Indel Molecular Markers Linked to the NWB-CMS Fertility Restorer Gene in Radish and Their Application

Abstract

The present invention belongs to the field of biotechnology, and in particular relates to indel molecular markers linked to radish NWB cytoplasmic male sterility (NWB-CMS) fertility restoration genes and their applications. The invention comprises first to fourth Indel markers. The size of the first Indel marker is 156bp or 150bp, the size of the second Indel marker is 115bp or 109bp, the size of the third Indel marker is 179bp or 171bp, and the size of the fourth Indel marker is 106bp or 90bp. The present invention explores the control of radish NWB-CMS fertility restoration sites and develops molecular markers related thereto, which can more quickly and accurately identify and select micro-pollen and sterile plants, effectively exclude fertile plants, thereby accelerating the breeding process and improving breeding efficiency.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to an indel molecular marker linked to a radish NWB-CMS fertility restorer gene and an application thereof. Background Art

[0002] my country is the secondary origin center of radish (Raphanus sativus L.), with a long history of cultivation and diverse varieties. Radish is a cross-pollinated crop with pronounced hybrid vigor, and over 90% of the major varieties currently on the market are hybrids. Male sterility lines are the primary method for producing radish hybrid seeds, offering two distinct advantages: improving the purity of hybrids and preventing the loss of parental lines, thereby safeguarding breeders' interests. Ogura Cytoplasmic Male Sterility (Ogura-CMS) and NongWoo Bio Cytoplasmic Male Sterility (NWB-CMS) are currently the most widely used male sterility lines.

[0003] The NWB-CMS sterile source was discovered by South Korea's NongWoo Bio in 2003. This sterile source is significantly different from Ogura-CMS in terms of genetic pattern, abortion period, and abortion method. As a new sterile source, NWB-CMS has unique advantages over Ogura-CMS. First, because the abortion period of NWB-CMS is relatively late during the microspore period, its anthers are larger, the morphology of floral organs such as nectaries is close to that of fertile materials, there is almost no yellowing of flower buds, and the seed production yield is higher. Secondly, sterility is easier to maintain in East Asian long radishes, especially for breeding materials that cannot be converted to the Ogura male sterile line (such as Xinlimei radish).

[0004] Mitochondrial genome sequencing revealed that NWB-CMS and another sterility source, DCGMS (Dongbu cytoplasmic and genic male-sterility), are mitochondrial isomorphs, with only genomic substoichiometric differences. Male sterility is controlled by the mitochondrial gene orf463. orf463 originated from European wild radish (Raphanus raphanistrum) and is widely present in the black radish (R. sativus var. niger Kerner) subspecies. Fertility restoration in NWB-CMS is controlled by nuclear genes. Studies have shown that there are fewer restoration genes in the East Asian long radish subspecies, while they are common in the European cherry radish and black radish subspecies. Kim et al. (2010) and Li Xiaomei et al. (2021) both believed that at least three genes are involved in fertility restoration in NWB-CMS (DCGMS). Rfd1 is the first identified DCGMS fertility restoration site, containing 25 genes within an 83-kb positioning interval. The gene is located on radish chromosome 6.

[0005] In radish hybrid seed production, the female parent requires a male sterile line. The development of male sterile lines requires continuous backcrossing between the maintainer line and the sterile parent, so the maintainer line cannot contain fertility restorer genes. Using molecular markers to select individual plants without fertility restorer genes as maintainer lines during male sterile line development would greatly improve selection efficiency. However, research on NWB-CMS fertility restorer genes and related molecular markers is currently limited. Summary of the Invention

[0006] In order to solve the above problems existing in the prior art, the present invention provides an Indel molecular marker tightly linked to the radish NWB-CMS fertility restorer gene, comprising a first Indel marker, a second Indel marker, a third Indel marker, and a fourth Indel marker, wherein:

[0007] The first Indel marker is 156 bp in size, and its nucleotide sequence is shown in SEQ ID NO: 1; or: the first Indel marker is 150 bp in size, and its nucleotide sequence is shown in SEQ ID NO: 2;

[0008] The second Indel marker is 115 bp in size, and its nucleotide sequence is shown in SEQ ID NO: 3; or: the first Indel marker is 109 bp in size, and its nucleotide sequence is shown in SEQ ID NO: 4;

[0009] The third Indel marker has a size of 179 bp, and its nucleotide sequence is shown in SEQ ID NO: 5; or: the third Indel marker has a size of 171 bp, and its nucleotide sequence is shown in SEQ ID NO: 6;

[0010] The size of the fourth Indel marker is 106 bp, and its nucleotide sequence is shown in Sequence 7; or: the size of the fourth Indel marker is 90 bp, and its nucleotide sequence is shown in Sequence 8.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] 1. The present invention has discovered the site that controls the restoration of fertility in radish NWB-CMS and developed related molecular markers, which can more quickly and accurately identify and select micro-pollen and sterile plants, effectively exclude fertile plants, thereby accelerating the breeding process and improving breeding efficiency.

