Genetically engineered bacterium and application thereof in preparation of xylitol by biological method

Abstract

The invention belongs to the technical field of biology, and particularly relates to a genetically engineered bacterium and application of the genetically engineered bacterium in preparation of xylitol through a biological method. According to the invention, several expression control technologies such as theophylline switch, Cre / LoxP and the like are utilized, so that the expression products of the genetically engineered bacteria can be controlled by judging whether theophylline is added or not, the expression products are arabinose-1-dehydrogenase and then xylose reductase, after arabinose is consumed by the arabinose-1-dehydrogenase, xylose is converted into xylitol by utilizing the xylose reductase, and the xylose is converted into xylitol by utilizing the xylose reductase. The generation of byproducts in the process of preparing the xylitol from the hemicellulose hydrolysate is prevented.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to genetic engineering bacteria and application thereof in the biological preparation of xylitol. Background Art

[0002] Xylitol (molecular formula C5H 12 Xylitol (X5) is a sweetener with the same sweetness as sucrose and the same calories as glucose. In 2004, it was rated as one of the 12 most promising biomass-based chemicals by the U.S. Department of Energy. At present, chemical methods are widely used in industry to prepare xylitol. First, pure xylose is separated from hemicellulose hydrolysate through a complex separation process, and then xylose is reduced to xylitol through high-pressure hydrogenation. Due to the relatively complex production process and high cost of chemical production of xylitol, the price of xylitol has remained high for a long time. Compared with chemical methods, biological production of xylitol has some advantages: mild catalytic conditions, safe operation, low energy consumption of equipment, etc. Therefore, it has attracted attention from the industry in recent years and is expected to become an alternative process to chemical methods. The biological method of preparing xylitol can use biological enzymes or microbial cells to directly convert xylose in hemicellulose hydrolysate into xylitol, and then separate it to obtain xylitol products.

[0003] In the existing biological preparation of xylitol, xylose reductase is a key enzyme. Wild-type xylose reductase usually has poor specificity. When hemicellulose hydrolysate is used for biological preparation, xylose reductase catalyzes the reduction of xylose to xylitol, while also reducing arabinose in the hemicellulose hydrolysate to arabitol. The structure and physicochemical properties of arabitol are very similar to those of xylitol, resulting in the byproduct arabitol affecting the separation and purification of xylitol. In recent years, many studies have improved the specificity of xylose reductase by exploring new xylose reductases and molecular modification of xylose reductases. The research has achieved certain results, but it still cannot completely eliminate the catalytic activity of xylose reductase on arabinose.

[0004] Hemicellulose is a renewable resource with abundant reserves in nature and is widely found in agricultural and forestry wastes (such as corn cobs, sugarcane bagasse, etc.). The xylose in its hydrolyzate is an ideal raw material for microbial fermentation to produce xylitol. However, there is also a certain amount of arabinose in the hemicellulose hydrolyzate. When preparing xylitol, it is difficult to eliminate the by-product arabinol. Summary of the invention

[0005] In view of the problem of by-products in the process of preparing xylitol from hemicellulose hydrolysate in the prior art, the present invention provides genetically engineered bacteria and their application in the biological preparation of xylitol. The specific technical scheme is as follows: In a first aspect, the present invention provides a genetically engineered bacterium, comprising a host cell and a functional gene inserted into the host cell, wherein the functional gene comprises: Cre / LoxP system, theophylline switch gene, and target gene expression element; The target gene expression element includes a promoter, a xylose reductase gene and an arabinose-1-dehydrogenase gene; the promoter has the ability to initiate transcription of the arabinose-1-dehydrogenase gene and the xylose reductase gene; the arabinose-1-dehydrogenase gene is connected to the downstream of the promoter; the xylose reductase gene is connected to the upstream of the promoter and the start codon end is close to the promoter; The Cre / LoxP The system has the function of flipping the sequence to be edited; the sequence to be edited is the promoter in the target gene expression element; the theophylline switch gene is induced by theophylline to regulate the expression of the Cre recombinase gene.

[0006] The present application provides a genetically engineered bacterium that can catalyze a substrate containing arabinose and xylose to produce xylitol without producing arabitol. In the genetically engineered bacterium, the expression of a xylose reductase (XR) gene and an arabinose-1-dehydrogenase (araDH) gene is regulated by the same promoter, the arabinose-1-dehydrogenase gene is connected to the downstream of the promoter, and the xylose reductase gene is connected to the upstream of the promoter with the start codon end close to the promoter. By flipping the promoter on the genome, the promoter can achieve expression regulation of the two enzyme genes.

