regulatory sequence.

[0115] Parent: The term "parent" means a polypeptide that functions as a signal peptide or a polypeptide having phytase activity, or an ALAB polypeptide that forms a functional regulatory subunit of a lactose synthase (LS) heterodimer, which can be altered to produce a variant of the present invention. The parent can be a naturally occurring (wild-type) polypeptide or a variant or fragment thereof.

[0116] Phytase: In the context of the present invention, preferred phytases according to the present invention are classified as belonging to the EC 3.1.3.26 group. The EC number refers to Enzyme Nomenclature 1992 from NC-IUBMB, Academic Press, San Diego, CA, including Supplements 1-5 published in: Eur. J. Biochem. 1994, 223, 1-5; Eur. J. Biochem. 1995, 232, 1-6; Eur. J. Biochem. 1996, 237, 1-5; Eur. J. Biochem. 1997, 250, 1-6; and Eur. J. Biochem. 1999, 264, 610-650. see, for example, the World Wide Web at http: / / www.chem.qmw.ac.uk / iubmb / enzyme / index.html. A non-limiting example of a phytase is shown in SEQ ID NO:12.

[0117] Phytase activity: For the purposes of the present invention, phytase activity is determined by the release of inorganic phosphate from a sodium phytate solution, wherein one unit of phytase activity is the amount of enzyme required to release 1 μmol of inorganic phosphate per minute from a 0.0051 M sodium phytate solution in 0.25 M sodium acetate (pH 5.5) at 37°C (Engelen, AJ, et al., 1994, "Simple and rapid determination of phytase activity", J. AOAC Int. [AOAC International Journal] 77: 760-764). Examples of activity unit names are: FYT, FTU and U. Phytase activity can be determined using the assay as described in Example 1 ("Determination of Phytase Activity"). In one aspect, the polypeptide of the invention has at least 20%, e.g. at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 100% of the phytase activity of SEQ ID NO: 12. A detailed description of how to detect phytase activity is given in the examples under "pNP assay" and "FYT(B) assay".

[0118] The specific activity of a highly purified sample (SDS polyacrylamide gel should show only one component present) is measured. The enzyme protein concentration can be determined by amino acid analysis, while the phytase activity is in FYT units. The specific activity is characteristic of the particular phytase variant in question, and is calculated as the phytase activity measured in FYT units per mg of phytase enzyme protein.

[0119] Recombinant: The term "recombinant" is used in its conventional sense to refer to the manipulation (e.g., cleavage and rejoining) of a nucleic acid sequence to form a sequence population that is different from that found in nature. The term recombinant refers to a cell, nucleic acid, polypeptide, or vector that has been modified from its native state. Thus, for example, a recombinant cell expresses genes not found within the native (non-recombinant) form of the cell, or expresses native genes at different levels or under different conditions than found in nature. The term "recombinant" is synonymous with "genetically modified" and "transgenic."

[0120] Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity".

[0121] For the purposes of the present invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J.Mol.Biol. [Journal of Molecular Biology] 48:443-453) implemented in the Needle program of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. [Genetics Trend] 16:276-277) (preferably 6.6.0 version or later) is used to determine the sequence identity between two amino acid sequences as the output of "longest identity". The parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. In order for the Needle program to report the longest identity, the non-simplified (-nobrief) option must be specified in the command line. The output of the "longest identity" marked by Needle is calculated as follows:

[0122] (number of identical residues x 100) / (length of alignment - total number of gaps in the alignment)

[0123] For purposes of the present invention, use Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, the same) to determine the output of sequence identity between two polynucleotide sequences as " longest identity ", this algorithm is implemented by the Needleman program of EMBOSS software package (EMBOSS:The European Molecular Biology Open Software Suite [European Molecular Biology Open Software Suite], Rice et al., 2000, the same) (preferred 6.6.0 version or updated version).The parameter used is gap opening penalty 10, gap extension penalty 0.5 and EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix.In order to make Needleman program report the longest identity, non-simplified options must be specified in the command line.The output calculation of " longest identity " of Needleman mark is as follows:

[0124] (number of identical deoxyribonucleotides × 100) / (length of alignment – ​​total number of gaps in alignment)

[0125] Signal peptide: A "signal peptide" is an amino acid sequence attached to the N-terminal portion of a protein that promotes secretion of the protein outside the cell. The mature form of the extracellular protein lacks the signal peptide, which is cleaved off during the secretion process.

[0126] Subsequence: The term "subsequence" means a polynucleotide having one or more nucleotides missing from the 5' and / or 3' end of a mature polypeptide coding sequence; wherein the subsequence encodes a fragment having phytase activity, or wherein the subsequence forms a functional regulatory subunit of a lactose synthase (LS) heterodimer.

[0127] Variant: The term "variant" means a polypeptide with phytase activity, or a polypeptide that forms a functional regulatory subunit of a lactose synthase (LS) heterodimer, which polypeptide comprises an artificial mutation (i.e., substitution, insertion (including extension) and / or deletion (e.g., truncation)) at one or more positions. Substitution means replacing the amino acid occupying a certain position with a different amino acid; deletion means removing the amino acid occupying a certain position; and insertion means adding 1-5 amino acids (e.g., 1-3 amino acids, in particular 1 amino acid) adjacent to and immediately following the amino acid occupying a position.

[0128] Wild-type: The term "wild-type" when referring to an amino acid sequence or a nucleic acid sequence means that the amino acid sequence or nucleic acid sequence is a native or naturally occurring sequence. As used herein, the term "naturally occurring" refers to any substance (e.g., a protein, amino acid, or nucleic acid sequence) found in nature. In contrast, the term "non-naturally occurring" refers to any substance not found in nature (e.g., recombinant nucleic acid and protein sequences produced in a laboratory, or modifications of a wild-type sequence). DETAILED DESCRIPTION

[0129] The present invention is based on the surprising and inventive discovery that expression of difficult to express proteins (α-lactalbumin and phytase) using signal peptides obtained from polypeptides can improve yields when expressed in fungal host cells.

[0130] Improved production of ALAB and phytase was achieved using the signal peptide of the present invention.

[0131] Notably, increased expression was achieved using several different fermentation protocols at different scales including microtiter plates (MTP), shake flasks (SF), microbioreactors, and laboratory fermenters.

[0132] Polynucleotide

[0133] The present invention also relates to polynucleotides encoding the polypeptides of the present invention, as described herein.

[0134] The polynucleotide may be genomic DNA, cDNA, synthetic DNA, synthetic RNA, mRNA or a combination thereof. The polynucleotide may be cloned from a strain of Aspergillus or a related organism and thus, for example, may be a polynucleotide sequence encoding a variant of a polypeptide of the invention.

[0135] In an embodiment, the polynucleotide is a subsequence encoding a fragment having phytase activity or a fragment that forms a functional regulatory subunit of a lactose synthase (LS) heterodimer of the present invention.

[0136] In one embodiment, the polynucleotide encoding the multi-signal peptide of the present invention is isolated from an Aspergillus cell, such as an Aspergillus ryukyuensis cell.

[0137] Polynucleotides can also be mutated by introducing nucleotide substitutions that do not result in changes in the amino acid sequence of the polypeptide, but correspond to the codon usage of the host organism intended for producing the enzyme, or by introducing nucleotide substitutions that may produce a different amino acid sequence. For a general description of nucleotide substitutions, see, for example, Ford et al., 1991, Protein Expression and Purification 2: 95-107.

[0138] In one aspect, the polynucleotide is isolated.

[0139] In another aspect, the polynucleotide is purified.

[0140] Nucleic acid construct

[0141] The present invention also relates to a nucleic acid construct comprising a polynucleotide of the present invention, wherein the polynucleotide is operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with these control sequences.

[0142] In a first aspect, the present invention relates to a nucleic acid construct comprising:

[0143] a first polynucleotide encoding a signal peptide having at least 80% sequence identity to SEQ ID NO:45, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:47, or SEQ ID NO:49; and

[0144] a) a second polynucleotide encoding an alpha-lactalbumin (ALAB) polypeptide having at least 70% sequence identity to the polypeptide sequence of SEQ ID NO: 6; or

[0145] b) a second polynucleotide encoding a polypeptide having phytase activity;

[0146] The first polynucleotide and the second polynucleotide are operably linked in a translational fusion manner.

[0147] In one embodiment, the second polynucleotide is located downstream of the first polynucleotide.

[0148] In one embodiment, the signal peptide is a naturally occurring signal peptide, or a functional fragment or functional variant of a naturally occurring signal peptide.

[0149] In one embodiment, the signal peptide is from a filamentous fungal glycosidase.

[0150] In one embodiment, the construct further comprises a third polynucleotide downstream of the first polynucleotide and upstream of the second polynucleotide.

[0151] In one embodiment, the third polynucleotide is a non-coding intron.

[0152] In one embodiment, the third polynucleotide has at least 80%, e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:17 (gtaagtaacatccactctgttctagtgccatgctgagattgtacag).

[0153] In one embodiment, the construct comprises a polynucleotide sequence having at least 80%, e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 18 or SEQ ID NO: 19.

[0154] In one embodiment, the nucleic acid construct further comprises a heterologous promoter, and wherein the promoter, the first polynucleotide, the second polynucleotide, and optionally the third polynucleotide are operably linked.

[0155] In another embodiment, the promoter is a P3 promoter or a P3-based promoter, and preferably the heterologous promoter is a tandem promoter comprising a P3 promoter or a tandem promoter derived from a P3 promoter.

[0156] In one embodiment, the promoter is operably linked to an mRNA stabilizer region; preferably, the mRNA stabilizer region is a cryIIIA mRNA stabilizer region.

[0157] In one embodiment, the signal peptide is a naturally occurring signal peptide, or a functional fragment or functional variant of a naturally occurring signal peptide.

[0158] In one embodiment, the signal peptide is from a glycosidase (EC 3.2.1).

[0159] In one embodiment, the signal peptide is obtained from a mannanase polypeptide (EC 3.2.1.78).

[0160] In one embodiment, the signal peptide is obtained from a b-transglycosidase polypeptide (EC 2.4.1.-).