[0013] 2. Since NWB-CMS contains at least three pairs of fertility restorer genes, the efficiency of selecting maintainer lines using a single gene or molecular marker in the natural population of European radish is low. The molecular markers developed by the present invention can assist in tracking the fertility restorer gene Rfn4 site, so as to better screen and locate other fertility restorer gene sites, construct a fertility restorer gene molecular marker network, and optimize the NWB-CMS breeding system.

[0014] 3. The identification method of the present invention is simple to operate and saves resources; the various operating steps of the identification method work synergistically to achieve excellent results. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the ΔSNP / Indel-index distribution diagram of Example 1.

[0016] A: Comparison between fertile and sterile pools; B: Comparison between micronized and sterile pools; C: Comparison between fertile and micronized pools. The scatter plots show the original values, and the black curve shows the window-fitted values. 1000 permutation tests were performed. The red line indicates the 99% confidence level, and the blue line indicates the 95% confidence level.

[0017] Figure 2 Schematic diagram of the InDel-marked genotypes of recombinant individuals in the F2 population within the Rfn4 mapping interval of Example 1. The area between the dotted lines represents the fine interval for further gene mapping.

[0018] Figure 3 The following is an electrophoresis diagram of the PCR amplification products of primers Rf-118, Rf-119, Rf-120, and Rf-122 in sterile, micronized, and fertile plants from Example 1. (The bands in lanes 1 and 2 of the electrophoresis with primers Rf-118, Rf-119, and Rf-120 appear slightly higher because the edge voltage of the electrophoresis tank is slightly lower than the center voltage, resulting in the bands being slightly higher.) DETAILED DESCRIPTION

[0019] To make the technical solutions, objectives and advantages of the present invention more clear, the present invention is further described in detail below through specific embodiments. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention and are not intended to limit the present invention.

[0020] In the first aspect of the present invention, an Indel molecular marker tightly linked to the radish NWB-CMS fertility restorer gene is provided, including a first Indel marker (Rf-118), a second Indel marker (Rf-119), a third Indel marker (Rf-120), and a fourth Indel marker (Rf-122).

[0021] The first Indel marker (Rf-118) is 156 bp in size, and its nucleotide sequence is shown in Sequence 1; or 150 bp in size, and its nucleotide sequence is shown in Sequence 2.

[0022] Sequence 1: Rf-118 (156 bp)

[0023]

[0024] Sequence 2: Rf-118 (150 bp)

[0025] AGTGACGTGGCACTCTCAAAGAAGAGAGTGCTTTTCTTTATATATAT

[0026] ATAGATATAAGAAGATGTAAATAAAAACGTTTGAAAATTAAAAATTACAT

[0027] ATCTTGAAATCCTACAATTAATTATTATATCATCAAATTTTGCCGACGATAAA.

[0028] The second Indel marker (Rf-119) is 115 bp in size, and its nucleotide sequence is shown in SEQ ID NO: 3; or 109 bp in size, and its nucleotide sequence is shown in SEQ ID NO: 4.

[0029] Sequence 3: Rf-119 (115 bp)

[0030]

[0031] Sequence 4: Rf-119 (109 bp)

[0032] CCCGAGAAAGCCTAACTGCTATTAAAAAGATTTAGACAAATGGTAT

[0033] TTTACCTACACAGTGCTTAACTTTGGGTAAATATTTTACCTTTACCCTTGGCCTTTGTTCCTT.

[0034] The third Indel marker (Rf-120) is 179 bp in size, and its nucleotide sequence is shown in Sequence 5; or 171 bp in size, and its nucleotide sequence is shown in Sequence 6.

[0035] Sequence 5: Rf-120 (179 bp)

[0036]

[0037] Sequence 6: Rf-120 (171 bp)

[0038] CCACATACAGATTAACAGTGCCCAATAAGTGTTTTATTCCATTTATA

[0039] AAAGTACTAAGTCTGATAGAAACAAATAGAACACCTTTCATTTCAAAATA

[0040] AACCCTATATCCAATCCCTACACCTAAATACTAAATCCTAACGAATTCTTAAACCAAAACCCAAAAGTGAAATCT.

[0041] The fourth Indel marker (Rf-122) is 106 bp in size, and its nucleotide sequence is shown in Sequence 7; or 90 bp in size, and its nucleotide sequence is shown in Sequence 8.

[0042] Sequence 7: Rf-122 (106 bp)

[0043]

[0044] Sequence 8: Rf-122 (90 bp)

[0045] GGCATAGGTAGCAGGAGGCATAGTGTAACTAACTAGTGCCTTCTATTTTTTTTATAATTATGATAAGGTTGCGGTTTAGGGTTTTACGGA.