[0007] This application uses Cre / LoxP The system achieves promoter flipping in Cre / LoxP In this system, Cre recombinase can be used with LoxP Site-specific binding to achieve LoxP Flipping of the sequence to be edited between sites. In the present application, the sequence to be edited is a promoter. Before the Cre recombinase flips the promoter gene, the genetically engineered bacteria expresses the arabinose-1-dehydrogenase gene downstream of the promoter. After the Cre recombinase flips the promoter gene, the genetically engineered bacteria expresses the xylose reductase gene upstream of the promoter.

[0008] In the present application, in order to control the expression of the two enzyme genes, the expression of the Cre recombinase is selected to be controlled, specifically by adding a theophylline switch gene to the Cre recombinase gene. The theophylline switch is a theophylline-inducible gene switch that can control the expression of the gene inserted into it. Before the addition of theophylline induction, the Cre recombinase gene is not expressed, and the addition of theophylline induction can make the Cre recombinase gene expressed.

[0009] Therefore, in the present application, the genetically engineered bacteria finally constructed have an initial expression product of arabinose-1-dehydrogenase. After being induced by theophylline, the Cre recombinase gene is expressed, and the Cre recombinase is LoxPAfter the site is combined, the promoter is flipped, and the expression product of the genetically engineered bacteria becomes xylose reductase.

[0010] Furthermore, the promoter is P J23119 or P lac .

[0011] Furthermore, the nucleotide sequence of the arabinose-1-dehydrogenase gene is shown in SEQ ID NO.1.

[0012] Furthermore, the nucleotide sequence of the xylose reductase gene is shown in SEQ ID NO.2.

[0013] In the present application, the combination of xylose reductase gene, arabinose-1-dehydrogenase gene and promoter was screened, and two promoters with good regulatory ability for xylose reductase gene and arabinose-1-dehydrogenase gene were obtained: P J23119 or P lac The expressed xylose reductase and arabinose-1-dehydrogenase retained good enzyme activities.

[0014] Furthermore, the Cre / LoxP In the system, the nucleotide sequence of the Cre recombinase gene is shown in SEQ ID NO.7.

[0015] Furthermore, the Cre / LoxP In the system, LoxP The nucleotide sequences of the sites are shown in SEQ ID NO.8 and SEQ ID NO.9.

[0016] In this application, Cre / LoxP The system realizes the flipping of the promoter. Specifically, it needs to form LoxP -Promoter- LoxP The structure of the previous LoxP The nucleotide sequence of the site is shown in SEQ ID NO.8, the latter LoxP The nucleotide sequence of the site is shown in SEQ ID NO.9, so that the Cre recombinase can correctly bind to the two LoxP site binding and the two LoxP Promoter flipping between sites.

[0017] Furthermore, the nucleotide sequence of the theophylline switch gene is one of the sequences shown in SEQ ID NOs. 3 to 6.

[0018] Furthermore, in the genetically engineered bacteria, Int2 and P lacThe above-mentioned theophylline switch and the above-mentioned promoter can be arbitrarily combined to achieve the expression control of the promoter through theophylline induction.

[0019] Furthermore, in the host cell genome, the theophylline switch gene is located downstream of the start codon ATG of the Cre recombinase gene.

[0020] In the present application, the theophylline switch gene is placed downstream of the start codon ATG of the Cre recombinase gene, so that it can achieve strict control over the expression of the Cre recombinase gene.

[0021] Furthermore, the host cell genome is knocked out ptsG Gene.

[0022] In this application, knockout ptsG The gene can slow down the CCR effect of host cells and improve the co-metabolism efficiency of glucose and other sugars in the host cells.

[0023] Furthermore, the Cre / LoxP The system, theophylline switch gene and target gene expression element are expressed in host cells in the form of genome integration or recombinant plasmid.

[0024] Furthermore, the theophylline switch and Cre recombinase are expressed in the host cell in the form of genome integration; LoxP The site and target gene expression elements are expressed in the host cell in the form of a recombinant plasmid.

[0025] Furthermore, the Cre recombinase gene and theophylline switch gene are inserted into the host cell genome nuclease dns Non-coding regions within or between genes.

[0026] Furthermore, the host cell is Vibrio natriuresis or Escherichia coli.

[0027] In a second aspect, the present invention provides a method for preparing xylitol, characterized in that it comprises: (1) using hemicellulose hydrolyzate as a raw material, fermenting and culturing in a fermentation medium inoculated with the above-mentioned genetically engineered bacteria until no arabinose remains in the fermentation liquid; (2) After adding theophylline to the reaction solution, the fermentation culture is continued to obtain a fermentation product containing xylitol.

