WB guarantee type monoclonal antibody for SKIV-TJ-MCP gene of sparus punctatus iridovirus and preparation method of WB guarantee type monoclonal antibody

Abstract

The invention discloses a SKIV-TJ-MCP gene WB guarantee type monoclonal antibody of a SKIV iridovirus and a preparation method of the SKIV-TJ-MCP gene WB guarantee type monoclonal antibody. The monoclonal antibody is generated by a hybridoma cell strain SKIV-MCP-4A9 3D11, and the preservation number of the hybridoma cell strain SKIV-MCP-4A9 3D11 is GDMCCNO: 64608. The invention further discloses a preparation method of the monoclonal antibody. The successful preparation of the monoclonal antibody of the oplegnathus punctatus iridovirus MCP lays a foundation for the establishment of an immunological detection method of the oplegnathus punctatus iridovirus and the research on the pathogenesis of virus infection, and can also be used for quantitative and positioning analysis of the oplegnathus punctatus iridovirus MCP in vivo and in vitro.

Description

Technical Field

[0001] The invention belongs to the cross-technical field of immunology and virology, and specifically relates to a WB-guaranteed monoclonal antibody of the SKIV-TJ-MCP gene of a grouper iridovirus and a preparation method thereof. Background Art

[0002] Spotted Knifejaw Iridovirus (SKIV) is a pathogen that poses a serious threat to the marine aquaculture industry. It belongs to the Iridoviridae family and mainly infects fish, including important economic aquatic species such as spotted knifejaw. This virus can cause illness and mass mortality in fish, causing huge economic losses to the aquaculture industry. Therefore, the development of effective detection and prevention and control methods is crucial to reducing the impact of this virus on the aquaculture industry. At present, the detection method of SKIV mainly relies on PCR technology, but this method has problems such as easy contamination, high false positive rate, high equipment cost and inconvenient operation.

[0003] In order to overcome the shortcomings of existing detection methods, it is urgent to develop a rapid, accurate, highly specific and low-cost detection method. Monoclonal antibodies are considered to be an ideal detection tool due to their high specificity and sensitivity. However, the preparation process of monoclonal antibodies is complicated, the cycle is long, and there is a risk of preparation failure. Therefore, it is of great significance to develop a monoclonal antibody preparation method that can guarantee the quality of monoclonal antibodies, especially the positive results in Western Blot (WB) detection, to improve the detection efficiency and accuracy.

[0004] In the prior art, researchers have constructed prokaryotic expression vectors to express the major capsid protein (MCP) of SKIV, and used the recombinant protein to immunize animals to prepare polyclonal antibodies. These antibodies have shown good specificity and sensitivity in the detection of SKIV. However, polyclonal antibodies may have limitations in certain applications due to their molecular diversity. In contrast, monoclonal antibodies provide higher consistency and repeatability, which is crucial to ensure the reliability of test results. Summary of the invention

[0005] In view of this, the present invention aims to provide a WB-guaranteed monoclonal antibody against the SKIV-TJ-MCP gene of the iridovirus of grouper sea bream and a preparation method thereof, in order to improve the accuracy and efficiency of the detection of the iridovirus of grouper sea bream, help promote the development of disease prevention and control technology of grouper sea bream, and provide technical support for the sustainable development of the grouper sea bream farming industry.

[0006] The first object of the present invention is to provide a hybridoma cell line SKIV-MCP-4A9 3D11 capable of producing WB-guaranteed monoclonal antibodies to the SKIV-TJ-MCP gene of the spotted sea bream iridovirus, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center (GDMCC) on May 11, 2024, address: Building 59, No. 100 Xianlie Middle Road, Guangzhou, Postal Code: 510070, and the deposit number is: GDMCCNo: 64608.

[0007] The second object of the present invention is to provide a WB-guaranteed monoclonal antibody against the SKIV-TJ-MCP gene of the spotted sea bream iridovirus, which is produced by the hybridoma cell line SKIV-MCP-4A9 3D11.