[0046] The first Indel marker (Rf-118), the second Indel marker (Rf-119), the third Indel marker (Rf-120), and the fourth Indel marker (Rf-122) are all located within the range of 31.29 to 38.86 Mb on chromosome 4 of radish.

[0047] In a second aspect of the present invention, a primer set for identifying the first Indel marker (Rf-118), the second Indel marker (Rf-119), the third Indel marker (Rf-120), and the fourth Indel marker (Rf-122) is provided, comprising:

[0048] Primer set for identifying the first Indel marker (Rf-118):

[0049] Forward primer: 5′-AGTGACGTGGCACTCTCAAA-3′ (SEQ ID NO: 9);

[0050] Reverse primer: 5′-TTTATCGTCGGCAAAATTTGATGA-3′ (SEQ ID NO: 10);

[0051] Primer set for identifying the second Indel marker (Rf-119):

[0052] Forward primer: 5′-CCCGAGAAAGCCTAACTGCT-3′ (SEQ ID NO: 11);

[0053] Reverse primer: 5′-AAGGAACAAAGGCCAAGGGT-3′ (SEQ ID NO: 12);

[0054] Primer set for identifying the third Indel marker (Rf-120):

[0055] Forward primer: 5′-CCACATACAGATTAACAGTGCCC-3′ (SEQ ID NO: 13);

[0056] Reverse primer: 5′-AGATTTCACTTTTGGGTTTTGGTTT-3′ (SEQ ID NO: 14);

[0057] Primer set for identifying the fourth Indel marker (Rf-122):

[0058] Forward primer: 5′-GGCATAGGTAGCAGGAGGC-3′ (SEQ ID NO: 15);

[0059] Reverse primer: 5'-TCCGTAAAACCCTAAACCGCA-3' (SEQ ID NO: 16).

[0060] In a third aspect, the present invention provides a kit for identifying / assisting in identifying the radish NWB-CMS fertility restorer gene, the kit comprising a primer set for identifying at least one of the first Indel marker (Rf-118), the second Indel marker (Rf-119), the third Indel marker (Rf-120), and the fourth Indel marker (Rf-122) provided in the second aspect of the present invention.

[0061] According to the third aspect of the present invention, the kit may further include at least one of a PCR amplification buffer, dNTPs, and Taq enzyme.

[0062] In a fourth aspect, the present invention provides a method for identifying / assisting in identifying the radish NWB-CMS fertility restorer gene, the method comprising the operation of identifying at least one of a first Indel marker (Rf-118), a second Indel marker (Rf-119), a third Indel marker (Rf-120), and a fourth Indel marker (Rf-122) that are closely linked to the radish NWB-CMS fertility restorer gene.

[0063] According to a fourth aspect of the present invention, the method comprises the operation of identifying any one of the following markers / marker combinations:

[0064] Any one of the first Indel marker (Rf-118), the second Indel marker (Rf-119), the third Indel marker (Rf-120), or the fourth Indel marker (Rf-122);

[0065] a first Indel marker (Rf-118) and a second Indel marker (Rf-119), or a first Indel marker (Rf-118) and a third Indel marker (Rf-120), or a first Indel marker (Rf-118) and a fourth Indel marker (Rf-122), or a second Indel marker (Rf-119) and a third Indel marker (Rf-120), or a second Indel marker (Rf-119) and a fourth Indel marker (Rf-122), or a third Indel marker (Rf-120) or a fourth Indel marker (Rf-122);

[0066] A first Indel marker (Rf-118), a second Indel marker (Rf-119), and a third Indel marker (Rf-120), or a first Indel marker (Rf-118), a second Indel marker (Rf-119), and a fourth Indel marker (Rf-122), or a first Indel marker (Rf-118), a third Indel marker (Rf-120), and a fourth Indel marker (Rf-122); or a second Indel marker (Rf-119), a third Indel marker (Rf-120), and a fourth Indel marker (Rf-122);

[0067] The first Indel marker (Rf-118), the second Indel marker (Rf-119), the third Indel marker (Rf-120) and the fourth Indel marker (Rf-122).

[0068] According to the fourth aspect of the present invention, the method may include using a primer set for identifying at least one of the first Indel marker (Rf-118), the second Indel marker (Rf-119), the third Indel marker (Rf-120), and the fourth Indel marker (Rf-122) provided in the second aspect of the present invention, performing a PCR amplification reaction on the radish genome, and then detecting and analyzing the PCR amplification product.

[0069] According to the fourth aspect of the present invention, the method may include using the kit for identifying / assisting in identifying the radish NWB-CMS fertility restorer gene provided by the third aspect of the present invention, performing a PCR amplification reaction on the radish genome, and then detecting and analyzing the PCR amplification product.

[0070] As a preferred embodiment, the operation of detecting and analyzing the PCR amplification products may include: performing electrophoresis (such as polyacrylamide gel electrophoresis) on the PCR amplification products, and then detecting and analyzing the electrophoresis bands; or sequencing the PCR amplification products.