[0028] In the present application, the above-mentioned genetically engineered bacteria are used to catalyze the production of xylitol from hemicellulose hydrolysate. First, in the absence of theophylline induction, the genetically engineered bacteria express arabinose-1-dehydrogenase to convert arabinose in the hemicellulose hydrolysate into arabinonic acid; after the arabinose conversion is complete, theophylline is added to the reaction solution to induce the activation of theophylline switch, so that the Cre recombinase is successfully expressed. After the Cre recombinase is expressed, it reacts with LoxP Site-specific binding LoxP The promoter between the sites is flipped, so that the genetically engineered bacteria express xylose reductase, which converts xylose in the hemicellulose reaction liquid into xylitol, obtaining a fermentation product containing xylitol and arabinonic acid. After further product separation, pure xylitol is obtained, and no by-product arabinitol is produced in this process.

[0029] Furthermore, the hemicellulose hydrolyzate is obtained by hydrolyzing biomass rich in hemicellulose; the biomass rich in hemicellulose is corn cobs, papermaking short fibers, bagasse, straw or rice husks, etc.; the hemicellulose hydrolyzate contains at least L-arabinose, glucose and xylose.

[0030] Furthermore, in the hemicellulose hydrolysate, the mass ratio of arabinose, glucose and xylose is 2-5:5-10:20-25.

[0031] Furthermore, the amount of theophylline added is 5-10 mM.

[0032] Furthermore, the reaction temperature is 25°C to 35°C.

[0033] Furthermore, based on the initial fermentation volume, the inoculation amount of the genetically engineered bacteria is 1-15%.

[0034] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a genetically engineered bacterium capable of producing xylitol using hemicellulose hydrolyzate as raw material, and utilizing theophylline switch, Cre / LoxP Several expression control technologies, such as the addition of theophylline, allow genetically engineered bacteria to control their expression products to first be arabinose-1-dehydrogenase and then xylose reductase. After arabinose is consumed by arabinose-1-dehydrogenase, xylose reductase is used to convert xylose into xylitol, thereby preventing the production of by-products in the process of preparing xylitol from hemicellulose hydrolysate. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1Schematic diagram of different expression control tools in the genetically engineered bacteria constructed in this application; wherein A is a schematic diagram of the location of theophylline switch gene and Cre recombinase gene in the host cell genome, and B is a schematic diagram of the target gene expression element and Cre recombinase gene in the host cell plasmid before and after theophylline regulation. loxP Schematic diagram of the relative position and orientation of the sites.

[0036] Figure 2 This is a curve diagram of the changes in substrate and product components during the preparation of xylitol by strain S3 using hemicellulose hydrolysate as raw material. DETAILED DESCRIPTION

[0037] In order to make those skilled in the art better understand the scheme of the present invention, the technical scheme of the present invention is clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed descriptions are all exemplary and are only embodiments of a part of the present invention, rather than all embodiments.

[0038] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work should fall within the scope of protection of the present invention.

[0039] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those of ordinary skill in the art to which this application belongs. The experimental materials used in the examples of the present invention are all conventional experimental materials in the art and can be purchased through commercial channels. Experimental methods without specifying detailed conditions were performed according to conventional experimental methods or according to the operating instructions recommended by the supplier.

[0040] Detection of xylitol, glucose, arabinose, arabitol and xylose: HPLC determination, the mobile phase was ultrapure water, Agilent Hi-Plex Ca chromatographic column (7.7 mm × 300 mm), column temperature was 85 ° C; the flow rate was 0.6 mL / min.

[0041] In the following examples, the xylose reductase activity determination method is as follows: the determination is carried out using a 1 mL reaction system, which includes: 100 μL of 1 M xylose mother solution (final concentration 100 mM), 50 μL of 0.4 M NADPH mother solution (final concentration 20 mM), 750 μL of PBS buffer, and 100 μL of cell lysis solution. After preheating the reaction solution and cell lysis solution at 30 °C in a metal bath for 10 minutes, the two are quickly mixed and the absorbance change at 340 nm is monitored by a spectrophotometer. Enzyme activity unit definition: Under standard reaction conditions, 1 μM NADP is generated per minute. +The amount of enzyme required. The formula for calculating the activity of xylose reductase is: enzyme activity (U / mL) = (△A / min) × (1 / ɛ) × (1 / d) × (Vt / Vs) × X, where △A / min represents the change in absorbance per minute; ɛ represents the molar extinction coefficient, which is 6.402 mL / (μmol*cm); d represents the light path of the cuvette, which is 1 cm; Vt represents the total reaction volume, which is 1000 μL; Vs represents the volume of the cell lysate, which is 100 μL; and X represents the dilution multiple.