[0008] The third object of the present invention is to provide the use of hybridoma cell line SKIV-MCP-4A9 3D11 in producing WB-guaranteed monoclonal antibodies against the SKIV-TJ-MCP gene of rockfish iridovirus.

[0009] The fourth object of the present invention is to provide the use of the WB guaranteed monoclonal antibody of the SKIV-TJ-MCP gene of the rockfish iridovirus in the preparation of a product for detecting the rockfish iridovirus.

[0010] Preferably, a WB-guaranteed monoclonal antibody against the SKIV-TJ-MCP gene of the rockfish iridovirus is provided for use in the preparation of a product for detecting the MCP protein antigen of the rockfish iridovirus.

[0011] Preferably, the product is selected from any one of a reagent or a kit.

[0012] Preferably, the kit is selected from any one of a colloidal gold immunoassay kit, a chemiluminescence kit, a radioimmunoassay kit, an enzyme-linked immunosorbent assay kit or a fluorescent immunoassay kit.

[0013] The fifth object of the present invention is to provide a product for detecting the iridovirus of rockfish, which comprises the WB guaranteed monoclonal antibody against the SKIV-TJ-MCP gene of the iridovirus of rockfish.

[0014] The sixth object of the present invention is to provide a method for detecting the iridovirus of spotted sea bream, using the WB-guaranteed monoclonal antibody of the SKIV-TJ-MCP gene of spotted sea bream iridovirus, or the product for detecting the iridovirus of spotted sea bream, to detect the sample to be tested.

[0015] The seventh objective of the present invention is to provide the use of the WB-guaranteed monoclonal antibody against the SKIV-TJ-MCP gene of the rockfish iridovirus or a product for detecting the rockfish iridovirus in detecting the rockfish iridovirus.

[0016] The present invention uses purified recombinant MCP protein of iridovirus of rock bream as an antigen, immunizes BALB / c mice, generates fused hybridoma cells through cell fusion, and obtains hybridoma cell lines (4A9 3D11) that stably secrete SKIV-TJ-MCP gene WB-guaranteed monoclonal antibodies of iridovirus of rock bream through indirect enzyme-linked immunosorbent assay (ELISA) screening. The results of immunoblotting show that the monoclonal antibody 4A9 3D11 of the present invention has good specificity and can specifically recognize the prokaryotic expression product of iridovirus of rock bream and the viral MCP in infected cells. The successful preparation of the WB-guaranteed monoclonal antibody of SKIV-TJ-MCP gene in the present invention lays a foundation for the establishment of immunological detection methods of iridovirus of rock bream, antiviral immune preparations, and the study of the pathogenic mechanism of viral infection.

[0017] The hybridoma cell line SKIV-MCP-4A9 3D11 was deposited in the Guangdong Microbiological Culture Collection Center (GDMCC) on May 11, 2024, address: Building 59, No. 100 Xianlie Middle Road, Guangzhou, Postal Code: 510070, and the deposit number is: GDMCCNo: 64608. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The figure is the SDS-PAGE electrophoresis diagram of the purified recombinant MCP protein of the iridovirus of the rockfish, wherein M is the protein molecular weight standard (Marker), and 1 is the purified recombinant MCP protein of the iridovirus of the rockfish.

[0019] Figure 2 The results of immunoblotting of the culture supernatant of hybridoma cells 4A9 3D11 are shown.

[0020] Figure 3 The purified monoclonal antibody was identified by SDS-PAGE, where M is a protein molecular weight standard (Marker), and 1 is a monoclonal antibody purified from ascites prepared by hybridoma cell 4A9 3D11.

[0021] Figure 4 The figure is an immunoblot analysis of the purified monoclonal antibody against the MCP protein of virus-infected cells. Among them, M is the protein molecular weight standard (Marker), 1 is the SKIV-infected cells as the detection antigen, and the antibody prepared by the hybridoma cell 4A9 3D11 is the primary antibody.