[0071] As a preferred embodiment, the reaction system (20 μL) of the above-mentioned PCR amplification reaction includes: 2 μL of radish genomic DNA (40 ng), 2 μL of 10× PCR Buffer (containing MgCl2), 0.5 μL of each of the upstream and downstream primers (10 μM), 1.6 μL of dNTPs (10 mM), 0.5 μL of Taq enzyme (2.0 U / μL), and 12.9 μL of ddH2O.

[0072] As a preferred embodiment, the PCR amplification program is: 94°C, 4 min; 94°C 20 s, 60°C 20 s, 72°C 30 s, for a total of 35 cycles; 72°C, 10 min; and storage at 4°C.

[0073] As a preferred embodiment, the operation of detecting and analyzing the PCR amplification product may include at least one of the following four PCR amplification results:

[0074] The primer set used to amplify the first Indel marker (Rf-118) amplified only a 156 bp band;

[0075] The primer set used to amplify the second Indel marker (Rf-119) amplified only a 115 bp band;

[0076] The primer set used to amplify the third Indel marker (Rf-120) amplified only a 179 bp band;

[0077] The primer set used to amplify the fourth Indel marker (Rf-122) amplified only a 106-bp band;

[0078] The radish genome does not contain a fertility restoration gene, and the radish is a micronized plant or a sterile plant, which can be used for the selection and breeding of male sterile lines and hybrid breeding.

[0079] In a fifth aspect, the present invention provides an application of the Indel molecular marker tightly linked to the radish NWB-CMS fertility restorer gene provided by the first aspect of the present invention, and / or the primer set for identifying the first Indel marker (Rf-118), the second Indel marker (Rf-119), the third Indel marker (Rf-120), and the fourth Indel marker (Rf-122) provided by the second aspect of the present invention, and / or the kit for identifying / assisting the identification of radish NWB-CMS fertility restorer provided by the third aspect of the present invention, and / or the method for identifying / assisting the identification of radish NWB-CMS fertility restorer gene provided by the fourth aspect of the present invention, in the identification / assisting identification of radish NWB-CMS fertility restorer gene, in radish breeding / assisting breeding, and in assisting the tracking of radish fertility restorer gene loci.

[0080] Unless otherwise specified, the various reagents, materials, etc. used in the following examples are all products that can be obtained from commercial channels; unless otherwise specified, the various tests and detection methods used in the following examples are all conventional tests and detection methods in the field, which can be obtained from textbooks, reference books or academic journals.

[0081] The radish varieties YB-A, YB-B, Shinong 301, KP, Red Price, Red Baron, Snow Belle, Red King, Vyurtcburgskii, Ldinka Skvirska, Tashkentsky, Ledianaya, Earliest Scarlet White, Icicle Short Top, No. 8891, and GiSi used in Examples 1 to 4 are currently stored in the Germplasm Resource Bank of the Vegetable Research Institute, Beijing Academy of Agricultural and Forestry Sciences (Contact Number: 010-81127153). For the purpose of implementing the technical solution of the present invention, anyone may contact our institution to obtain the above-mentioned plant varieties within the validity period of the patent right from the filing date of the present invention.

[0082] Example 1 Acquisition of molecular markers

[0083] This embodiment is used to describe the acquisition of the first to fourth Indel markers.

[0084] 1. Construction of genetic populations

[0085] The maternal NWB cytoplasmic sterile line YB-A and the paternal European cherry radish high-generation inbred line variety KP were hybridized to obtain an F1 progeny population. The fertile offspring of the F1 progeny were self-pollinated to obtain an F2 population (n=335). The fertile plants in the F2 population were then backcrossed with the maternal sterile line YB-A to obtain F2BC1 families (10-20 plants per family), which were used to determine the genotype of the individual plants in the F2 population and locate the restored gene.

[0086] After vernalization of all populations during the seedling stage, they were transplanted in the greenhouse of Sijiqing Farm, Vegetable Research Institute, Beijing Academy of Agricultural and Forestry Sciences in April 2023, and three fertility surveys were conducted at the early flowering period, peak flowering period and late flowering period.

[0087] The maternal NWB cytoplasmic sterile line YB-A was developed by continuous backcrossing (9 generations) between YB-B (Yangzhou round white inbred line) and the sterile source "Shinong 301".

[0088] 2. Analysis of genetic patterns of fertility restoration in NWB-CMS

[0089] Fertility survey results revealed that the F2 population included fertile plants (characterized by visible, abundant, and pale yellow pollen on anthers), sterile plants (with small, shriveled anthers and no visible pollen), and plants with minimal pollen (also known as "micropollen plants" with a small amount of visible pollen on the anthers, which dry and clumped, and fail to produce seeds when self-pollinated or test-crossed during flowering). The F2 population contained 238 fertile plants, 68 plants with minimal pollen, and 29 sterile plants. The segregation ratios among these individual plants did not conform to classic Mendelian inheritance, suggesting a complex inheritance pattern for fertility restoration, potentially controlled by both major and minor restorer genes, or by gene interactions.