[0042] In the following examples, the activity of arabinose-1-dehydrogenase was determined as follows: 1 mL of the reaction system included: 100 μL of 1 M L-arabinose stock solution (final concentration 100 mM), 0.4 M NADP + 50 μL of mother solution (final concentration 20 mM), 750 μL of PBS buffer, and 100 μL of cell lysis solution. After preheating the reaction solution and cell lysis solution at 30 °C in a metal bath for 10 minutes, the two were quickly mixed and the absorbance change at 340 nm was monitored by a spectrophotometer. Definition of enzyme activity unit: the amount of enzyme required to generate 1 μM NADPH per minute under standard reaction conditions. AraDH enzyme activity calculation formula: enzyme activity (U / mL) = (△A / min) × (1 / ɛ) × (1 / d) × (Vt / Vs) × X, where △A / min represents the change in absorbance per minute; ɛ represents the molar extinction coefficient, which is 6.402 mL / (μmol*cm); d represents the cuvette light path, which is 1 cm; Vt represents the total reaction volume, which is 1000 μL; Vs represents the volume of cell lysis solution, which is 100 μL; X represents the dilution multiple.

[0043] In the following examples, the working concentration of kanamycin (kan) was 200 μg / mL when culturing Vibrio natrii; and the working concentration of kanamycin (kan) was 50 μg / mL when culturing Escherichia coli.

[0044] In the following examples, a mixed solution containing 20-25 g / L of xylose, 5-10 g / L of glucose, and 2-5 g / L of arabinose was prepared as a hemicellulose hydrolyzate for fermentation.

[0045] In the genetically engineered bacteria constructed in the following examples, the positions of the functional genes are as follows: Figure 1 As shown in A and B.

[0046] The nucleotide sequence of the arabinose-1-dehydrogenase gene is shown in SEQ ID NO.1; the nucleotide sequence of the xylose reductase gene is shown in SEQ ID NO.2; the nucleotide sequence of the theophylline switch gene is shown in SEQ ID NO.3-6; the nucleotide sequence of the Cre recombinase gene is shown in SEQ ID NO.7; LoxP The nucleotide sequences of the sites are shown in SEQ ID NO.8 and SEQ ID NO.9.