[0022] Figure 5It is the specific detection of the virus by purified monoclonal antibodies. Among them, SKIV is the iridovirus of rockfish, ISKNV is the infectious spleen and kidney necrosis virus of mandarin fish, SGIV is the iridovirus of Singapore grouper, RGNNV is the neural necrosis virus, OSGIV is the iridovirus of grouper, LMBV is the iridovirus of California sea bass, and control is the cell sample not infected with the virus. DETAILED DESCRIPTION

[0023] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention. Specific experimental conditions and methods are not specified in the following examples, and the technical means used are generally conventional means known to those skilled in the art.

[0024] Example 1: Construction of prokaryotic expression recombinant plasmid of rockfish iridovirus MCP and protein expression

[0025] (1) The sequence of the open reading frame of the MCP gene of the rockfish iridovirus (as shown in SEQ ID NO.1) was cloned into the prokaryotic expression vector pET-28a by restriction endonucleases BamHI and XhoI to construct a recombinant expression vector pET-28a-SKIV-MCP; the recombinant plasmid pET-28a-SKIV-MCP was transformed into Escherichia coli BL21 competent cells, positive bacteria were screened by colony PCR, and sequencing was performed for verification.

[0026] >SEQ ID NO.1

[0027] ATGTCTGCAATCTCAGGTGCGAACGTAACCAGTGGGTTCATCGACATCTCCGCGTTTGA

[0028] TGCGATGGAGACCCACTTGTATGGCGGCGACAATGCCGTGACCTACTTTGCCCGTGAG

[0029] ACCGTGCGTAGTTCCTGGTACAGCAAGCTGCCCGTCACCCTATCAAAACAGACTGGCC

[0030] ATGCTAATTTCGGCCAGGAGTTTAGTGTGACTGTGGCAAGGGGTGGCGACTACCTCAT

[0031] TAATGTGTGGCTGCGTGTTAAGATCCCCTCCATCACGTCCAGCAAGGAGAACAGCTAC

[0032] ATTCGCTGGTGTGATAATTTGATGCACAATCTAGTTGAGGAGGTGTCGGTGTCATTTAA

[0033] CGACCTGGTGGCACAGACCCTGACCAGCGAGTTCCTTGACTTTTGGAACGCCTGCATG

[0034] ATGCCTGGCAGCAAACAATCTGGCTACAACAAGATGATTGGCATGCGCAGCGACCTGG

[0035] TGGGCGGTATCACCAACGGTCAGACTATGCCCGCCGCCTACCTTAATTTGCCCATTCCC

[0036] CTATTCTTTACCCGTGACACAGGCCTTGCATTGCCTACTGTGTCTCTGCCGTACAATGA

[0037] GGTGCGCATCCACTTCAAGCTGCGGCGCTGGGAGGACCTGCTCATCAGCCAGAGCAC

[0038] CCAGGCCGACATGGCCATATCGACTGTCACCCTGGCTAACATTGGCAATGTAGCACCC

[0039] GCACTGACCAACGTGTCCGTGATGGGCACCTACGCTGTACTGACAAGTGAGGAGCGT

[0040] GAGGTTGTGGCCCAGTCTAGCCGTAGCATGCTCATTGAGCAGTGTCAGGTGGCGCCTC

[0041] GTGTGCCTGTCACACCCGTAGACAATTCCTTGGTGCATCTCGACCTGAGGTTCAGTCA

[0042] CCCTGTGAAGGCCTTGTTCTTTGCAGTCAAGAATGTCACTCACCGCAACGTGCAAAGC

[0043] AATTACACCGCGGCCAGTCCCGTGTATGTCAACAACAAGGTGAATCTGCCTTTGCTGG

[0044] CCACCAATCCCCTGTCCGAGGTGTCGCTCATTTACGAGAACAACCCCTCGGCTCCACCA

[0045] GATGGGAGTAGACTACTTCACATCTGTCGACCCCTACTACTTTGCGCCCAGCATGCCTG

[0046] AGATGGATGGTGTTATGACCTACTGTTATACGCTGGACATGGGCAATATCAACCCTATG

[0047] GGCTCGACCAACTACGGCCGCCTGTCCAACGTCACCCTGTCATGTAAGGTGTCGGACA

[0048] ATGCCAAGACCACCGCGGCGGGCGGTGGAGGCAACGGCACCGGCTACACGGTCGCCC

[0049] AAAAGTTTGAACTGGTCGTTATTGCAGTCAACCACAACATCATGAAGATTGCTGACGGCGCTGCAGGCTTCCCTATCCTGTAA.