[0161] In one embodiment, the signal peptide is obtained from a chitin b-1,3 / 1,6-glucanoyltransferase polypeptide (EC 2.4.1.-) polypeptide.

[0162] In one embodiment, the signal peptide is obtained from an endo-b-1,3-glucanase polypeptide or a laminarinase polypeptide (EC 3.2.1.39).

[0163] In one embodiment, the signal peptide is obtained from a polypeptide expressed by a filamentous fungal host cell, such as a mannanase, a transglycosidase, a glycosyltransferase, a laminarinase, or a glucanase.

[0164] In one embodiment, the signal peptide is obtained for expression of the polypeptide in a free Aspergillus host cell (eg, Aspergillus ryukyuensis).

[0165] In one embodiment, the first polynucleotide encoding the signal peptide has at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO:1 or SEQ ID NO:3; most preferably, the polynucleotide comprises, consists essentially of, or consists of the mature polypeptide coding sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:44, SEQ ID NO:46 or SEQ ID NO:48.

[0166] In one embodiment, the first polynucleotide encoding the signal peptide has at least 80%, e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1; most preferably, the polynucleotide comprises, consists essentially of, or consists of the mature polypeptide coding sequence of SEQ ID NO: 1.

[0167] In one embodiment, the first polynucleotide encoding the signal peptide has at least 80%, e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO:3; most preferably, the polynucleotide comprises, consists essentially of, or consists of the mature polypeptide coding sequence of SEQ ID NO:3.

[0168] In one embodiment, the first polynucleotide encoding the signal peptide has at least 80%, e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO:44; most preferably, the polynucleotide comprises, consists essentially of, or consists of the mature polypeptide coding sequence of SEQ ID NO:44.

[0169] In one embodiment, the first polynucleotide encoding the signal peptide has at least 80%, e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO:46; most preferably, the polynucleotide comprises, consists essentially of, or consists of the mature polypeptide coding sequence of SEQ ID NO:46.

[0170] In one embodiment, the first polynucleotide encoding the signal peptide has at least 80%, e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO:48; most preferably, the polynucleotide comprises, consists essentially of, or consists of the mature polypeptide coding sequence of SEQ ID NO:48.

[0171] In one embodiment, the signal peptide is obtained from a glycosidase expressed by an Aspergillus species selected from the group consisting of Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus ryukyuus, or Aspergillus oryzae.

[0172] In one embodiment, the signal peptide is obtained from a glycosidase expressed by Aspergillus ryukyuensis.

[0173] In one embodiment, the signal peptide has at least 85%, such as at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:2.

[0174] In one embodiment, the signal peptide comprises, consists essentially of, or consists of SEQ ID NO:2.

[0175] In one embodiment, the signal peptide has at least 85%, such as at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:4.

[0176] In one embodiment, the signal peptide comprises, consists essentially of, or consists of SEQ ID NO:4.

[0177] In one embodiment, the signal peptide has at least 85%, e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:45.

[0178] In one embodiment, the signal peptide comprises, consists essentially of, or consists of SEQ ID NO:45.

[0179] In one embodiment, the signal peptide has at least 85%, e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:47.

[0180] In one embodiment, the signal peptide comprises, consists essentially of, or consists of SEQ ID NO:47.

[0181] In one embodiment, the signal peptide has at least 85%, e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:49.

[0182] In one embodiment, the signal peptide comprises, consists essentially of, or consists of SEQ ID NO:49.

[0183] In one embodiment, the signal peptide consists of the amino acid sequence of SEQ ID NO:45, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:47 or SEQ ID NO:49 with or without the C-terminal alanine, or a peptide fragment thereof that retains the ability to direct the polypeptide into or across the cell membrane.

[0184] In one embodiment the N- and / or C-terminus of the signal peptide has been extended by the addition of one or more amino acids.

[0185] In one embodiment, the polynucleotide encoding the alpha-lactalbumin polypeptide has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO:5; most preferably, the polynucleotide comprises, consists essentially of, or consists of the mature polypeptide coding sequence of SEQ ID NO:5.

[0186] In one embodiment, the alpha-lactalbumin polypeptide is a bovine alpha-lactalbumin polypeptide.

[0187] In one embodiment, the α-lactalbumin polypeptide is a human α-lactalbumin polypeptide.

[0188] In one embodiment, the alpha-lactalbumin polypeptide has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide of SEQ ID NO:6.

[0189] In one embodiment, the alpha-lactalbumin polypeptide comprises, consists essentially of, or consists of the mature polypeptide of SEQ ID NO:6.

[0190] In one embodiment the N- and / or C-terminus of the alpha-lactalbumin polypeptide has been extended by the addition of one or more amino acids.

[0191] In one embodiment, the polynucleotide encoding a polypeptide having phytase activity has at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 11; most preferably, the polynucleotide comprises, consists essentially of, or consists of the mature polypeptide coding sequence of SEQ ID NO: 11.

[0192] In one embodiment, the polypeptide having phytase activity is a bacterial polypeptide or a variant thereof.

[0193] In one embodiment, the polypeptide having phytase activity is EC 3.1.3.26.

[0194] In one embodiment, the polypeptide having phytase activity has at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide of SEQ ID NO: 12.

[0195] In one embodiment, the polypeptide having phytase activity comprises, consists essentially of, or consists of the mature polypeptide of SEQ ID NO:12.

[0196] In one embodiment the N- and / or C-terminus of the polypeptide having phytase activity has been extended by the addition of one or more amino acids.

[0197] It is expected that the present invention will also be more effective when using signal peptides highly similar to the signal peptides encoded by SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:44, SEQ ID NO:46 and SEQ ID NO:48 disclosed in SEQ ID NO:45, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:47 and SEQ ID NO:49, respectively. For example, one or more non-essential amino acids can be changed. Non-essential amino acids in signal peptides can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, 1989, Science 244:1081-1085). In the latter technique, single alanine mutations are introduced at each residue in the molecule, and the signal peptide activity of the resulting molecule is tested to identify amino acid residues that are critical to the activity of the molecule and non-essential residues. See also, Hilton et al., 1996, J. Biol. Chem. 271:4699-4708. The identities of essential and nonessential amino acids can also be inferred from alignment with one or more related signal peptides.

[0198] Single or multiple amino acid substitutions, deletions and / or insertions can be made and tested using known mutagenesis, recombination and / or shuffling methods followed by relevant screening procedures, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241:53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86:2152-2156; WO 95 / 17413; or WO 95 / 22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991, Biochemistry 30:10832-10837; U.S. Pat. No. 5,223,409; WO 92 / 06204), and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46:145; Ner et al., 1988, DNA 7:127).

[0199] Mutagenesis / shuffling methods can be combined with high-throughput, automated screening methods to detect the activity of cloned, mutagenized polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17:893-896). Mutagenized DNA molecules encoding active polypeptides can be recovered from host cells and rapidly sequenced using standard methods in the art. These methods allow the importance of individual amino acid residues in a polypeptide to be rapidly determined.

[0200] In one aspect, the signal peptide is a variant (i.e., a functional variant) or a fragment (i.e., a functional fragment) of the signal peptide of SEQ ID NO: 45, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 47 or SEQ ID NO: 49. In one aspect, the number of changes in the signal peptide variant of the present invention is 1-10, for example 1-5, such as 1, 2, 3, 4 or 5 changes. Compared with the parent, the changes include substitutions, insertions and / or deletions at one or more (e.g., several) positions. Substitution means replacing the amino acid occupying a certain position with a different amino acid; deletion means removing the amino acid occupying a certain position; and insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a certain position.

[0201] In a preferred embodiment, the signal peptide is a variant of the mature polypeptide of SEQ ID NO:45, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:47 or SEQ ID NO:49, which comprises 1-10 changes, for example 1-5, such as 1, 2, 3, 4 or 5 changes compared to SEQ ID NO:45, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:47 or SEQ ID NO:49, respectively.

[0202] The first polynucleotide and the second polynucleotide are operably linked in a translational fusion manner. In the context of the present invention, the term "operably linked in a translational fusion manner" means that the signal peptide encoded by the first polynucleotide and the polypeptide encoded by the second polynucleotide are encoded in frame and translated together as a single polypeptide. Preferably, after translation, the signal peptide is removed to provide a mature phytase polypeptide or a mature ALAB polypeptide. Alternatively, the signal peptide is not removed or only partially removed to provide a mature ALAB polypeptide or a mature polypeptide having phytase activity and comprising at least one fragment of the signal peptide.

[0203] The first polynucleotide and the second polynucleotide can be manipulated in a variety of ways to provide expression of the variant. Depending on the construct or vector, manipulation of the polynucleotide prior to its insertion into a nucleic acid construct or expression vector may be desirable or necessary. Techniques for modifying polynucleotides using recombinant DNA methods are well known in the art.

[0204] In addition to the signal peptide, the nucleic acid construct of the present invention may also be operably linked to one or more additional control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.

[0205] Promoter

[0206] The control sequence may be a promoter, i.e., a polynucleotide that is recognized by the host cell for expression of a polynucleotide encoding a polypeptide of the present invention. The promoter contains transcriptional control sequences that mediate the expression of the polypeptide. The promoter may be any polynucleotide that exhibits transcriptional activity in the host cell, including mutant promoters, truncated promoters, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides that are homologous or heterologous to the host cell.

[0207] In one embodiment, the nucleic acid construct further comprises a heterologous promoter, and wherein the promoter, the first polynucleotide and the second polynucleotide are operably linked. The promoter is located upstream of the first polynucleotide.

[0208] In an embodiment, the promoter is a heterologous promoter. Preferably, the promoter is a tandem promoter. More preferably, the promoter is a P3 promoter or a P3-based promoter.

[0209] Further suitable promoters for directing transcription of the polynucleotides of the present invention in filamentous fungal host cells are promoters obtained from Aspergillus, Fusarium, Rhizomucor, and Trichoderma cells, such as those described in Mukherjee et al., 2013, “Trichoderma: Biology and Applications” and Schmoll et al., 2014, “Trichoderma: Biology and Applications”. 2016. “Gene Expression Systems in Fungi: Advancements and Applications.” Fungal Biology.