[0090] 3. Preliminary positioning of the NWB-CMS fertility restorer gene

[0091] 1. The total DNA of the F2 population was extracted using the CTAB method.

[0092] 2. From the 335 F2 populations, 23 fertile plants, 23 trace pollen plants, and 23 sterile plants were selected, and their DNA was mixed in equal amounts to construct the following three extreme pools: fertile pool (F_pool), trace pollen pool (SW_pool), and sterile pool (S_pool).

[0093] 2. The parental and extreme pool DNAs were sent to Tianjin Jizhi Gene Technology Co., Ltd. for double-end 150bp sequencing using an Illumina HiSeq2000 sequencer. The sequencing depth of each extreme pool was 40×, and the sequencing depth of the parent was 20×.

[0094] 3. QTL-seq analysis was performed using cherry radish "ROD" as the reference genome (Takagi et al., 2013). The alignment rates of the three extreme pools were 94.93%, 95.02%, and 94.88%, respectively, and the average sequencing depths were 49.92×, 43.15×, and 43.83×, respectively.

[0095] 4. Use Sentieon software to detect SNPs and Indels. Filter and select polymorphic markers. Calculate the SNP / Indel index at these marker sites in the progeny pool and the ΔSNP / Indel index between progeny pools. Select sites with a SNP / Indel index > 0.3 in the progeny pool for further calculations. Fit the calculated SNP / Indel index and ΔSNP / Indel index using a sliding window with a 1 Kb window size and a 0.1 Kb step size. Window intervals greater than the threshold at a 95% confidence level are selected as candidate intervals.

[0096] The results show that Figure 1As shown in Table 1, at the 95% confidence level, QTL-seq analysis of the fertile and sterile pools located the fertility restorer gene within the range of 32.5-33.7 Mb (Rfn1.1) on chromosome 1; QTL-seq analysis of the pollen pool and sterile pools located the fertility restorer gene within the range of 32.5-33.7 Mb (Rfn1.1) on chromosome 1 and 12.2-13.3 Mb (Rfn9.1) on chromosome 9; QTL-seq analysis of the fertile and pollen pools located the fertility restorer gene within the range of 16.7-18.6 Mb (Rfn4.1), 31.9-33.1 Mb (Rfn4.2), and 34.3-37.9 Mb (Rfn4.3) on chromosome 4.

[0097] Table 1: Initial mapping interval of NWB-CMS fertility restorer genes and gene statistics within the interval

[0098]

[0099] IV. Analysis of the Rfn4 locus in NWB-CMS fertility restoration

[0100] The present invention only further analyzed the Rfn4 locus. Based on the genome resequencing information of the parents YB-A and KP, primers were selected for the InDel site in the 16.11-40.48Mb interval on chromosome 4 of radish, and used to genotype individual plants in the F2 population of YB-A×KP (n=335). Based on the information of the exchanged individual plants, the Rfn4 locus was mapped to the molecular markers Rf-1 to Rf-10, with a physical interval of 31.29-38.86Mb ( Figure 2 It is worth noting that no recombinant strains were detected within 7.57 Mb using an F2 population containing 335 strains. We speculate that structural variations such as chromosomal inversions and large duplications may exist in this interval.

[0101] The inventors then used pan-genome data to analyze the linear relationship between different genomes in this interval (Table 2). The results showed that the Rfn4.1, Rfn4.2, and Rfn4.3 loci on chromosome 4 identified using the ROD genome were located in the same interval in the WK10039 genome, and in the XYB36-2 genome, Rfn4.2 and Rfn4.3 were located in the same interval, indicating that these three intervals may be large-segment chromosome duplications. In addition, the positions of the Rfn4.2 and Rfn4.3 loci in the ROD genome are reversed in the R03, RS04, RS05, and RS06 genomes, suggesting that there may be a chromosome inversion here. This result explains the lack of recombinant strains in the 31.29-38.86Mb interval of the Rfn4 locus.

[0102] Table 2: Linear alignment of NWB-CMS fertility restorer gene QTL regions in different genomes

[0103] Genome Rfn4.1 locus Rfn4.2 locus Rfn4.3 locus ROD 15.4-18.7Mb 31.9-33.1Mb 34.2-37.9Mb RS03 15.9-19.0Mb 35.6-36.5Mb 33.2-34.5Mb RS04 16.0-19.4Mb 35.2-36.1Mb 32.7-33.7Mb RS05 16.4-19.8Mb 36.3-37.2Mb 33.4-35.2Mb RS06 16.0-19.2Mb 35.9-36.4Mb 33.4-34.4Mb WK10039 18.7-23.7Mb 29.0-29.2Mb 19.1-23.7Mb XYB36-2 16.0-21.1Mb 25.2-27.6Mb 25.4-26.5Mb

[0104] 5. Screening and obtaining Indel molecular markers and primers

[0105] The genomic DNA of young leaves of different radish genetic materials in the F2 population was extracted using the modified CTAB method (Aboul-Maaty, N.AF., Oraby, H.AS. Extraction of high-quality genomic DNA from different plant orders applying a modified CTAB-based method. Bull Natl Res Cent 43, 25(2019). https: / / doi.org / 10.1186 / s42269-019-0066-1), and the whole genomic DNA was dissolved using ddH2O.