[0050] (2) The positive bacteria with correct sequencing were placed in LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C overnight with shaking. The next day, the overnight culture was diluted at a volume ratio of 1:100 and cultured until the OD600 of the culture was about 0.6. Then, isopropyl β-D-thiogalactoside (IPTG) was added at a final concentration of 0.5 mmol / L to induce protein expression.

[0051] (3) Inclusion body protein purification. The protein was purified according to the inclusion body protein purification method. The specific procedures are as follows: ① Collect the bacterial solution, resuspend the bacterial cells in pre-cooled NTA-0 buffer, place on ice for 30 minutes, and perform ultrasonic disruption for 25-30 minutes (the parameters are set to 200W power, 3s working, and 4s pause), centrifuge at 16000rpm / min and 4℃ for 50 minutes, and remove the supernatant. ② The precipitate was resuspended in STET buffer (DTT concentration 1mM), ultrasonically disrupted for 10min, the parameters were set to 200W, working for 3s, and paused for 3s; centrifuged at 10000rpm / min and 4℃ for 10min, and the supernatant was removed; ③ Repeat ② three times until the supernatant was transparent; ④ The precipitate was resuspended in PBS, ultrasonicated, the parameters were set to 200W, working for 3s, paused for 3s, and time was 5min; centrifuged at 16000rpm / min and 4℃ for 10min, and the supernatant was removed; ⑤ The inclusion bodies were resuspended in 4mL SKL (sodium lauryl sarcosine), DTT was added at a concentration of 5mM, and the inclusion bodies were shaken at 37℃ until they were completely dissolved. Centrifuged at 10000rpm / min and 4℃ for 10min, and the supernatant protein solution was taken.

[0052] (4) Refolding of inclusion body protein. ① Dilute the protein solution with 2 volumes of 3M guanidine hydrochloride, and add dropwise to 200 mL of refolding solution (weigh 0.077 g oxidized glutathione, 0.385 g reduced glutathione, 0.186 g EDTA·2Na, 17.42 g arginine, 3.03 g Trisbase, dissolve in deionized water, add concentrated hydrochloric acid to adjust pH = 8.0, and make up to 250 mL) at 4°C with a syringe, adjust the speed to the maximum, and stir for 24 h; reduce the speed and continue stirring for 24 h; ② Take the protein solution in a dialysis bag, concentrate the volume to 50-100 mL with PEG20000, and dialyze in TE buffer at 4°C overnight; ③ Take the protein solution, concentrate the volume to 2-4 mL with PEG20000; dialyze in TE buffer at 4°C overnight, and take the protein solution for SDS-PAGE detection.

[0053] (5) Affinity purification of renatured protein. ① The renatured protein solution in (4) was filtered through a 0.22 μm filter and then purified by Ni-NTA column; ② The protein solution was loaded at a flow rate of 1 mL / min; the column was washed with NTA-0 buffer (pH 8.0) until the effluent contained no protein (the G250 detection solution did not change color); ③ The elution was respectively eluted with eluents containing 20 mM, 60 mM, 200 mM and 500 mM imidazole, and the eluent was collected in sections until the G250 detection solution did not change color; ④ The column material was washed with 3 times column volume of deionized water, the column was sealed with 20% ethanol, and the collected eluent was subjected to SDS-PAGE electrophoresis. ⑤ The components with the required purity were dialyzed with TE at 4°C; the dialyzed product was concentrated by ultrafiltration at 4°C, and the protein purification was detected by SDS-PAGE. The results of SDS quality control showed that the MCP recombinant protein after inclusion body purification, protein renaturation and Ni-NTA column purification had a target band with a molecular weight of 54 kDa, a protein concentration of about 1 mg / mL, and a purity of about 85% ( Figure 1 ). Thus, a high-purity recombinant protein of the MCP virus of the spotted sea bream is obtained, which meets the subsequent immunization requirements.