[0210] For expression in yeast hosts, examples of useful promoters are described by Smolke et al., 2018, “Synthetic Biology: Parts, Devices and Applications” (Chapter 6: Constitutive and Regulated Promoters in Yeast: How to Design and Make Use of Promoters in S. cerevisiae) and Schmoll et al., 2018, “Synthetic Biology: Parts, Devices and Applications” (Chapter 6: Constitutive and Regulated Promoters in Yeast: How to Design and Make Use of Promoters in S. cerevisiae). 2016. “Gene Expression Systems in Fungi: Advancements and Applications.” Fungal Biology.

[0211] In one embodiment, the promoter is a promoter operably linked to an mRNA stabilizer region, such as a P3 promoter. Preferably, the mRNA stabilizer region is a cryIIIA mRNA stabilizer region.

[0212] mRNA stabilizer

[0213] The control sequence may also be an mRNA stabilizer region downstream of the promoter and upstream of the coding sequence of a gene, which increases the expression of the gene.

[0214] Examples of suitable mRNA stabilizer regions are obtained from: Bacillus thuringiensis cryIIIA gene (WO 94 / 25612) and Bacillus subtilis SP82 gene (Hue et al., 1995, Journal of Bacteriology 177:3465-3471). Examples of mRNA stabilizer regions of fungal cells are described in Geisberg et al., 2014, Cell 156(4):812-824 and Morozov et al., 2006, Eukaryotic Cell 5(11):1838-1846.

[0215] Terminator

[0216] The control sequence may also be a transcription terminator that is recognized by the host cell to terminate transcription. The terminator is operably linked to the 3' end of the polynucleotide encoding the polypeptide. Any terminator that is functional in the host cell can be used in the present invention.

[0217] Preferred terminators for filamentous fungal host cells are obtainable from Aspergillus or Trichoderma species, such as the genes for Aspergillus niger glucoamylase, Trichoderma reesei β-glucosidase, Trichoderma reesei cellobiohydrolase I, and Trichoderma reesei endoglucanase I, such as those described in Mukherjee et al., 2013, “Trichoderma: Biology and Applications” and in Schmoll et al., 2014. 2016. “Gene Expression Systems in Fungi: Advancements and Applications.” Fungal Biology.

[0218] Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al., 1992, Yeast 8:423-488.

[0219] Propeptide

[0220] The control sequence can also be a propeptide coding sequence encoding a propeptide at the N-terminus of a polypeptide. The resulting polypeptide is referred to as a proenzyme or propolypeptide (or in some cases as a zymogen). Propolypeptides are generally inactive and can be converted into active polypeptides by catalytic cleavage or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding sequence can be obtained from the genes of the following items: Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Myceliophthora thermophila laccase (WO 95 / 33836), Rhizomucor miehei aspartic protease and Saccharomyces cerevisiae α-factor.

[0221] In the case where both the signal peptide sequence and the propeptide sequence are present, the propeptide sequence is located adjacent to the N-terminus of the polypeptide and the signal peptide sequence is located adjacent to the N-terminus of the propeptide sequence. Additionally or alternatively, when both the signal peptide sequence and the propeptide sequence are present, the polypeptide may comprise only a portion of the signal peptide sequence and / or only a portion of the propeptide sequence. Alternatively, the final or separated polypeptide may comprise a mixture of a mature polypeptide and a polypeptide comprising a partial or full-length propeptide sequence and / or a signal peptide sequence.

[0222] Adjustment sequence

[0223] It may also be desirable to add regulatory sequences that regulate the expression of polypeptides associated with host cell growth. Examples of regulatory sequences are regulatory sequences that cause gene expression to be turned on or off in response to chemical or physical stimuli (including the presence of regulatory compounds). In yeast, the ADH2 system or the GAL1 system may be used. In filamentous fungi, Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA α-amylase promoter and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter and Trichoderma reesei cellobiohydrolase II promoter may be used. Other examples of regulatory sequences are those that allow gene amplification. In fungal systems, these regulatory sequences include dihydrofolate reductase genes amplified in the presence of methotrexate and metallothionein genes amplified with heavy metals.

[0224] Preamble sequence

[0225] The control sequence may also be a leader sequence, i.e., an untranslated region of an mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5' end of the polynucleotide encoding the polypeptide. Any leader sequence that is functional in the host cell may be used.

[0226] Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.

[0227] Suitable leaders for yeast host cells can be obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH2 / GAP).

[0228] Transcription Factors

[0229] The control sequence can also be a transcription factor, i.e. a polynucleotide encoding a polynucleotide-specific DNA binding polypeptide, which controls the transcription rate of genetic information from DNA to mRNA by binding to a specific polynucleotide sequence. Transcription factors can play a role alone and / or together with one or more other polypeptides or transcription factors in a complex by promoting or blocking the recruitment of RNA polymerase. Transcription factors are characterized by comprising at least one DNA binding domain, which is usually attached to a specific DNA sequence adjacent to a genetic element regulated by the transcription factor. Transcription factors can directly regulate the expression of a target protein, i.e., activate the transcription of a gene encoding a target protein by binding to its promoter, or indirectly regulate the expression of a target protein, i.e., activate the transcription of the other transcription factor by, for example, binding to the promoter of another transcription factor, and the other transcription factor regulates the transcription of the gene encoding the target protein. Suitable transcription factors for prokaryotic host cells are described in Seshasayee et al., Subcell Biochem 2011; 52: 7-23, and Balleza et al., FEMS Microbiol Rev 2009, 33(1): 133-151.

[0230] polyadenylation sequence

[0231] The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the polynucleotide which, when transcribed, is recognized by the host cell as a signal to add polyadenylic acid residues to transcribed mRNA. Any polyadenylation sequence functional in the host cell may be used.

[0232] Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.

[0233] Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Mol. Cellular Biol. 15: 5983-5990.

[0234] Expression vector

[0235] In the second aspect, the present invention further relates to recombinant expression vectors, which comprise the nucleic acid construct according to the first aspect. The expression vector comprises polynucleotides of the present invention, promoters and transcription and translation termination signals. A plurality of nucleotides and control sequences can be linked together to produce a recombinant expression vector, which can comprise one or more convenient restriction sites to allow insertion or replacement of the polynucleotides encoding polypeptides at such sites. Alternatively, the polynucleotides can be expressed by inserting the polynucleotides or the nucleic acid constructs comprising the polynucleotides into a suitable vector for expression. When producing the expression vector, the coding sequence is so positioned in the vector that the coding sequence is operably connected with the suitable control sequence for expression.

[0236] The recombinant expression vector can be any vector (e.g., a plasmid or virus) that can be easily subjected to recombinant DNA procedures and can cause expression of the polynucleotide. The choice of vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid.

[0237] The vector can be an autonomously replicating vector, that is, a vector existing as an extrachromosomal entity, whose replication is independent of chromosomal replication, such as a plasmid, an extrachromosomal element, a minichromosome or an artificial chromosome. The vector can contain any means for ensuring self-replication. Alternatively, the vector can be a vector that is integrated into the genome when it is introduced into the host cell and replicates with the chromosome into which it has been integrated. Moreover, a single vector or plasmid or two or more vectors or plasmids can be used, which together contain the total DNA to be introduced into the host cell genome, or a transposon can be used.

[0238] The vector preferably contains one or more selectable markers that permit easy selection of transformed cells, transfected cells, transduced cells, etc. A selectable marker is a gene whose product provides biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, etc.

[0239] The vector preferably contains one or more elements that permit integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.

[0240] For integration into the host cell genome, the vector may rely on the polynucleotide sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous recombination, such as homology directed repair (HDR), or non-homologous recombination, such as non-homologous end joining (NHEJ).

[0241] For autonomous replication, the vector may further comprise an origin of replication that enables the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicon that mediates autonomous replication that functions in the cell. The term "origin of replication" or "plasmid replicon" means a polynucleotide that enables a plasmid or vector to replicate in vivo.

[0242] More than one copy of polynucleotides of the present invention can be inserted into host cells to improve the production of polypeptides. For example, 2 or 3 or 4 or 5 or more copies are inserted into host cells. The copy number of the increase of polynucleotides can be obtained by integrating at least one other copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene together with the polynucleotides, wherein cells containing amplified copies of the selectable marker gene and thus other copies of the polynucleotides can be selected by cultivating cells in the presence of an appropriate selective agent.

[0243] Host cells

[0244] In a third aspect, the present invention relates to fungal host cells comprising in their genome:

[0245] a) a nucleic acid construct according to the first aspect; and / or

[0246] b) The expression vector according to the second aspect.

[0247] The construct or vector comprising the polynucleotide is introduced into the host cell so that the construct or vector is maintained as a chromosomal integrant or as a self-replicating extrachromosomal vector, as described earlier. The selection of the host cell will depend to a great extent on the gene encoding the polypeptide and its source. The polypeptide encoded by the introduced polynucleotide can be natural or heterologous to the recombinant host cell. In addition, at least one control sequence in the one or more control sequences can be heterologous to the polynucleotide encoding the polypeptide. The recombinant host cell can comprise a single copy or at least two copies, for example three, four, five or more copies of the polynucleotide of the present invention.

[0248] In one embodiment, the host cell comprises two or more copies of the nucleic acid construct and / or expression vector.

[0249] The host cell may be a fungal cell. "Fungi" as used herein include Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota, as well as Oomycota and all mitotic spore fungi (as defined by Hawksworth et al., Ainsworth and Bisby's Dictionary of The Fungi, 8th ed., 1995, CAB International, University Press, Cambridge, UK).

[0250] Fungal cells can be transformed by processes involving protoplast-mediated transformation, Agrobacterium-mediated transformation, electroporation, gene gun methods, and shock wave-mediated transformation (reviewed in Li et al., 2017, Microbial Cell Factories [Microbial Cell Factories] 16: 168) and EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States] 81: 1470-1474; Christensen et al., 1988, Bio / Technology [Biotechnology] 6: 1419-1422 and Lubertozzi and Keasling, 2009, Biotechn. Advances [Biotechnological Progress] 27: 53-75. However, any method known in the art for introducing DNA into fungal host cells may be used, and the DNA may be introduced as a linearized or circular polynucleotide.