[0106] 1. Within the ranges of 16.7-18.6 Mb (Rfn4.1), 31.9-33.1 Mb (Rfn4.2), and 34.3-37.9 Mb (Rfn4.3) on chromosome 4, the following 15 pairs of primers were designed to detect polymorphic Indel sites closely linked to the NWB-CMS fertility restorer gene, as shown in Table 3.

[0107] Table 3: 15 pairs of primers for Indel markers

[0108] mark Location Forward primer Reverse primer Rf-117 16109162 TCTCGCGGATGTAGTAAGCT TTACGTGCCAATTATGTAGGAGAA Rf-6 17270936 GCCACTATCACAATACTAGCATGA ACTTGATTCTTGCAGAGTGATTGA Rf-8 18574289 ACGCATTTTCGATGTGTGTACA TGAGGGATATGATCTGCATTGTCA Rf-113 19086196 TCTGGTCCAAGTCAGGAGGA GGGGAGTGACAAGAACCTGA Rf-1 31297167 CCACCTGTCTCGTTGAAGGA TCTCAAGTCTGATTCCCCGC Rf-120 33851811 CCACATACAGATTAACAGTGCCC AGATTTCACTTTTGGGTTTTGGTTT Rf-119 34029651 CCCGAGAAAGCCTAACTGCT AAGGAACAAAGGCCAAGGGT Rf-122 37683242 GGCATAGGTAGCAGGAGGC TCCGTAAAACCCTAAACCGCA Rf-118 38202091 AGTGACGTGGCACTCTCAAA TTTATCGTCGGCAAAATTTGATGA Rf-10 38864737 CTTTGCGCGGGTCTTTCAAA ACACCTTGTGACTGAAGAGGA Rf-11 39147363 TCCAATATATAATGGCTTTTGTGCAAA TGAGATCGGCGGAAGACTTG Rf-14 40214027 AAACTTACTTGTGTCGGAGATCC CCTTCTAGAACATTTACTCTCCAGGT Rf-16 42080242 GCCAAGACACAGTACGGTCA CGAGTCAGGAAGCTGGTCAT Rf-128 42368813 ACATCTCTGGGGAAAAAGCTTT GCTATAGTCCCCGCATCAAGT Rf-131 42586659 TGTTTTACCGTTACATTCAGTTTCAGT CCAAAAGCCTATTCAACACTCGT

[0109] 2. Extract genomic DNA from the above-mentioned parents and offspring F2 population, and perform PCR amplification reaction using the above 15 pairs of primers.

[0110] The PCR amplification reaction system (20 μL) includes: 2 μL of radish genomic DNA (40 ng), 2 μL of 10×PCR Buffer (containing MgCl2), 0.5 μL of each upstream and downstream primers (10 μM), 1.6 μL of dNTPs (10 mM), 0.5 μL of Taq enzyme (2.0 U / μL), and 12.9 μL of ddH2O.

[0111] The PCR amplification program was as follows (MyCycler, Bio-Rad Laboratories, USA): 94°C, 4 min; 35 cycles (94°C, 20 s; 60°C, 20 s; 72°C, 30 s); 72°C, 10 min; and storage at 4°C.

[0112] 3. The PCR amplification products were subjected to 8% polyacrylamide gel electrophoresis at 160V constant power for 1.5 hours. After silver staining, the band patterns were counted under a film observation light.

[0113] 4. Statistical analysis of electrophoresis band patterns

[0114] like Figure 3 As shown in the figure, the Rf-118, Rf-119, Rf-120 and Rf-122 markers in the Rfn4 locus gave consistent genotyping results for individual plants in the F2 population, so any one of these four pairs of primers can be used to detect the presence of the NWB-CMS fertility restorer gene in the material.