[0054] Example 2: Preparation of WB-guaranteed monoclonal antibodies against the SKIV-TJ-MCP gene of the rockfish iridovirus

[0055] (1) Immunity

[0056] Purified MCP recombinant protein of rock snapper iridovirus was used as an antigen to immunize SPF female BALB / c mice. A total of 8 mice were immunized in the present invention. The immunization was carried out in 4 times, all of which were subcutaneous injections: ① One immunization: each mouse was subcutaneously injected with 50 μg of purified MCP recombinant protein of banded sea bream iridovirus and an equal amount of Freund's complete adjuvant (V / V), and the immunization time was 2-3 weeks; ② Two immunizations: each mouse was subcutaneously injected with 50 μg of purified MCP recombinant protein of banded sea bream iridovirus and an equal amount of Freund's incomplete adjuvant (V / V), and the immunization time was 2 weeks; ③ Three immunizations: each mouse was subcutaneously injected with 50 μg of purified MCP recombinant protein of banded sea bream iridovirus and an equal amount of Freund's incomplete adjuvant (V / V), and the immunization time was 1 week. After the three immunizations, the titer was detected by ELISA; ④ Four immunizations: each mouse was subcutaneously injected with 50 μg of purified MCP recombinant protein of banded sea bream iridovirus and an equal amount of Freund's incomplete adjuvant (V / V), and the immunization time was 2 weeks. After the four immunizations, the titer was detected by ELISA. ⑤ Intraperitoneal shock: Each mouse was intraperitoneally injected with 50 μg of purified MCP recombinant protein of rock snapper iridovirus, and the immunization time was 3 days.

[0057] (2) Cell fusion

[0058] ① Preparation of immune spleen cells: Take immunized BALB / c mice, remove the eyeballs to collect blood, and separate the serum as the positive control serum for antibody detection. After killing the mice by dislocating the neck, soak them in 75% alcohol for 5 minutes, remove the spleen aseptically and place it in a 3.5cm culture dish, and remove the fat and connective tissue on the spleen. Grind with a grinding rod to make the lymphocytes in the spleen pass through the silk mesh to make a single cell suspension, and collect the single cell suspension in a 15mL centrifuge tube. Centrifuge at 1000rpm / min for 5 minutes, discard the supernatant, and resuspend the precipitate with RPMI-1640 solution for later use.

[0059] ② Preparation of SP2 / 0 myeloma cells: Resuscitate SP2 / 0 myeloma cells frozen at -80℃, dissolve in a 37℃ water bath; centrifuge at 1000rpm / min for 5min, aspirate the supernatant, add 1mL GIT medium (HycloneDMEM, Thermo), and transfer to a 24-well plate. Expand and subculture the next day. Observe the cell state after about two days, and select cells with good growth and morphology in the logarithmic growth phase for subsequent fusion. Replace the medium 12h before fusion.

[0060] ③Preparation of feeder layer cells: Remove the spleen of healthy BALB / c mice under sterile conditions, and make a single spleen cell suspension using HAT medium containing 20% ​​fetal bovine serum, and then pre-plate it into a 96-well plate according to the number of plates.

[0061] ④SP2 / 0 myeloma cells and spleen cells were mixed in a certain ratio (quantity ratio 1:5), 50% PEG1450 was used for 1 min, and the mixture was terminated by dilution with basal medium DMEM. After low-speed centrifugation, the mixture was gently suspended and mixed with HAT medium containing 20% ​​fetal bovine serum.