[0251] The fungal host cell can be a yeast cell. "Yeast" as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to Fungi Imperfecti (Blastomycetes). For the purposes of the present invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, Passmore and Davenport, eds., Soc. App. Bacteriol. Symposium Series No. 9, 1980).

[0252] The yeast host cell can be a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell, such as a Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia lipolytica cell. In preferred embodiments, the yeast host cell is a Pichia or Komagataella cell, such as a Pichia pastoris cell (Komagataella phaffii).

[0253] The fungal host cell can be a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the subphylum of Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). The characteristics of filamentous fungi are generally mycelial walls composed of chitin, cellulose, glucan, chitosan, mannan and other complex polysaccharides. Vegetative growth is carried out by hyphae extension, and carbon catabolism is obligate aerobic. In contrast, the vegetative growth of yeast (such as Saccharomyces cerevisiae) is carried out by budding of unicellular thallus, and carbon catabolism can be fermentative.

[0254] The filamentous fungal host cell can be Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neomyces, In some embodiments, the filamentous fungal host cell is a cell of the genus Aspergillus, Trichoderma, or Fusarium. In other preferred embodiments, the filamentous fungal host cell is a cell of the genus Aspergillus, Trichoderma, or Fusarium. In other preferred embodiments, the filamentous fungal host cell is a cell of Aspergillus niger, Aspergillus oryzae, Trichoderma reesei, or Fusarium venenatum.

[0255] For example, the filamentous fungal host cell can be Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis a eirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lukenowens, or Chrysosporium spp. lucknowense), Chrysosporiummerdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolushirsutus, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum), Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusariumsulphureum), Fusarium torulosum, Fusarium trichothecioides, Fusarium embellishment, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Talaromyces emersonii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longifolia, longibrachiatum, Trichoderma reesei, or Trichoderma viride cells.

[0256] In one embodiment, the host cell is an Aspergillus cell.

[0257] In another embodiment, the host cell is an Aspergillus niger cell.

[0258] In one embodiment, the host cell is an Aspergillus oryzae cell.

[0259] In one aspect, the host cell is isolated.

[0260] In one embodiment, the host cell comprises at least two copies of the nucleic acid construct and / or the expression vector, such as two copies, four copies, or more than four copies.

[0261] In another aspect, the host cell is purified.

[0262] Generation method

[0263] In a fourth aspect, the present invention also relates to a method for producing an alpha-lactalbumin (ALAB) polypeptide, the method comprising:

[0264] a) cultivating a host cell according to the third aspect under conditions conducive to production of the ALAB polypeptide; and optionally

[0265] b) recovering the ALAB polypeptide.

[0266] In a fifth aspect, the present invention also relates to a method for producing a polypeptide having phytase activity, the method comprising:

[0267] a) cultivating the host cell according to the third aspect under conditions conducive to production of the polypeptide having phytase activity; and optionally

[0268] b) recovering the polypeptide having phytase activity.

[0269] Host cells are cultivated in a nutrient medium suitable for producing polypeptides using methods known in the art. For example, cells can be cultured in suitable medium and under conditions allowing expression and / or separation of polypeptides by shaking flask culture or in a laboratory or industrial fermentor on a small scale or in large scale fermentation (including continuous, batch, fed-batch or solid-state and / or microcarrier-based fermentation). Suitable medium can be obtained from commercial suppliers or can be prepared according to disclosed composition (for example, in the catalog of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be directly recovered from the medium. If the polypeptide is not secreted, it can be recovered from the cell lysate.

[0270] The polypeptide can be detected using methods known in the art that are specific for the polypeptide, including but not limited to assays using specific antibodies, enzyme product formation, disappearance of enzyme substrate, or determining the relative or specific activity of the polypeptide.

[0271] The polypeptide can be recovered from the culture medium using methods known in the art, including but not limited to collection, centrifugation, filtration, extraction, spray drying, evaporation or precipitation. In one aspect, the whole fermentation broth containing the polypeptide is recovered. In another aspect, the cell-free fermentation broth containing the polypeptide is recovered.

[0272] The polypeptides can be purified by a variety of procedures known in the art to obtain substantially pure polypeptides and / or polypeptide fragments (see, e.g., Wingfield, 2015, Current Protocols in Protein Science; 80(1):6.1.1-6.1.35; Labrou, 2014, Protein Downstream Processing, 1129:3-10).

[0273] In an alternative aspect, the polypeptide having phytase activity is not recovered.In one aspect, the polypeptide having phytase activity is not recovered, but rather a host cell of the invention expressing the polypeptide having phytase activity is used as a source of the variant.

[0274] Fusion peptide:

[0275] In a sixth aspect, the present invention relates to a fusion polypeptide comprising

[0276] a) a signal peptide having at least 60% sequence identity to SEQ ID NO:45, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:47 or SEQ ID NO:49; and

[0277] b) an alpha-lactalbumin polypeptide having at least 60% sequence identity to SEQ ID NO: 6, or a polypeptide having phytase activity having at least 60% sequence identity to SEQ ID NO: 8.

[0278] In one embodiment, the signal peptide is located upstream of the α-lactalbumin polypeptide or upstream of the polypeptide having phytase activity.

[0279] In one embodiment, the signal peptide is located at the N-terminus of the α-lactalbumin polypeptide or the N-terminus of the polypeptide having phytase activity.

[0280] In particular embodiments, the α-lactalbumin polypeptide is selected from the group consisting of:

[0281] (a) a polypeptide having at least 60% sequence identity to SEQ ID NO: 8;

[0282] (b) a polypeptide having at least 60% sequence identity to SEQ ID NO: 10;

[0283] (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO:7 or SEQ ID NO:9;

[0284] (d) a polypeptide derived from SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:18, or SEQ ID NO:19, the mature polypeptide of SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:18, or SEQ ID NO:19, having 1-30 alterations, e.g., substitutions, deletions and / or insertions, e.g., 1, or 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13, or 14, or 15, or 16, or 17, or 18, or 19, or 20, or 21, or 22, or 23, or 24, or 25, or 26, or 27, or 28, or 29, or 30 alterations, particularly substitutions, at one or more positions;

[0285] (e) a polypeptide derived from the polypeptide of (a), (b), (c) or (d), wherein the N- and / or C-terminus has been extended by the addition of one or more amino acids;

[0286] (f) a fragment of the polypeptide of (a), (b), (c), (d) or (e), and

[0287] (g) A fragment of (f), wherein the polypeptide has 1-10 deletions at the N-terminus.

[0288] In another embodiment, the polypeptide having phytase activity is selected from the group consisting of:

[0289] (a) a polypeptide having at least 60% sequence identity to SEQ ID NO: 14;

[0290] (b) a polypeptide having at least 60% sequence identity to SEQ ID NO: 16;

[0291] (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 13 or SEQ ID NO: 15;

[0292] (d) a polypeptide derived from SEQ ID NO: 14 or SEQ ID NO: 16, the mature polypeptide of SEQ ID NO: 14 or SEQ ID NO: 16, having 1-30 alterations, e.g., substitutions, deletions and / or insertions, e.g., 1, or 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13, or 14, or 15, or 16, or 17, or 18, or 19, or 20, or 21, or 22, or 23, or 24, or 25, or 26, or 27, or 28, or 29, or 30 alterations, particularly substitutions, at one or more positions;

[0293] (e) a polypeptide derived from the polypeptide of (a), (b), (c) or (d), wherein the N- and / or C-terminus has been extended by the addition of one or more amino acids;

[0294] (f) a fragment of the polypeptide of (a), (b), (c), (d) or (e), and

[0295] (g) A fragment of (f), wherein the polypeptide has 1-10 deletions at the N-terminus.

[0296] Fermentation broth preparation or cell composition

[0297] The invention also relates to a fermentation broth formulation or cell composition comprising a polypeptide having phytase activity. The fermentation broth product further comprises other ingredients used in the fermentation process, such as, for example, cells (including host cells containing nucleic acid constructs of the present invention, which are used to produce polypeptides having phytase activity), cell debris, biomass, fermentation medium and / or fermentation product. In certain embodiments, the composition is a cell-killed full culture broth containing organic acids, killed cells and / or cell debris and culture medium.

[0298] As used herein, term " fermented liquid " refers to the preparation produced by cell fermentation, does not experience or experiences minimum recovery and / or purification.For example, when microbial culture is hatched and grown to saturation under the carbon restriction condition that allows protein synthesis (for example, by host cell expression enzyme) and protein secretion in cell culture medium. Fermented liquid can contain the unclassified or graded content of the fermented material derived at the end of fermentation.Typically, fermented liquid is unclassified and comprises the cell debris existing after the spent culture medium and for example, by centrifugal removal microbial cell (for example, filamentous fungal cell).In certain embodiments, fermented liquid contains spent cell culture medium, extracellular enzyme and vigorous and / or inactive microbial cell.

[0299] In some embodiments, the fermentation broth formulation or cell composition comprises a first organic acid component (comprising at least one 1-5 carbon organic acid and / or its salt) and a second organic acid component (comprising at least one 6 or more carbon organic acid and / or its salt). In some embodiments, the first organic acid component is acetic acid, formic acid, propionic acid, a salt thereof, or a mixture of two or more of the foregoing; and the second organic acid component is benzoic acid, cyclohexanecarboxylic acid, 4-methylpentanoic acid, phenylacetic acid, a salt thereof, or a mixture of two or more of the foregoing.

[0300] On the one hand, composition contains one or more organic acids, and optionally further contains killed cells and / or cell debris. In certain embodiments, these killed cells and / or cell debris are removed from the whole culture fluid of cell killing to provide a composition without these components.

[0301] The fermentation broth formulation or cell composition may further comprise a preservative and / or an antimicrobial (eg, bacteriostatic) agent, including but not limited to sorbitol, sodium chloride, potassium sorbate, and other agents known in the art.

[0302] The full culture fluid or cell composition of cell killing can contain the unfractionated content of the fermentation material derived at the end of fermentation.Typically, the full culture fluid or cell composition of cell killing contain spent substratum and cell debris existing after microbial cells (for example, filamentous fungal cells) grow to saturation, hatch under carbon restriction conditions to allow protein synthesis.In certain embodiments, the full culture fluid or cell composition of cell killing contain spent cell culture medium, extracellular enzyme and the filamentous fungal cells of killing.In certain embodiments, methods known in the art can be used to make the microbial cells present in the full culture fluid or composition of cell killing permeabilization and / or cracking.