[0047] SEQ ID NO.1: ATGAGCGATCAGGTGAGCCTGGGCGTTGTTGGTATTGGTAAAATTGCACGTGATCAGCATCTGCCGGCCATTGATGCAGAACCGGGTTTTAAACTGACCGCATGTGCAAGCCGTCATGCAGAAGTGACCGGTGTTCGTAATTATCGTGATCTGCGTGCCCTGCTGGCAGCCGAGCGTGAGCTGGACGCAGTGAGCTTATGTGCACCGCCGCAGGTGCGTTATGCACAGGCAAGAGCCGCACTGGAAGCAGGTAAACATGTGATGCTGGAAAAACCGCCGGGCGCAACCCTGGGTGAAGTTGCAGTTCTGGAAGCCCTGGCACGCGAACGTGGTTTAACCCTGTTTGCCACCTGGCATAGCCGTTGCGCCAGTGCAGTGGAACCGGCAAGAGAATGGCTGGCCACCCGTGCAATTCGTGCCGTTCAGGTTCGCTGGAAAGAAGATGTGCGCCGTTGGCATCCGGGCCAACAATGGATTTGGGAACCGGGCGGCCTGGGTGTTTTTGATCCGGGTATTAATGCCCTGAGTATTGTTACCCGTATTCTGCCGCGCGAACTGGTTCTGCGTGAAGCTACCCTGATTGTGCCGAGCGATGTTCAGACCCCGATTGCCGCAGAACTGGATTGTGCAGATACCGATGGTGTTCCGGTTCGCGCAGAATTTGATTGGCGTCATGGCCCGGTTGAACAGTGGGAAATTGCCGTGGATACCGCAGATGGCGTTCTGGCAATTAGCCGCGGTGGCGCACAGTTAAGCATTGCAGGTGAACCGGTGGAACTGGGTCCGGAACGTGAATATCCGGCCCTGTATGCCCATTTTCATGCACTGATTGCACGCGGTGAAAGTGATGTGGATGTTCGTCCGCTGCGTCTGGTGGCAGATGCTTTTCTGTTTGGTCGTCGCGTTCAGACCGATGCCTTTGGTCGT SEQ ID NO.2: atgagtcagcaaataccctcagtaaaactaagcaacggcgtcgaattcccgttgcttggtttcggcacctggcagagcgcaccgggtgaggtgggtaaggccgtcgaggtggctctgaaggctggttatcgtcacctggatctggcaaaagtttatggtaaccaaaaggagatcgctccggcgatcgcgaactccggtgtggaccgcaaagatattttcatcaccagtaaactgtggaattcgcaacacaagccggaattggttgaagctgcgctggacgacaccctgaaggagctgggcctggaatacctggacttgtacctgattcattggcctgttgcgtttccagccgaaggtgacccgcatagcaacctgtttccgaaagagaacggtgagtgcaaaattgatacctccgtatctatcgtggacacgtggaaagccatgattaagttgctggatactggcaagaccaaagcggttggcgtgtctaacttcagcccggcaatggtggacgccatcaccgaagccaccggtgtgaagccggttgttaatcaaattgaacgtcacccacgtctgctgcaaaaggacttgattaaacaccacaaagagaaaaatattgtggtcacggcatatagcggcttcggcaacaactccgttggcgagccgctcttgttggagcacccgactgtaaagaaaatcgcggaagcgaagggcgcgaatccgggtcaggtcctgatcgcgtggggtatgcatggtggtcatgcaatcattccgaaaagcgttaccccttctcgcattgaaagcaatttcaaagtgattagcctgaccgatgatgaagtggcggaaatcaacaaaatcggcgaggagaaaccggcgcgttttaatcttccgatcctgtactcaccgctgtggccgattaacgtttttgatacgccggaagagcagaaggcgaagtaccaggttaagatccagtaagcggccgc SEQ ID NO.3: TCCtcaGGTTAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATTCCCGTGCTAAATTGATACCAGCATCGTCTTGATGCCCTTGGCAGCATAAATGCCTAACGACTA TCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAATGCTA SEQ ID NO.4: TCCtcgGGTTAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATTCCCGTGCTAAATTGATACCAGCATCGTCTTGATGCCCTTGGCAGCATAAATGCCTAACGACTA TCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAATGCTA SEQ ID NO.5: TCCttgGGTTAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATTCCCGTGCTAAATTGATACCAGCATCGTCTTGATGCCCTTGGCAGCATAAATGCCTAACGACTA TCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAATGCTA SEQ ID NO.6: TCCtctGGTTAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATTCCCGTGCTAAATTGATACCAGCATCGTCTTGATGCCCTTGGCAGCATAAATGCCTAACGACTA TCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAATGCTA SEQ ID NO.7: SEQ ID NO.8: ATAACTTCGTATAGCATACATTATACGAAGTTAT SEQ ID NO.9: ATAACTTCGTATAATGTATGCTATACGAAGTTAT.

[0048] Example 1 Vibrio natriuresis dns Site-integrated Cre recombinase containing theophylline switch Cre recombinase was integrated into the genome of Vibrio natrii using the NT-CRISPR method published in the literature (DOI: 10.1038 / s42003-022-03150-0). dns The plasmid pNT-CRISPR-dns was constructed by electroporation. ptsG The gene of Vibrio natriuresis ATCC△ptsG was expressed and the strain ATCC△ptsG / pNT-CRISPR-dns was obtained.

[0049] pSIBR001-Cre (Addgene219437), pSIBR002-Cre (Addgene219438), pSIBR003-Cre (Addgene219439), and pSIBR004-Cre (Addgene219435) (Biotechnol Bioeng. 2024 Mar;121(3):1163-1172. doi: 10.1002 / bit.28639) are plasmids already available in our laboratory, carrying four theophylline switches and Cre genes. Specific primers were designed to PCR amplify the Cre gene fragments containing theophylline switches: int1-Cre fragment, int2-Cre fragment, int3-Cre fragment, and int4-Cre fragment. Specific primers were designed to amplify the Cre gene fragments of Vibrio natriuresis. dns A 1kb homology arm was added upstream and downstream of the site to construct the repair templates: dnsaLR- int1-Cre fragment, dnsaLR- int2-Cre fragment, dnsaLR- int3-Cre fragment, and dnsaLR- int4-Cre fragment.

[0050] Using the natural transformation method, the repair template fragments were introduced into the strain ATCC△ptsG / pNT-CRISPR-dns and integrated into the genome dnsCorresponding sites were used to construct four strains of Vibrio natriuresis whose genomes were integrated with theophylline switch and Cre recombinase expression cassettes: ATCC△ptsG△dns::(int1-Cre), ATCC△ptsG△dns::(int2-Cre), ATCC△ptsG△dns::(int3-Cre), and ATCC△ptsG△dns::(int4-Cre).