[0062] ⑤ Fusion cells were counted at 2×10 7 Cells / plate were spread into the prepared feeder cell plate and cultured at 5% CO2 and 37°C. After fusion, the cell growth and contamination were checked every day. When the fused cells formed cell clusters, the culture supernatant was taken for screening.

[0063] (3) Screening, cloning and subtype identification of hybridoma cells

[0064] 1) Fusion plate detection: When the cells in the fusion plate are replaced with medium, they grow to a medium size of about 1×10 4The detection started when the number of cells was more than 1. The indirect enzyme-linked immunosorbent assay was used to screen positive hybridoma cells. The specific steps are as follows: ① Antigen coating: The purified MCP recombinant protein of the grouper porgy iridovirus was coated on the ELISA plate at a concentration of 1 μg / mL, and coated overnight at 4°C; ② Blocking: Block with 5% skimmed milk powder at 37°C for 2 hours, and wash 3 times with TBST; ③ Add different dilutions of the culture supernatant of the hybridoma cells to be tested to a 96-well plate, 100 μL / well, incubate at 37°C for 1 hour, and use PBS as a blank control; ④ After primary antibody incubation, rinse with TBST 3 times, add 1:10000 horseradish peroxidase (HRP) labeled goat anti-mouse IgG secondary antibody, 100μL / well, incubate at 37℃ for 40min; rinse with TBST 5 times after secondary antibody incubation; ⑤ Color development: add 90μL substrate color developer (TMB color development solution) to each well and incubate at room temperature in the dark for 15min; ⑥ Stop reaction and colorimetry: add 50μL H2SO4 to each well to stop the reaction, and measure the absorbance at 450nm with an enzyme marker. After the ELISA quality control is qualified (i.e. negative control <0.2, positive control >1.0), select the positive wells (generally OD450 ≥ 0.5) for subcloning.

[0065] 2) Subcloning method and detection: Select cell lines with higher titer and affinity in the fusion plate for limiting dilution, count 60% of the number of monoclonal wells on each plate for subcloning, select monoclonal wells with higher positive values ​​for limiting dilution each time, and perform ELISA detection 4-5 days after each subcloning. After secondary subclone screening, the monoclonal cell lines that can stably secrete positive antibodies are finally screened out for fixed-line expansion culture. The supernatant of each round of subclone cell culture is detected by the above-mentioned ELISA method. After ELISA detection, the present invention obtains a total of 6 monoclonal hybridoma cell lines.

[0066] 3) Establishment and expansion of cell lines: The cell lines that stably secrete positive antibodies screened in the subcloning stage are expanded and cultured in 24-well plates. After expansion, the supernatant is collected and the recognition of the antibody in the supernatant to the antigen is detected by immunoblotting. The collected cells are expanded in a 10 cm culture dish, and the supernatant is collected again and the titer of the antibody is detected. The specific steps of the immunoblotting method are as follows: using the cells infected with the iridovirus of the spotted porgy as samples, separating the proteins by SDS-PAGE, transferring the proteins on the gel to a polyvinylidene fluoride (PVDF) membrane by an electrotransfer instrument, blocking with a PBS solution containing 1% casein for 30 minutes, adding the monoclonal antibody hybridoma cell supernatant and immune mouse serum, incubating at 4°C overnight, rinsing with PBS solution (PBS solution containing 0.05% Tween-20) 3 times, adding alkaline phosphatase-labeled goat anti-mouse IgG antibody (1:10000 dilution), continuing to incubate at 37°C for 1.5 hours, rinsing with PBS solution (PBS solution containing 0.05% Tween-20) 3 times. Add the substrate mixture for display observation. The results of immunoblotting showed that after subcloning, 6 hybridoma cell lines were identified, and the cell supernatants with higher antibody titers were selected for WB verification of endogenous samples. The results showed that the culture supernatant of hybridoma cell 4A93D11 could effectively detect a relatively single target band ( Figure 2 ), and the hybridoma cells were selected to prepare ascites.