[0303] As described herein, whole culture fluid or cell composition is typically liquid, but can contain insoluble components, such as killed cells, cell debris, culture medium components and / or one or more insoluble enzymes. In some embodiments, insoluble components can be removed to provide a clarified liquid composition.

[0304] The whole broth formulation and cell composition of the present invention can be produced by the methods described in WO 90 / 15861 or WO 2010 / 096673.

[0305] The present invention is further described by the following examples, which should not be construed as limiting the scope of the present invention.

[0306] Examples

[0307] Example 1: Signal peptide library for expressing phytase

[0308] Phytase expression vectors containing the signal peptide variants JSP002, 010, 011 and 031 were prepared as follows.

[0309] The phytase expression plasmid consists of a phytase coding sequence (SEQ ID NO: 11), a marker expression cassette and an E. coli vector fragment. To prepare the expression plasmid for each signal peptide variant, two fragments are amplified. The first fragment (signal peptide fragment) has a portion of the E. coli vector fragment and a portion of the phytase expression cassette, which includes a promoter, a signal peptide sequence and the first 21 bases at the 5' end of the mature phytase. The second fragment (mature fragment) contains a portion of the phytase expression cassette, a marker expression cassette and a portion of the E. coli derived fragment including the mature peptide sequence and a terminator. The 5' and 3' ends of the two fragments have overlapping sequences of about 20 bp and can be assembled with the Gibson assembly kit. The obtained plasmid will have different signal peptides for phytase expression. For the amplification of the mature fragment, overlapping PCR is performed to amplify the fragment encoding each signal fragment and the mature fragment of the phytase. It is inserted between the promoter and terminator of the Aspergillus niger expression plasmid. The prepared plasmid DNA is introduced into the host strain of Aspergillus niger (host: C3085 and / or C5553). All strains contained the same number of copies of the phytase gene

[0310] SP GH13 having SEQ ID NO: 25 is derived from Aspergillus niger endo-1,4-alpha amylase GH13.

[0311] The SP Cutinase having SEQ ID NO: 27 is derived from Humicola insolens Cutinase.

[0312] SP GH16 having SEQ ID NO: 4 is derived from Aspergillus ryukyuensis endo-b-1,3-glucanase GH16 (SEQ ID NO: 23).

[0313] SP GH26 having SEQ ID NO: 2 is derived from Aspergillus ryukyuensis endo-1,4-β-mannanase GH26 (SEQ ID NO: 21).

[0314] Table 1. Signal sequences for phytase expression

[0315]

[0316] Table 2. Primers

[0317]

[0318] Example 2: SP GH16 and SP GH26 show increased phytase production during MTP cultivation

[0319] The transformant constructed as in Example 1 was cultured in 1 / 4YPG Ac and 1% SBP were fermented at 30°C for 3 days in 96-well microtiter plates (MTP). The yield was detected by measuring the phytase activity in the culture supernatant using an artificial substrate (described in the "pNP assay" section). As can be seen in Table 3, increased phytase activity was measured using SP GH26 and SP GH16 compared to the phytase activity using SP cutinase. In detail, SP GH26 showed a 187% increase in yield compared to SP cutinase, and SP GH16 showed a 12% increase in yield compared to SP cutinase.

[0320] Table 3. Relative phytase activities of signal variants in the C3085 host

[0321] Signal variants Relative phytase activity (% relative to JSP004) JSP004 (SP Cutinase) 100 JSP002(SP GH26) 287 JSP010(SP GH16) 112 JSP011(SP GH13) 80

[0322] Example 3: SP GH16 with increased phytase production during laboratory tank fermentation

[0323] The GH16 signal peptide was compared to SP GH13 by laboratory tank fermentation under existing standard conditions. The strains had the same genetic background, but the number of integrated gene copies of the phytase signal variants was different, as shown in Table 4. The results are shown in Table 4, where the JSP010 signal peptide GH16 showed significantly higher yield, i.e. 2.3 times higher, compared to SP GH13. The yield was measured by phytase activity using phytase as substrate (FYT (B) assay).

[0324] Table 4. Relative phytase production during laboratory tank fermentation

[0325]

[0326] Example 4: Expression of a signal peptide library of bovine α-lactalbumin (ALAB)

[0327] Signal peptide variants expressing bovine alpha-lactalbumin (ALAB, SEQ ID NO: 6) were constructed by two transformation steps (shown in Table 5). The first transformation (host C2552) was performed to integrate the expression cassette of bovine alpha-lactalbumin, but an amylase intron containing a PAM sequence was inserted at the position of the signal sequence. The obtained strain was transformed for the second time. The target signal sequence fragment was amplified by PCR and integrated between the promoter and the mature sequence of bovine alpha-lactalbumin by the CRISPR system. The obtained strain is a strain expressing bovine alpha-lactalbumin under six different signal peptides.

[0328] SP GH72 having SEQ ID NO: 29 is derived from Aspergillus niger β-1,3-glucanosyltransferase GH72 having a GPI-anchor.

[0329] SP GH16 having SEQ ID NO: 4 is derived from Aspergillus ryukyuensis endo-b-1,3-glucanase GH16 (SEQ ID NO: 23).

[0330] SP GH26 having SEQ ID NO: 2 is derived from Aspergillus ryukyuensis endo-1,4-β-mannanase GH26 (SEQ ID NO: 21).

[0331] SP LYA1_4 having SEQ ID NO:45.

[0332] SP pepsin A having SEQ ID NO:47.

[0333] SP GH28_9 having SEQ ID NO:49.

[0334] Table 5. Signal sequences tested for ALAB expression

[0335]

[0336]

[0337] Example 5: Improved α-lactalbumin production using SP GH26

[0338] Transformants JSP002 and JSP031 constructed as in Example 4 were fermented by MTP or baffled shake flask (SF). The culture broth was centrifuged (3500 xg, 15 min), and the supernatant was used for yield evaluation by MALDI-TOFMS semi-quantitative method.

[0339] Semi-quantification by MALDI-TOF MS

[0340] The yield of bovine α-lactalbumin was simply measured by the intensity of the MS spectrum relative to the reference signal. The results are summarized in Table 6. Accordingly, ALAB expression increased by 91% using SP GH26 compared to ALAB expression using SP GH72 (MTP). In shake flask culture, ALAB expression using SP GH26 was about 2.6 times higher than ALAB expression using SP GH72.

[0341] Table 6. Relative ALAB production using different signal sequences and fermentation protocols (MTP and SF).

[0342]

[0343] Example 6: SP GH16 and SP GH26 resulted in similar ALAB yields in laboratory tank fermentations

[0344] The ALAB expression of the JSP002 (SP GH26) signal peptide (which showed superior expression compared to the JSP031 SP in the MTP and SF formats of Example 5) was compared with that of the JSP010 (SP GH16) signal peptide. Therefore, an ALAB expression strain containing three copies of the ALAB encoding gene was reconstructed using the Aspergillus niger host C6216, each copy having either SP GH26 or SP GH16 located upstream of the ALAB gene. The expression plasmid was prepared by overlapping PCR of the signal and mature α-lactalbumin (ALAB) fragments. The obtained strains were fermented in laboratory tanks under existing standard conditions and the yields were compared by band intensity of SDS-PAGE. As shown in Table 7, no significant ALAB yield differences were observed between the two signal variants, SP GH16 and SP GH26. Thus, both signal variants showed significant yield increases compared to JSP031 from Example 5, with Example SP GH26 showing a 191% increase in ALAB yield compared to JSP031 with SP from GH72.

[0345] Table 7. Relative ALAB production using different signal sequences in different fermentation protocols (SF and lab tank).

[0346]

[0347] Example 7: Improved ALAB production in MTP culture

[0348] Additional signal peptide variants for the expression of bovine ALAB (SEQ ID NO: 6) were constructed as described in Example 4. The signal peptide variants used in Example 7 were: JSP004 (control, cutinase SP with SEQ ID NO: 27), JSP008 (GH28_9 SP with SEQ ID NO: 49), JSP017 (LYA1_4 SP with SEQ ID NO: 45), JSP002 (SP GH 26, SEQ ID NO: 2), JSP031 (SP GH72, SEQ ID NO: 29) and JSP019 (pepsin A = pepASP with SEQ ID NO: 47). The constructed strains were cultured in MTP (microtiter plates). The culture broth was centrifuged (3500 x g, 15 min) and the supernatant was used for yield evaluation by SDS-PAGE. The culture supernatant was deglycosylated with EndoH and loaded on an SDS-PAGE gel. The intensity of the band corresponding to ALAB was compared with the intensity of ALAB fused to Cutinase SP (JSP004) used as a control. The ALAB production of different SP variants relative to the ALAB production using Cutinase SP is shown in Table 8. All SP variants tested showed increased ALAB production relative to SP Cutinase. As shown in Table 8, JSP017 and JSP019 resulted in 342% and 472% ALAB production, respectively.

[0349] Table 8.

[0350] Signal peptide variants Relative ALAB yield [%] 15 JSP004 (SP Cutinase, SEQ ID NO: 27) 100.0 JSP002 (SP GH26, SEQ ID NO: 2) 172.1 JSP008 (GH28_9, SEQ ID NO: 49) 287.2 JSP017(SP LYA1-4, SEQ ID NO:45) 342.8 JSP019 (SP pepA, SEQ ID NO:47) 472.7 JSP031(SP GH72, SEQ ID NO:29) 324.8

[0351] Example 8: Improved ALAB production in a microbial reactor

[0352] The ALAB expressing Aspergillus niger strains fused with different signal peptides were cultured in a microbial reactor with a culture volume of 250 ml for each strain. The strains were constructed as described in Example 4 and grown in duplicate. The average ALAB yield was measured by size exclusion chromatography and is shown in Table 9, normalized to JSP002 GH 26SP having SEQ ID NO: 2. As shown in Table 9, the ALAB yield of the JSP017 signal peptide was increased by 53% relative to the JSP002 signal peptide.