[0051] Example 2 Integration of Cre recombinase containing theophylline switch into the intergenic noncoding region of Escherichia coli The Cre recombinase was integrated into the genome of Escherichia coli using the CRISPR-Cas9 method published in the literature (DOI: 10.1093 / abbs / gmab036). The sgRNA sequence targeting the intergenic non-coding region of the E. coli genome was designed to construct the plasmid pTargetF-Cre. Four repair template sequences for Cre recombinase integration, aLR-int1-Cre, aLR-int2-Cre, aLR-int3-Cre, and aLR-int4-Cre, were constructed based on the 500bp sequence upstream and downstream of the insertion site. The Cas9 expression plasmid pCas, pTargetF-Cre, and the four repair templates were electroporated into the knockout ptsG The gene was expressed in Escherichia coli W3110△ptsG, and strains W3110△ptsG::int1-Cre, W3110△ptsG::int2-Cre, W3110△ptsG::int3-Cre and W3110△ptsG::int4-Cre were constructed.

[0052] Example 3 Construction of expression plasmids for xylose reductase XR and arabinose dehydrogenase araDH The present invention selects constitutive promoter P lac , P tac , P J23119 , construct different XR and araDH expression plasmids. Using the p18-kan plasmid as the backbone, specific primers were designed to amplify the XR gene and araDH gene respectively, and then the Cre recombinase-specific recognition site was obtained by gene synthesis. LoxP -Promoter- LoxP Fragments, two of which of LoxP The direction is opposite to that of the promoter, so as to achieve the purpose of using Cre recombinase to flip the promoter sequence. LoxP -Promoter- LoxP The snippet is: LoxP -P lac - LoxP , LoxP -P tac - LoxP , LoxP -PJ23119 - LoxP . The plasmid backbone, XR gene fragment, araDH gene fragment, LoxP -Promoter- LoxP The gene fragments were recombined and plasmids were constructed to obtain three plasmids: p18-kan-P lac -araDH-XR、p18-kan-P tac -araDH-XR、p18-kan-P J23119 The three plasmids were electroporated into the four genetically engineered Vibrio natrii constructed in Example 1, and a total of 12 genetically engineered bacteria were obtained: ATCC△ptsG△dns::(int1-Cre) / p18-kan-P lac -araDH-XR,ATCC△ptsG△dns::(int1-Cre) / p18-kan-P tac -araDH-XR,ATCC△ptsG△dns::(int1-Cre) / p18-kan-P J23119 -araDH-XR,ATCC△ptsG△dns::(int2-Cre) / p18-kan-P lac -araDH-XR,ATCC△ptsG△dns::(int2-Cre) / p18-kan-P tac -araDH-XR,ATCC△ptsG△dns::(int2-Cre) / p18-kan-P J23119 -araDH-XR,ATCC△ptsG△dns::(int3-Cre) / p18-kan-P lac -araDH-XR,ATCC△ptsG△dns::(int3-Cre) / p18-kan-P tac -araDH-XR,ATCC△ptsG△dns::(int3-Cre) / p18-kan-P J23119 -araDH-XR,ATCC△ptsG△dns::(int4-Cre) / p18-kan-P lac -araDH-XR,ATCC△ptsG△dns::(int4-Cre) / p18-kan-P tac -araDH-XR,ATCC△ptsG△dns::(int4-Cre) / p18-kan-P J23119-araDH-XR, named strains S1, S2, S3, S4, S5, S6, S7, S8, S9, S10, S11 and S12 respectively. The three plasmids were respectively electrotransfected into the four genetically engineered Escherichia coli bacteria constructed in Example 2, and a total of 12 genetically engineered bacteria were obtained: W3110△ptsG::(int1-Cre) / p18-kan-P lac -araDH-XR, W3110△ptsG::(int1-Cre) / p18-kan-P tac -araDH-XR、W3110△ptsG::(int1-Cre) / p18-kan-P J23119 -araDH-XR、W3110△ptsG::(int2-Cre) / p18-kan-P lac -araDH-XR, W3110△ptsG::(int2-Cre) / p18-kan-P tac -araDH-XR、W3110△ptsG::(int2-Cre) / p18-kan-P J23119 -araDH-XR、W3110△ptsG::(int3-Cre) / p18-kan-P lac -araDH-XR, W3110△ptsG::(int3-Cre) / p18-kan-P tac -araDH-XR、W3110△ptsG::(int3-Cre) / p18-kan-P J23119 -araDH-XR、W3110△ptsG::(int4-Cre) / p18-kan-P lac -araDH-XR, W3110△ptsG::(int4-Cre) / p18-kan-P tac -araDH-XR、W3110△ptsG::(int4-Cre) / p18-kan-P J23119 -araDH-XR, and were designated as strains E1, E2, E3, E4, E5, E6, E7, E8, E9, E10, E11, and E12, respectively.