[0067] The above-mentioned hybridoma cell 4A9 3D11 is named: hybridoma cell line SKIV-MCP-4A9 3D11, which was deposited in Guangdong Microbiological Culture Collection Center (GDMCC) on May 11, 2024, address: Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Postal Code: 510070, and the deposit number is: GDMCCNo: 64608.

[0068] 4) Ascites preparation and purification

[0069] First, liquid paraffin was injected into the mouse peritoneum, and one week later, hybridoma cells 4A9 3D11 were inoculated into the mouse peritoneum. After 7-10 days, ascites was collected for purification. The collected ascites was pretreated and purified by Protein G-agarose affinity chromatography column. The specific steps are as follows: ① Preparation of buffer: the starting buffer was pH 7.0, 20 mmol / L phosphate buffer; the elution buffer was pH 3, 0.1 mmol / L glycine hydrochloride; ② Preparation of collection tubes: Take 1.5 mL centrifuge tubes, add 70 μL pH 9.0, 0.1 mmol / L Tris-HCL to each centrifuge tube; ③ Sample preparation: the sample obtained by 50% SAS precipitation was dialyzed overnight in the starting buffer and filtered through a 0.22 μm microporous filter membrane; ④ Purification process: chromatography column pretreatment, rinse 3-5 times with 10 column volumes of deionized water at a flow rate of 1 mL / min, and equilibrate the Protein G-agarose affinity chromatography column (HiTrap Protein G 1 ml, Pharmacia Biotech) with 10 column volumes of starting buffer (containing 0.3 M NaCl), rinse 3-5 times at a flow rate of 1 mL / min. Sample loading: Take 15-25mL of the sample to be purified (after the ascites is diluted with the starting buffer) and load it onto the column at a flow rate of 0.6mL / min. Washing: Rinse with the starting buffer until no protein flows out during detection (G250 does not turn blue), at a flow rate of 1.5mL / min. Antibody elution: Elute with elution buffer, collect the eluate and detect the elution product with G250 until it does not turn blue. pH adjustment: Adjust the pH of the eluted product to neutral with saturated sodium carbonate. Sample concentration: Ultrafiltration and concentration to 1-5mL with a 10kDa ultrafiltration tube. Dialysis: Dialyze overnight with 5L 0.01MpH7.4 PBS, and change the solution once the next day. ⑤ Purity and activity identification: The purity of the purified monoclonal antibody was identified by SDS-PAGE.

[0070] In this embodiment, 5 mL of ascites was taken from each sample to co-purify one antibody. The results of SDS-PAGE purity test of the purified monoclonal antibody showed that there were two protein bands with molecular weights of approximately 49 kDa and 28 kDa, respectively. Figure 3 ), the antibody purity was above 90%, indicating that the antibody purity after purification was high.

[0071] Example 3: Identification of the properties of the WB-guaranteed monoclonal antibody against the SKIV-TJ-MCP gene of the rockfish iridovirus

[0072] 1) Determination of monoclonal antibody concentration in ascites purified antibody

[0073] The concentration of monoclonal antibody purified from ascites was determined by indirect ELISA. The purified MCP recombinant protein of the iridovirus of the grouper was used as the coating antigen to determine the concentration of the purified antibody. The results of ELISA showed that the concentration of the antibody prepared by 4A93 D11 was 3 mg / mL.

[0074] 2) Identification of monoclonal antibody subtypes

[0075] The ThermoScientific monoclonal antibody typing kit was used to identify the subtype of the monoclonal cell supernatant by indirect ELISA. The results showed that the antibodies of the six cell lines were all of a single subtype (Table 1).

[0076] Table 1 Results of clone subtype detection

[0077] Strain No. 1G6 2G2 4A9 3D11 4E2 3D9 1B11 4D2 3C1 4C4 1D2 4E6 Subtype IgG1 IgG1 IgG1 IgG1 IgG1 IgG1

[0078] 3) Monoclonal antibody titer detection

[0079] The titer of the antibody prepared by 4A9 3D11 was determined by indirect ELISA method. The titer of 4A9 3D11 antibody was determined using the purified recombinant protein of the iridovirus MCP of the rock snapper as the coating antigen. The results are shown in Table 2.