[0353] Table 9.

[0354] Signal peptide variants Relative ALAB yield [%] JSP002 (SEQ ID NO: 2) 100 JSP017 (SEQ ID NO:45) 153 JSP031 (SEQ ID NO: 29) 141 JSP019 (SEQ ID NO: 47) 110

[0355] Materials and Methods

[0356] Unless otherwise indicated, DNA manipulation and transformation were performed using standard methods of molecular biology as described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor lab., Cold Spring Harbor, NY; Ausubel, FM et al. (eds.) "Current protocols in Molecular Biology", John Wiley and Sons, 1995; Harwood, CR, and Cutting, SM (eds.) "Molecular Biological Methods for Bacillus". John Wiley and Sons, 1990.

[0357] Purchased materials (E. coli and kit)

[0358] Escherichia coli DH5α (Toyobo) was used for plasmid construction and amplification. Qiagen Plasmid kit (Qiagen) was used to reclaim the amplified plasmid. According to the manufacturer's instructions, Rapid DNA Dephos & Ligation kit (Roche) or Gibson assembly kit (NEB) was used for connection. Polymerase chain reaction (PCR) was performed using KOD-Plus system (Toyobo) or PrimeSTAR MAX DNA polymerase (Takara). QIAquickTM gel extraction kit (Qiagen) was used to purify PCR fragments and extract DNA fragments from agarose gel.

[0359] Enzymes

[0360] Enzymes for DNA manipulation (eg, restriction endonucleases, ligases, etc.) are available from New England Biolabs, Inc. and were used according to the manufacturer's instructions.

[0361] Plasmids

[0362] The phytase sequence with the phytase from Citrobacterium braakii is depicted as SEQ ID NO: 11 (coding sequence) and SEQ ID NO: 12 (amino acid sequence).

[0363] Microbial strains

[0364] In Example 14 of WO 2012 / 160093, the expression host strain Aspergillus niger C2552 was isolated by Novozymes and is a derivative of Aspergillus niger NN049184 isolated from soil. C3085, C5553, C6242 are strains that can produce glucoamylase (1,4-α-D-glucan glucose hydrolase, EC 3.2.1.3) from Gloeophyllum sepiarium (Gs AMG).

[0365] Culture medium

[0366] The COVE trace metal solution is composed of: 0.04 g NaB4O7·10H2O, 0.4 g CuSO4·5H2O, 1.2 g FeSO4·7H2O, 0.7 g MnSO4·H2O, 0.8 g Na2MoO2·2H20, 10 g ZnSO4·7H2O, and deionized water to make up to 1 liter.

[0367] 50X COVE salt solution was composed of 26 g KCl, 26 g MgSO4.7H2O, 76 g KH2PO4, 50 ml COVE trace metal solution, and deionized water to make up to 1 liter.

[0368] COVE medium is composed of 342.3 g sucrose, 20 ml 50X COVE salt solution, 10 ml 1 M acetamide, 10 ml 1.5 M CsCl2, 25 g pure agar, and deionized water to make up to 1 liter.

[0369] COVEII plus 5-fluorocytosine top agarose is composed of the following: 34 g sucrose, 20 ml 50X COVE salt solution, 10 ml 1 M acetamide, 2 ml 5 g / L 5-fluorocytosine, 10 g low melting point agarose and deionized water to make up to 1 liter.

[0370] COVE-N-GlyX plates were composed of 218 g xylitol, 10 g glycerol, 2.02 g KNO3, 50 ml COVE salt solution, 25 g neat agar, and deionized water to make up to 1 liter.

[0371] STC buffer consisted of: 0.8 M sorbitol, 25 mM Tris pH 8, and 25 mM CaCl2.

[0372] STPC buffer consisted of: 40% PEG 4000 in STC buffer.

[0373] LB medium was composed of 10 g of tryptone, 5 g of yeast extract, 5 g of sodium chloride, and deionized water to make up to 1 liter.

[0374] LB plus ampicillin plates were composed of 10 g tryptone, 5 g yeast extract, 5 g sodium chloride, 15 g bactoagar, ampicillin at 100 μg / ml, and deionized water to make up to 1 liter.

[0375] YPG medium was composed of 10 g of yeast extract, 20 g of bacterial peptone, 20 g of glucose, and deionized water to make up to 1 liter.

[0376] SOC medium was composed of 20 g tryptone, 5 g yeast extract, 0.5 g NaCl, 10 ml 250 mM KCl, and deionized water to make up to 1 liter.

[0377] TAE buffer was composed of 4.84 g Tris base, 1.14 ml glacial acetic acid, 2 ml 0.5 M EDTA pH 8.0, and deionized water to make up to 1 liter.

[0378] 1 / 4YPG Ac and 1% SBP consisted of: 5.0 g / L glucose, 2.5 g / L yeast extract, 5 g / L peptone, 10 g / L soy flour, 5 ml / L 2M sodium acetate buffer, pH 4.5

[0379] MSG was composed of: 72 g glycerol, 92 g soy flour (pH 6.0), water to make up to 1 liter.

[0380] MU-1glu is composed of 260 g glucose, 3 g MgSO4·7H2O, 5 g KH2PO4, 6 g K2SO4, amyloglucosidase trace metal solution (pH 4.5), and water to make up to 1 liter.

[0381] The amyloglucosidase trace metal solution is 13.9 g / L FeSO4·7H2O, 13.56 g / L MnSO4·5H2O, 6.8 g / L ZnCl2, 2.5 g / L CuSO4·5H2O, 0.24 g / L NiCl2·6H2O, and 3 g / L citric acid H2O.

[0382] Transformation of Aspergillus niger

[0383] Transformation of Aspergillus species can be achieved using general methods for transformation of yeast.

[0384] The Aspergillus niger host strain was inoculated into 100 ml of YPG medium supplemented with 10 mM uridine and incubated at 32°C at 80 rpm for 16 hours. The pellet was collected and washed with 0.6 M KCl and resuspended in a 5% flask containing a commercial β-glucanase product (GLUCANEX TM , Novozymes A / S, Boswell , Denmark) in 20ml 0.6M KCl (final concentration of 20mg / ml).The suspension is incubated at 32°C with 80rpm until protoplasts are formed, and then washed twice with STC buffer.These protoplasts are counted with a hemocytometer, and are resuspended in 8:2:0.1 solution of STC:STPC:DMSO and adjusted to a final concentration of 2.5x107 individual protoplasts / ml.Approximately 4 μg of plasmid DNA is added to 100 μl protoplast suspensions, mixed gently, and incubated on ice for 30 minutes.1ml of SPTC is added, and the protoplast suspension is incubated at 37°C for 20 minutes.After adding 10ml of 50°C Cove top agarose, the reaction is poured on Cove agar plates, and the plates are incubated for 3 days at 30°C.COVEII is covered on transformation plates with 5-fluorocytosine top agarose to carry out the counter selection of bacterial strains.

[0385] PCR amplification

[0386] Polymerase chain reaction (PCR) was performed using KOD plus neo [Toyo] or PrimeSTAR Max DNA polymerase [Takara Bio]. The KOD plus reaction mixture is shown in Table 10. The KOD plus PCR cycles are shown in Table 11. The PrimeSTAR reaction mixture is shown in Table 12, and the corresponding PCR cycles are shown in Table 13.

[0387] Table 10. KOD plus neo-PCR reaction mixture:

[0388] Template DNA 1.0mL 5x Buffer 5.0mL dNTP 5.0mL MgSO4 3.0mL KOD plus neo 1.0mL Forward primer (10 μM) 1.5mL Reverse primer (10 μM) 1.5mL water Up to 50mL

[0389] Table 11. KOD plus neo-PCR program

[0390]

[0391] Table 12. PrimeSTAR Max DNA polymerase PCR reaction mixture:

[0392] Template DNA 1.0mL 2× PrimeSTAR Max DNA Polymerase Mix 55.0mL Forward primer (10 μM) 1.5mL Reverse primer (10 μM) 1.5mL water Up to 50mL

[0393] Table 13. PrimeSTAR Max DNA polymerase PCR program

[0394]

[0395] MTP fermentation

[0396] Spores of the selected transformants were inoculated into 0.45 mL of 1 / 4 YPG Ac, 1% SBP in a 96-well MTP and cultured at 30°C and 900 rpm for 3 days.

[0397] Shake flask (SF) fermentation

[0398] The spores were inoculated into 100 ml MSG medium in baffled flasks and fermented on a rotary shaker at 220 rpm at 30° C. 10 ml of the culture was transferred to 100 ml MU1-glu with 4 ml 50% urea in a 500 ml baffled flask and further fermented for 3 to 5 days.

[0399] Laboratory tank fermentation

[0400] Fermentation was performed as fed-batch fermentation (H. Pedersen 2000, Appl Microbiol Biotechnol, 53: 272-277). The selected strains were pre-cultured in liquid medium and the grown mycelium was then transferred to tanks for further culture for protein production. Culture was carried out at pH 4 to 7, 30° C.-34° C. for 6-8 days with glucose and ammonium feed without overdosing. The culture supernatant after centrifugation was used for yield evaluation.

[0401] pNP assay

[0402] The culture supernatant and the purified standard samples were diluted to appropriate concentrations with 100mM sodium acetate buffer (pH 5.5). Enzymatic reaction was started by mixing 10uL diluted sample and 100uL substrate (10mM disodium p-nitrophenyl phosphate, in 100mM sodium acetate, pH 5.5) in 96-well plates. After incubation at room temperature for 18min, 80uL stop solution (0.5M NA2CO3, pH>11) was added, the absorbance at 405nm was measured for 2min. Enzyme activity was calculated according to the standard curve and indicated as relative activity with reference.

[0403] FYT(B) assay

[0404] Phytase activity was measured as FYT(B) (Phytase (Braakii) Units) relative to an enzyme standard of known strength.

[0405] Sample and standard phytase and sodium phytate (phytic acid dodecasodium salt C6H6O 24 P6 12) reacts and releases inorganic phosphate. The catalytic reaction parameters and conditions are shown in Table 14. This phosphate is formed by a yellow complex with an acidic complex reagent containing molybdate / vanadate, which is determined by spectrophotometry. The yellow complex is measured by spectrophotometry at a wavelength of 405nm. The rate of phosphate release can be observed by Konelab (Thermo Fisher Scientific). The colorimetric reaction parameters and conditions are shown in Table 15. Table 16 shows the reaction buffer and reagent composition.