[0115] (1) The electrophoresis results of the PCR products produced by primer Rf-118 showed that the genotypes of the sterile strains in the F2 population were: homozygous 156bp / 156bp band (only the 156bp band was visible), homozygous 150bp / 150bp band (only the 150bp band was visible), and heterozygous 156bp / 150bp band (two bands of 150bp and 156bp were visible). The electrophoresis bands of the micropowder strains included: homozygous 156bp / 156bp band (only the 156bp band was visible), homozygous 150bp / 150bp band (only the 150bp band was visible), and heterozygous 156bp / 150bp band (two bands of 150bp and 156bp were visible). The electrophoresis bands of the fertile strains include: a homozygous 150bp / 150bp band (only a 150bp band is visible) and a heterozygous 156bp / 150bp band (two bands of 150bp and 156bp are visible). The electrophoresis bands of the fertile strains do not include a homozygous 156bp / 156bp band (only a 156bp band is visible). Therefore, based on the above, it can be inferred that although the electrophoresis bands of sterile and micronized plants may show not only the homozygous 156bp / 156bp band (only the 156bp band is visible), but also the homozygous 150bp / 150bp band (only the 150bp band is visible), and the heterozygous 156bp / 150bp band (two bands of 150bp and 156bp are visible), if the electrophoresis band is only the homozygous 156bp / 156bp band (only the 156bp band is visible), then the sample can only be a sterile plant or micronized plant, not a fertile plant. In other words, if the electrophoresis results of a sample only show the homozygous 156bp / 156bp band (only the 156bp band is visible), it can be determined that the genome of the sample does not contain the fertility restorer gene, and the sample is a sterile plant or micronized plant, which can be used for molecular marker-assisted breeding of male sterile lines.

[0116] (2) Electrophoresis results of the PCR products using primer Rf-119 showed that the genotypes of the sterile strains in the F2 population were: homozygous 115bp / 115bp band (only the 115bp band was visible), homozygous 109bp / 109bp band (only the 109bp band was visible), and heterozygous 115bp / 109bp band (two bands of 109bp and 115bp were visible). The electrophoresis bands of the micropowder strains included: homozygous 115bp / 115bp band (only the 115bp band was visible), homozygous 109bp / 109bp band (only the 109bp band was visible), and heterozygous 115bp / 109bp band (two bands of 109bp and 115bp were visible). The electrophoresis bands of the fertile strains include: a homozygous 109bp / 109bp band (only a 109bp band is visible) and a heterozygous 115bp / 109bp band (two bands of 109bp and 115bp are visible). The electrophoresis bands of the fertile strains do not include a homozygous 115bp / 115bp band (only a 115bp band is visible). Therefore, based on the above, it can be inferred that although the electrophoresis bands of sterile plants and micronized plants may show not only the homozygous 115bp / 115bp band (only the 115bp band is visible), but also the homozygous 109bp / 109bp band (only the 109bp band is visible), and the heterozygous 115bp / 109bp band (two bands of 109bp and 115bp are visible), if the electrophoresis band is only the homozygous 115bp / 115bp band (only the 115bp band is visible), then the sample can only be a sterile plant or micronized plant, not a fertile plant. In other words, if the electrophoresis results of a sample only show the homozygous 115bp / 115bp band (only the 115bp band is visible), it can be determined that the genome of the sample does not contain the fertility restorer gene, and the sample is a sterile plant or micronized plant, which can be used for molecular marker-assisted breeding of male sterile lines.

[0117] (3) Electrophoresis results of the PCR products using primer Rf-120 showed that the genotypes of sterile plants in the F2 population were: homozygous 179bp / 179bp band (only the 179bp band was visible), homozygous 171bp / 171bp band (only the 171bp band was visible), and heterozygous 179bp / 171bp band (two bands of 171bp and 179bp were visible). The electrophoresis bands of the micropowder strains included: homozygous 179bp / 179bp band (only the 179bp band was visible), homozygous 171bp / 171bp band (only the 171bp band was visible), and heterozygous 179bp / 171bp band (two bands of 171bp and 179bp were visible). The electrophoresis bands of the fertile strains include: a homozygous 171bp / 171bp band (only a 171bp band is visible) and a heterozygous 179bp / 171bp band (two bands of 171bp and 179bp are visible). The electrophoresis bands of the fertile strains do not include a homozygous 179bp / 179bp band (only a 179bp band is visible). Therefore, based on the above, it can be inferred that although the electrophoresis bands of sterile and micronized strains may show not only the homozygous 179bp / 179bp band (only the 179bp band is visible), but also the homozygous 171bp / 171bp band (only the 171bp band is visible), and the heterozygous 179bp / 171bp band (two bands of 171bp and 179bp are visible), if the electrophoresis band is only the homozygous 179bp / 179bp band (only the 179bp band is visible), then the sample can only be a sterile or micronized strain, not a fertile strain. In other words, if the electrophoresis results of a sample only show the homozygous 179bp / 179bp band (only the 179bp band is visible), it can be determined that the genome of the sample does not contain the fertility restorer gene, and the sample is a sterile or micronized strain, which can be used for molecular marker-assisted breeding of male sterile lines.