[0080] Table 2 4A9 3D11 antibody titer detection

[0081]

[0082]

[0083] The results of indirect ELISA showed that the 4A9 3D11 antibody had good affinity and high detection sensitivity.

[0084] 4) Specific recognition and identification of monoclonal antibodies

[0085] The above-mentioned immunoblotting method was used to detect the recognition of endogenous MCP by the antibody 4A9 3D11 obtained after ascites purification. The results showed that a positive band of MCP with a size of about 49 kDa ( Figure 4 ), indicating that the monoclonal antibody 4A9 3D11 described in the present invention can recognize the major capsid protein MCP of the spotted sea bream iridovirus.

[0086] Example 4: Application of WB-guaranteed monoclonal antibody against SKIV-TJ-MCP gene of rockfish iridovirus

[0087] WB guaranteed monoclonal antibody against SKIV-TJ-MCP gene of rock snapper iridovirus is used to specifically detect virus infection:

[0088] The indirect immunoblotting method was used to determine the WB guaranteed monoclonal antibody of the SKIV-TJ-MCP gene of the rockfish iridovirus in the present invention for specific detection of virus infection. The results showed that the positive band of SKIV-TJ-MCP could be detected in the sample of SKIV-infected cells, with a size of about 49 kDa, while no bands were detected in the cell samples infected with mandarin fish infectious spleen and kidney necrosis virus (ISKNV), Singapore grouper iridovirus (SGIV), neural necrosis virus (RGNNV), grouper swollen cell iridovirus (OSGIV), California sea bass iridovirus (LMBV) and cell samples not infected with the virus ( Figure 5 ), indicating that the monoclonal antibody described in the present invention can specifically detect viral infection.

[0089] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Hybridoma cell line SKIV-MCP-4A9 3D11, whose deposit number is: GDMCC No: 64608.

2. WB guaranteed monoclonal antibody against SKIV-TJ-MCP gene of rockfish iridovirus, characterized in that: The hybridoma cell line SKIV-MCP-4A93 D11 is produced by the hybridoma cell line SKIV-MCP-4A93 D11 of claim 1.

3. Use of the hybridoma cell line SKIV-MCP-4A9 3D11 according to claim 1 in producing WB-guaranteed monoclonal antibodies against the SKIV-TJ-MCP gene of the rockfish iridovirus.

4. Use of the WB-guaranteed monoclonal antibody against the SKIV-TJ-MCP gene of the rockfish iridovirus according to claim 2 in the preparation of a product for detecting the rockfish iridovirus.

5. The use according to claim 4, characterized in that: It is used in the preparation of products for detecting MCP protein antigen of grouper sea bream iridovirus.

6. The use according to claim 4 or 5, characterized in that: The product is selected from any one of a reagent or a kit.

7. The use according to claim 6, characterized in that: The kit is selected from any one of a colloidal gold immunoassay kit, a chemiluminescence kit, a radioimmunoassay kit, an enzyme-linked immunosorbent assay kit or a fluorescent immunoassay kit.

8. A product for detecting iridovirus of rock snapper, characterized in that: The invention comprises the WB guaranteed monoclonal antibody against the SKIV-TJ-MCP gene of the spotted sea bream iridovirus according to claim 2.

9. A method for detecting iridovirus in rock snapper, characterized in that: The sample to be tested is tested using the WB guaranteed monoclonal antibody against the SKIV-TJ-MCP gene of the rockfish iridovirus as described in claim 2, or the product for detecting the rockfish iridovirus as described in claim 8.

10. Use of the WB-guaranteed monoclonal antibody against the SKIV-TJ-MCP gene of the rockfish iridovirus according to claim 2 or the product for detecting the rockfish iridovirus according to claim 8 in detecting the rockfish iridovirus.

Images