[0406] Table 14. Catalytic reactions

[0407]

[0408]

[0409] Table 15. Colorimetric reactions

[0410]

[0411] Table 16. Reaction buffer and reagent compositions

[0412]

[0413] The activity of the enzyme samples was determined relative to the standard curve.

[0414] The calculation is performed as follows:

[0415] Active FYT(B) / g=(S x V x F) / W

[0416] S = standard curve reading, in FYT(B) / ml

[0417] V = volume of the volumetric flask used, in mL

[0418] F = dilution of the second dilution

[0419] W = weight of the sample in grams

[0420] Semi-quantification by MALDI-TOF MS

[0421] The diluted culture supernatant was mixed with an internal standard protein (e.g. EndoH) and MS spectra were obtained. The ratio of the target (bovine α-lactalbumin) signal intensity to the reference (internal standard) signal intensity was recorded as the crude expression level of the target. A standard curve was prepared using a series of diluted purified bovine α-lactalbumin.

[0422] Size Exclusion Chromatography (SEC)

[0423] Quantification of ALAB was performed by size exclusion chromatography. The SEC protocol was modified from Pinho et al. Journal of Dairy Research, 79(2)2012.

[0424] The invention described and claimed herein is not limited to the scope of the specific aspects disclosed herein, as these aspects are intended to serve as illustrations of several aspects of the invention. Any equivalent aspects are intended to be within the scope of the invention. In fact, various modifications of the invention, in addition to those shown and described herein, become apparent to those skilled in the art due to the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the event of a conflict, the present disclosure including definitions shall prevail.

[0425] List of Examples

[0426] The present invention is further defined by the following numbered examples:

[0427] [1] A nucleic acid construct comprising:

[0428] a first polynucleotide encoding a signal peptide having at least 80% sequence identity to SEQ ID NO:45, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:47, or SEQ ID NO:49; and

[0429] a) a second polynucleotide encoding an alpha-lactalbumin (ALAB) polypeptide having at least 70% sequence identity to the polypeptide sequence of SEQ ID NO: 6; or

[0430] b) a second polynucleotide encoding a polypeptide having phytase activity;

[0431] The first polynucleotide and the second polynucleotide are operably linked in a translational fusion manner.

[0432] [2] The nucleic acid construct according to embodiment 1, wherein the second polynucleotide is located downstream of the first polynucleotide.

[0433] [3] The nucleic acid construct according to any one of Embodiments 1 or 2, wherein the signal peptide is a naturally occurring signal peptide, or a functional fragment or functional variant of a naturally occurring signal peptide.

[0434] [4] The nucleic acid construct according to any one of embodiments 1 to 3, wherein the signal peptide is derived from a filamentous fungal glycosidase.

[0435] [4a] According to any one of embodiments 1 to 4, the nucleic acid construct further comprises a third polynucleotide downstream of the first polynucleotide and upstream of the second polynucleotide.

[0436] [4b] The nucleic acid construct according to any preceding embodiment, wherein the third polynucleotide is a non-coding intron.

[0437] [4c] A nucleic acid construct according to any of the preceding embodiments, wherein the third polynucleotide has at least 80%, for example at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO:17 (gtaagtaacatccactctgttctagtgccatgctgagattgtacag).

[0438] [4d] A nucleic acid construct according to any of the preceding embodiments, comprising a polynucleotide sequence having at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 18 or SEQ ID NO: 19.

[0439] [5] The nucleic acid construct according to any preceding embodiment, wherein the nucleic acid construct further comprises a heterologous promoter, and wherein the promoter, the first polynucleotide, the second polynucleotide and optionally the third polynucleotide are operably linked.

[0440] [6] A nucleic acid construct according to any of the preceding embodiments, wherein the promoter is a P3 promoter or a P3-based promoter, preferably the heterologous promoter is a tandem promoter comprising the P3 promoter, or a tandem promoter derived from the P3 promoter.

[0441] [7] A nucleic acid construct according to any of the preceding embodiments, wherein the promoter is operably linked to an mRNA stabilizer region; preferably, the mRNA stabilizer region is a cryIIIAm RNA stabilizer region.

[0442] [8] The nucleic acid construct according to any one of the preceding embodiments, wherein the signal peptide is a naturally occurring signal peptide, or a functional fragment or functional variant of a naturally occurring signal peptide.

[0443] [9] The nucleic acid construct according to any one of the preceding embodiments, wherein the signal peptide is derived from a glycosidase (EC 3.2.1).

[0444]

[10] The nucleic acid construct according to any one of the preceding embodiments, wherein the signal peptide is obtained from a mannanase polypeptide (EC 3.2.1.78).

[0445]

[11] The nucleic acid construct according to any one of the preceding embodiments, wherein the signal peptide is obtained from a b-transglycosidase polypeptide (EC 2.4.1.-).

[0446]

[12] The nucleic acid construct according to any one of the preceding embodiments, wherein the signal peptide is obtained from a chitin b-1,3 / 1,6-glucanotransferase polypeptide (EC 2.4.1.-) polypeptide.

[0447]

[13] The nucleic acid construct according to any one of the preceding embodiments, wherein the signal peptide is obtained from an endo-b-1,3-glucanase polypeptide or a laminarinase polypeptide (EC 3.2.1.39).

[0448]

[14] The nucleic acid construct according to any one of the preceding embodiments, wherein the signal peptide obtains a polypeptide expressed by a filamentous fungal host cell, such as a mannanase, a transglycosidase, a glycosyltransferase, a laminarinase or a glucanase.

[0449]

[15] The nucleic acid construct according to any one of the preceding embodiments, wherein the signal peptide is obtained to express a polypeptide in a free Aspergillus host cell, such as Aspergillus ryukyuus.

[0450]

[16] A nucleic acid construct according to any of the preceding embodiments, wherein the first polynucleotide encoding the signal peptide has at least 80%, for example at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:44, SEQ ID NO:46 or SEQ ID NO:48; most preferably, the polynucleotide comprises, essentially consists of, or consists of the mature polypeptide coding sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:44, SEQ ID NO:46 or SEQ ID NO:48.

[0451]

[17] A nucleic acid construct according to any of the preceding embodiments, wherein the first polynucleotide encoding the signal peptide has at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:1; most preferably, the polynucleotide comprises, consists essentially of, or consists of the mature polypeptide coding sequence of SEQ ID NO:1.

[0452] [18a] A nucleic acid construct according to any of the preceding embodiments, wherein the first polynucleotide encoding the signal peptide has at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:3; most preferably, the polynucleotide comprises, consists essentially of, or consists of the mature polypeptide coding sequence of SEQ ID NO:3.

[0453] [18b] A nucleic acid construct according to any of the preceding embodiments, wherein the first polynucleotide encoding the signal peptide has at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:44; most preferably, the polynucleotide comprises, consists essentially of, or consists of the mature polypeptide coding sequence of SEQ ID NO:44.

[0454] [18c] A nucleic acid construct according to any of the preceding embodiments, wherein the first polynucleotide encoding the signal peptide has at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:46; most preferably, the polynucleotide comprises, consists essentially of, or consists of the mature polypeptide coding sequence of SEQ ID NO:46.

[0455] [18d] A nucleic acid construct according to any of the preceding embodiments, wherein the first polynucleotide encoding the signal peptide has at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:48; most preferably, the polynucleotide comprises, consists essentially of, or consists of the mature polypeptide coding sequence of SEQ ID NO:48.

[0456]

[19] The nucleic acid construct according to any one of the preceding embodiments, wherein the signal peptide obtains a glycosidase expressed by a species of Aspergillus selected from the group consisting of Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus ryukyuus or Aspergillus oryzae.

[0457]

[20] The nucleic acid construct according to any one of the preceding embodiments, wherein the signal peptide is obtained from a glycosidase expressed by Aspergillus ryukyuus.

[0458]

[21] A nucleic acid construct according to any of the preceding embodiments, wherein the signal peptide has at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO:2.

[0459] [22a] The nucleic acid construct according to any one of the preceding embodiments, wherein the signal peptide comprises, essentially consists of, or consists of SEQ ID NO: 2.

[0460] [22b] A nucleic acid construct according to any of the preceding embodiments, wherein the signal peptide has at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO:45.

[0461] [22c] A nucleic acid construct according to any one of the preceding embodiments, wherein the signal peptide comprises, essentially consists of, or consists of SEQ ID NO:45.

[0462] [22d] A nucleic acid construct according to any of the preceding embodiments, wherein the signal peptide has at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO:47.

[0463] [22e] A nucleic acid construct according to any one of the preceding embodiments, wherein the signal peptide comprises, essentially consists of, or consists of SEQ ID NO:47.

[0464] [22f] A nucleic acid construct according to any of the preceding embodiments, wherein the signal peptide has at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO:49.

[0465] [22g] A nucleic acid construct according to any one of the preceding embodiments, wherein the signal peptide comprises, essentially consists of, or consists of SEQ ID NO:49.

[0466]

[23] A nucleic acid construct according to any of the preceding embodiments, wherein the signal peptide has at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO:4.

[0467]

[24] A nucleic acid construct according to any one of the preceding embodiments, wherein the signal peptide comprises, essentially consists of, or consists of SEQ ID NO:4.

[0468] [24a] A nucleic acid construct according to any of the preceding embodiments, wherein the signal peptide consists of the amino acid sequence of SEQ ID NO:45, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:47 or SEQ ID NO:49 with or without a C-terminal alanine, or a peptide fragment thereof that retains the ability to direct the polypeptide into or through the cell membrane.

[0469]

[25] A nucleic acid construct according to any one of the preceding embodiments, wherein the N- and / or C-terminus of the signal peptide has been extended by adding one or more amino acids.

[0470]

[26] The nucleic acid construct according to any one of embodiments 1 to 25, wherein the signal peptide is a fragment of the signal peptide according to any one of embodiments 1 to 25.