[0053] Example 4 Xylitol strain shake flask fermentation The Vibrio natrii strains S1 to S12 were streaked on LB-kan solid plates, and single clones were inoculated into 5 mL LB-kan test tubes, and cultured at 30°C and 200 rpm for 4 to 6 hours. Xylitol shake flask fermentation medium was prepared: yeast powder 5 g / L, Na2HPO4 6 g / L, KH2PO4 5.31 g / L, NH4Cl 1 g / L, NaCl 10 g / L, MgSO4 0.1 g / L, CaCl2 0.1 g / L. Genetically engineered bacteria were inoculated into the fermentation medium at a ratio of 2%, and cultured at 30°C and 200 rpm for 2 hours, and then xylose, 10 g / L glucose and 2.3 g / L arabinose were added at a final concentration of 20 g / L, and cultured at 30°C and 200 rpm for another 2 hours. At the same time, 1 mL of the fermentation broth was taken to determine the araDH enzyme activity and XR enzyme activity. Then, theophylline was added at a final concentration of 6 mM, and the mixture was cultured for another 10 h at 30°C and 200 rpm, and the araDH and XR enzyme activities were determined. After the fermentation, the contents of xylose, xylitol, arabinose, and arabitol were determined by HPLC.

[0054] Escherichia coli strains E1 to E12 were streaked on LB-kan solid plates, and single clones were inoculated into 5 mL LB-kan test tubes and cultured at 37°C and 200 rpm for 6 to 8 hours. Xylitol shake flask fermentation medium was prepared: yeast powder 5 g / L, Na2HPO4 6 g / L, KH2PO4 5.31 g / L, NH4Cl 1 g / L, MgSO4 0.1 g / L, CaCl2 0.1 g / L. Genetically engineered bacteria were inoculated into the fermentation medium at a ratio of 2%, cultured at 37°C and 200 rpm for 2 hours, and then xylose, 10 g / L glucose and 2.3 g / L arabinose were added at a final concentration of 20 g / L, and cultured at 30°C and 200 rpm for another 2 hours. At the same time, 1 mL of the fermentation liquid was taken to determine the araDH enzyme activity and XR enzyme activity. Then, theophylline was added at a final concentration of 6 mM, and the culture was shaken at 30°C and 200 rpm for another 10 hours to determine the araDH and XR enzyme activities. After the fermentation, the contents of xylose, xylitol, arabinose, and arabitol were detected by HPLC.

[0055] The results of AraDH and XR enzyme activities of different strains are shown in Table 1. It can be seen from Table 1 that in Escherichia coli and Vibrio natrii, the four theophylline switches all effectively switch the direction of the promoter. Before theophylline induction, araDH is expressed and XR is not expressed; after theophylline induction, araDH is not expressed and XR is expressed. Due to the use of three constitutive promoters of different strengths, the activities of araDH and XR are different, but in the two host cells, the enzyme activities are: P J23119 >P lac >Ptac .

[0056] After the fermentation, the liquid phase detection results are shown in Table 2. tac The promoter expressed low activity of araDH and XR in both host cells. Before theophylline induction, arabinose was not completely converted into arabinonic acid or metabolized by itself, resulting in a small amount of arabitol being produced after theophylline was added. J23119 and P lac The promoter strains did not produce arabinitol, and xylose could be completely converted.