[0471]

[27] The nucleic acid construct of any preceding embodiment, wherein the polynucleotide encoding the α-lactalbumin polypeptide has at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO:5; most preferably, the polynucleotide comprises, consists essentially of, or consists of the mature polypeptide coding sequence of SEQ ID NO:5.

[0472]

[28] The nucleic acid construct according to any one of the preceding embodiments, wherein the α-lactalbumin polypeptide is bovine α-lactalbumin.

[0473]

[29] The nucleic acid construct according to any one of the preceding embodiments, wherein the α-lactalbumin is human α-lactalbumin.

[0474]

[30] The nucleic acid construct of any preceding embodiment, wherein the α-lactalbumin polypeptide has at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide of SEQ ID NO:6.

[0475]

[31] The nucleic acid construct of embodiment 30, wherein the α-lactalbumin polypeptide comprises, consists essentially of, or consists of the mature polypeptide of SEQ ID NO: 6.

[0476]

[32] The nucleic acid construct according to any one of the preceding embodiments, wherein the N- and / or C-terminus of the α-lactalbumin polypeptide has been extended by the addition of one or more amino acids.

[0477]

[33] The nucleic acid construct according to any of the preceding embodiments, wherein the polynucleotide encoding the polypeptide having phytase activity has at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the mature polypeptide coding sequence of SEQ ID NO: 11; most preferably, the polynucleotide comprises, consists essentially of, or consists of the mature polypeptide coding sequence of SEQ ID NO: 11.

[0478]

[34] A nucleic acid construct according to any one of the preceding embodiments, wherein the polypeptide having phytase activity is a bacterial polypeptide or a variant thereof.

[0479]

[35] The nucleic acid construct according to any one of the preceding embodiments, wherein the polypeptide having phytase activity is EC 3.1.3.26.

[0480]

[36] The nucleic acid construct of any preceding embodiment, wherein the polypeptide having phytase activity has at least 80%, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide of SEQ ID NO:12.

[0481]

[37] The nucleic acid construct of embodiment 36, wherein the polypeptide having phytase activity comprises, consists essentially of, or consists of the mature polypeptide of SEQ ID NO: 12.

[0482]

[38] The nucleic acid construct according to any one of the preceding embodiments, wherein the N- and / or C-terminus of the polypeptide having phytase activity has been extended by adding one or more amino acids.

[0483]

[39] The nucleic acid construct according to any one of embodiments 1 to 38, wherein the signal peptide is a fragment of the signal peptide according to any one of embodiments 1 to 38.

[0484]

[40] An expression vector comprising the nucleic acid construct according to any one of Examples 1 to 39.

[0485]

[41] A fungal host cell comprising in its genome:

[0486] a) a nucleic acid construct according to any one of embodiments 1 to 39; and / or

[0487] b) An expression vector according to Example 40.

[0488]

[42] The host cell according to embodiment 41, wherein the fungal host cell is a filamentous fungal host cell, for example, Acremonium, Aspergillus, Brevibacterium, Nicotiana, Ceroplastes, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Ustilagoraceae, Fusarium, Humicola, Pyricularia, Mucor, Myceliophthora, Neotrichia, Neurospora, Paecilomyces, Penicillium, Cells of the genus Lederma, Radius, Ruminochytrium, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Toxoplasma, Trametes or Trichoderma, in particular, Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Aspergillus niger, Psoralea xeroptera, Psora carnegiea, Psora fumigatus, Psora pannohita, Psora annulata, Psora rubrum, Psora rubrum, Pseudomonas aeruginosa, narrow-edged golden spore, horny golden spore, Lukenowens golden spore, fecal golden spore, rent spore, queen's golden spore, tropical golden spore, brown thin golden spore, gray capped cap mushroom, hairy leather cap mushroom, rod-shaped fusarium, cereal fusarium, Kuwei fusarium, broadsword fusarium, gramineous fusarium, gramineous fusarium, heterospore fusarium, albizzia fusarium, sharp spore fusarium, multi-branched fusarium, pink fusarium, elder fusarium spores, Fusarium sporeans, Fusarium sporeans, Fusarium sulphur, Fusarium sporeans, Fusarium sporeans, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Rhizomucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Pleurotus eryngii, Talaromyces emersonii, Trametes terrestris, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei or Trichoderma viride cells.

[0489]

[43] A host cell according to any one of embodiments 41 to 42, wherein the host cell is an Aspergillus cell.

[0490]

[44] A host cell according to any one of embodiments 41 to 43, wherein the host cell is an Aspergillus niger or Aspergillus oryzae host cell.

[0491]

[45] A host cell according to any one of embodiments 41 to 44, wherein the host cell contains at least two copies of the nucleic acid construct and / or the expression vector, such as two copies, three copies, four copies or more than four copies.

[0492]

[46] A method for producing alpha-lactalbumin (ALAB) polypeptide, the method comprising:

[0493] a) culturing the host cell of any one of embodiments 41 to 45 under conditions conducive for production of the ALAB polypeptide; and optionally

[0494] b) recovering the ALAB polypeptide.

[0495]

[47] A method for producing a polypeptide having phytase activity, the method comprising:

[0496] a) cultivating the host cell according to any one of embodiments 41 to 45 under conditions conducive for production of the polypeptide having phytase activity; and optionally

[0497] b) recovering the polypeptide having phytase activity.

[0498]

[48] ​​A fusion polypeptide comprising

[0499] a) a signal peptide having at least 60% sequence identity to SEQ ID NO:45, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:47 or SEQ ID NO:49; and

[0500] b) an alpha-lactalbumin polypeptide having at least 60% sequence identity to SEQ ID NO: 6, or a polypeptide having phytase activity having at least 60% sequence identity to SEQ ID NO: 8.

[0501]

[49] The fusion polypeptide according to embodiment 48, wherein the signal peptide is located upstream of the α-lactalbumin polypeptide or upstream of the polypeptide having phytase activity.

[0502]

[50] The fusion polypeptide according to any one of embodiments 48 to 49, wherein the signal peptide is located at the N-terminus of the α-lactalbumin polypeptide or the N-terminus of the polypeptide having phytase activity.

[0503]

[51] The fusion polypeptide according to any one of embodiments 48 to 50, wherein the α-lactalbumin polypeptide is selected from the group consisting of:

[0504] (a) a polypeptide having at least 60% sequence identity to SEQ ID NO: 8;

[0505] (b) a polypeptide having at least 60% sequence identity to SEQ ID NO: 10;

[0506] (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO:7 or SEQ ID NO:9;

[0507] (d) a polypeptide derived from SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:18, or SEQ ID NO:19, the mature polypeptide of SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:18, or SEQ ID NO:19, having 1-30 alterations, e.g., substitutions, deletions and / or insertions, e.g., 1, or 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13, or 14, or 15, or 16, or 17, or 18, or 19, or 20, or 21, or 22, or 23, or 24, or 25, or 26, or 27, or 28, or 29, or 30 alterations, particularly substitutions, at one or more positions;

[0508] (e) a polypeptide derived from the polypeptide of (a), (b), (c) or (d), wherein the N- and / or C-terminus has been extended by the addition of one or more amino acids;

[0509] (f) a fragment of the polypeptide of (a), (b), (c), (d) or (e), and

[0510] (g) A fragment of (f), wherein the polypeptide has 1-10 deletions at the N-terminus.

[0511]

[52] The fusion polypeptide according to any one of embodiments 48 to 50, wherein the polypeptide having phytase activity is selected from the group consisting of:

[0512] (a) a polypeptide having at least 60% sequence identity to SEQ ID NO: 14;

[0513] (b) a polypeptide having at least 60% sequence identity to SEQ ID NO: 16;

[0514] (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 13 or SEQ ID NO: 15;

[0515] (d) a polypeptide derived from SEQ ID NO: 14 or SEQ ID NO: 16, the mature polypeptide of SEQ ID NO: 14 or SEQ ID NO: 16, having 1-30 alterations, e.g., substitutions, deletions and / or insertions, e.g., 1, or 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13, or 14, or 15, or 16, or 17, or 18, or 19, or 20, or 21, or 22, or 23, or 24, or 25, or 26, or 27, or 28, or 29, or 30 alterations, particularly substitutions, at one or more positions;

[0516] (e) a polypeptide derived from the polypeptide of (a), (b), (c) or (d), wherein the N- and / or C-terminus has been extended by the addition of one or more amino acids;

[0517] (f) a fragment of the polypeptide of (a), (b), (c), (d) or (e), and

[0518] (g) A fragment of (f), wherein the polypeptide has 1-10 deletions at the N-terminus.

Claims

1. A nucleic acid construct comprising: a first polynucleotide encoding a signal peptide having at least 80% sequence identity to SEQ ID NO:45, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:47, or SEQ ID NO:49; and a second polynucleotide encoding an alpha-lactalbumin (ALAB) polypeptide having at least 70% sequence identity to the polypeptide sequence of SEQ ID NO: 6; The first polynucleotide and the second polynucleotide are operably linked in a translational fusion manner.

2. The nucleic acid construct of claim 1, wherein the signal peptide has at least 85%, such as at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:

45.

3. The nucleic acid construct of claim 1, wherein the signal peptide has at least 85%, such as at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:

2.

4. The nucleic acid construct according to any preceding claim, wherein the signal peptide consists of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 45 with or without a C-terminal alanine, or a peptide fragment thereof that retains the ability to direct a polypeptide into or through a cell membrane.

5. The nucleic acid construct according to any preceding claim, wherein the alpha-lactalbumin polypeptide has at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide of SEQ ID NO:

6. 6 . An expression vector comprising the nucleic acid construct according to claim 1 .

7. A fungal host cell comprising in its genome: a) a nucleic acid construct according to any one of claims 1 to 5; and / or b) The expression vector according to claim 6.

8. A method for producing alpha-lactalbumin (ALAB) polypeptide, the method comprising: a) culturing the host cell according to claim 7 under conditions conducive to production of the ALAB polypeptide; and optionally b) recovering the ALAB polypeptide.

9. A fusion polypeptide comprising: a signal peptide having at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:45, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:47 or SEQ ID NO:49, and An alpha-lactalbumin polypeptide having at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:6.

Images