[0057] Table 1 Results of araDH and XR enzyme activities

[0058] Table 2 Liquid phase results after shake flask fermentation

[0059] Example 5 Shake flask fermentation of theophylline switch strain to produce xylitol According to the experimental results of Example 3, strain S3 was used as an example to perform shake flask fermentation and monitor the changes in metabolites during the process. Specific steps: Streak S1 on an LB-kan plate to separate single bacteria, pick a single clone and inoculate it in a 5 mL LB-kan test tube, and culture it in a shaker at 30°C and 200rpm for 5 hours. Prepare xylitol shake flask fermentation medium: yeast powder 5 g / L, Na2HPO4 6 g / L, KH2PO4 5.31 g / L, NH4Cl 1 g / L, NaCl 10 g / L, MgSO4 0.1 g / L, CaCl2 0.1 g / L. The genetically engineered bacteria were inoculated into the fermentation medium at a ratio of 2%, and the medium was cultured at 30°C and 200 rpm for 2 hours. Then, xylose with a final concentration of 20 g / L, glucose with a final concentration of 10 g / L, and arabinose with a final concentration of 2.3 g / L were added. After the medium was cultured at 30°C and 200 rpm for another 2 hours, theophylline with a final concentration of 6 mM was added. The medium was cultured at 30°C and 200 rpm for another 10 hours. Samples were taken at regular intervals to detect the contents of xylose, xylitol, arabinose, and arabitol by HPLC. The fermentation results are shown in Figure 2. Figure 2 As shown, at the 3rd hour of fermentation, arabinose had been completely consumed, and at the 10th hour of fermentation, xylose was completely converted into xylitol.

Claims

1. A genetically engineered bacterium, comprising a host cell and a functional gene inserted into the host cell, characterized in that: The functional genes include: Cre / LoxP system, theophylline switch gene, and target gene expression element; The target gene expression element includes a promoter, a xylose reductase gene and an arabinose-1-dehydrogenase gene; the promoter has the ability to initiate transcription of the arabinose-1-dehydrogenase gene and the xylose reductase gene; the arabinose-1-dehydrogenase gene is connected to the downstream of the promoter; the xylose reductase gene is connected to the upstream of the promoter and the start codon end is close to the promoter; The Cre / LoxP The system has the function of flipping the sequence to be edited; the sequence to be edited is the promoter in the target gene expression element; the theophylline switch gene is induced by theophylline to regulate the expression of the Cre recombinase gene.

2. The genetically engineered bacterium according to claim 1, characterized in that: The promoter is P J23119 or P lac .

3. The genetically engineered bacterium according to claim 1, characterized in that: The nucleotide sequence of the arabinose-1-dehydrogenase gene is shown in SEQ ID NO.

1.

4. The genetically engineered bacterium according to claim 1, characterized in that The nucleotide sequence of the xylose reductase gene is shown in SEQ ID NO.

2.

5. The genetically engineered bacterium according to claim 1, characterized in that: The Cre / LoxP In the system, the nucleotide sequence of the Cre recombinase gene is shown in SEQ ID NO.

7.

6. The genetically engineered bacterium according to any one of claims 1 or 5, characterized in that The Cre / LoxP In the system, LoxP The nucleotide sequences of the sites are shown in SEQ ID NO.8 and SEQ ID NO.

9.

7. The genetically engineered bacterium according to claim 1, characterized in that The nucleotide sequence of the theophylline switch gene is one of the sequences shown in SEQ ID NOs. 3 to 6.

8. The genetically engineered bacterium according to any one of claims 1 or 7, characterized in that: In the host cell genome, the theophylline switch gene is located downstream of the start codon ATG of the Cre recombinase gene.

9. The genetically engineered bacterium according to claim 1, characterized in that: knockout in the host cell genome ptsG Gene.

10. The genetically engineered bacterium according to claim 6, characterized in that: Cre / LoxP The system, theophylline switch gene and target gene expression element are expressed in host cells in the form of genome integration or recombinant plasmid.

11. The genetically engineered bacterium according to claim 10, characterized in that: The theophylline switch and Cre recombinase are expressed in the host cell in the form of genome integration; LoxP The site and target gene expression elements are expressed in the host cell in the form of a recombinant plasmid.

12. The genetically engineered bacterium according to claim 11, characterized in that: The theophylline switch and Cre recombinase are inserted into the host cell genome nuclease DNS Non-coding regions within or between genes.

13. The genetically engineered bacterium according to claim 1, characterized in that: The host cell is Vibrio natriuresis or Escherichia coli.

14. A method for preparing xylitol, characterized in that: include: (1) using hemicellulose hydrolyzate as a raw material, and fermenting in a fermentation medium inoculated with the genetically engineered bacteria as claimed in claim 1, until no arabinose remains in the fermentation liquid; (2) After adding theophylline to the reaction solution, the fermentation culture is continued to obtain a fermentation product containing xylitol.

15. The method according to claim 14, characterized in that The amount of theophylline added is 5-10 mM.

16. The method according to claim 14, characterized in that The reaction temperature is 25℃~35℃.

17. The method according to claim 14, characterized in that The inoculation amount of the genetically engineered bacteria is 1-15% based on the initial fermentation volume.

Images