[0118] (4) Electrophoresis results of the PCR products using primer Rf-122 showed that the genotypes of the sterile strains in the F2 population were: homozygous 106 bp / 106 bp band (only the 106 bp band was visible), homozygous 90 bp / 90 bp band (only the 90 bp band was visible), and heterozygous 106 bp / 90 bp band (two bands of 90 bp and 106 bp were visible). The electrophoresis bands of the micropowder strains included: homozygous 106 bp / 106 bp band (only the 106 bp band was visible), homozygous 90 bp / 90 bp band (only the 90 bp band was visible), and heterozygous 106 bp / 90 bp band (two bands of 90 bp and 106 bp were visible). The electrophoresis bands of the fertile strains include: a homozygous 90bp / 90bp band (only the 90bp band is visible) and a heterozygous 106bp / 90bp band (two bands of 90bp and 106bp are visible). The electrophoresis bands of the fertile strains do not include a homozygous 106bp / 106bp band (only the 106bp band is visible). Therefore, based on the above, it can be inferred that although the electrophoresis bands of sterile plants and micronized plants may show not only the homozygous 106bp / 106bp band (only the 106bp band is visible), but also the homozygous 90bp / 90bp band (only the 90bp band is visible), and the heterozygous 106bp / 90bp band (two bands of 90bp and 106bp are visible), if the electrophoresis band is only the homozygous 106bp / 106bp band (only the 106bp band is visible), then the sample can only be a sterile plant or micronized plant, not a fertile plant. In other words, if the electrophoresis results of a sample only show the homozygous 106bp / 106bp band (only the 106bp band is visible), it can be determined that the genome of the sample does not contain the fertility restorer gene, and the sample is a sterile plant or micronized plant, which can be used for molecular marker-assisted breeding of male sterile lines.

[0119] Example 2 Identification of Radish Male Sterile Lines by Molecular Marker-Assisted Breeding

[0120] This example is used to illustrate the practical application of using Rf-118, Rf-119, Rf-120, and Rf-122 markers in identifying / assisting in identifying radish male sterile lines.

[0121] To cultivate a radish male sterile line, YB-A was used as the female parent and the cherry radish material Red Price was used as the male parent to obtain F1, which was then self-pollinated to obtain F2.

[0122] S1: 100 F2 generation radish seed samples were selected and sown in plug trays. Leaves of the radish seedlings were collected and genomic DNA of each radish plant was extracted according to the method of Example 1.

[0123] S2: Using the above primer sets for amplifying Rf-118, Rf-119, Rf-120, and Rf-122 markers, respectively, with each radish genome as a template, PCR amplification reaction was performed according to the PCR amplification reaction system and procedure of Example 1 to obtain PCR amplification products of each individual plant.

[0124] S3: The above PCR amplification products were subjected to 8% polyacrylamide gel electrophoresis at 160V constant power for 1.5 hours, and then silver-stained.

[0125] S4: Electrophoresis bands were examined under a film viewing light and band pattern statistics were performed (Table 4). The results showed that, among the 96 samples, in 12 samples (R3, R10, R16, R27, R34, R38, R48, R49, R50, R67, R70, and R86), primer Rf-118 amplified only a 156 bp band, primer Rf-119 amplified only a 115 bp band, primer Rf-120 amplified only a 179 bp band, and primer Rf-122 amplified only a 106 bp band.

[0126] S5: The 12 seedlings were planted in a test field. After the radishes flowered, the fertility of the plants was investigated. The results showed that 8 of the 12 seedlings (R10, R16, R34, R38, R48, R49, R67, and R86) were microfertile plants, 4 (R3, R27, R50, and R70) were sterile plants, and no fertile plants were found. This indicates that the method provided by the present invention can accurately identify radish NWB cytoplasmic male sterile lines and can be applied to molecular marker-assisted breeding for fertility restoration in radishes after NWB-CMS.

[0127] Table 4: Genotype identification of F2 population Rf-118, 119, 120, and 122 of YB-A and cherry radish material Red Price and fertility results of individual plants that could only amplify 156 bp

[0128]

[0129]

[0130]

[0131]

[0132] Example 3 Molecular marker-assisted breeding of radish NWB-CMS maintainer line

[0133] This example is used to illustrate the application of Rf-118, 119, 120 or 122 molecular markers in marker-assisted breeding of radish NWB-CMS maintainer lines.

[0134] The genotype of the NWB-CMS sterile line is: sterile cytoplasm (containing the mitochondrial sterility gene orf463a) and no restorer gene in the nucleus. The genotype of the maintainer line is: normal fertile cytoplasm (not containing the mitochondrial sterility gene orf463a) and no restorer gene in the nucleus. In breeding, it is necessary to select an appropriate maintainer line for the conversion of male sterile lines.

[0135] Test materials: 105 individual plants of 10 cherry radish varieties, each material containing 10-15 plants (see Table 5 for details).

[0136] S1: First, the cytoplasm of the test material was identified. For details, please refer to “Wang YP, Wang QB, Hao W, LJX, Qi MX, Zhang L (2020) Mitochondrial genome sequencing reveals orf463a mayinduce male sterility in NWB cytoplasm of radish. Genes 11(1): 74” for the identification of the NWB-CMS cytoplasmic sterility gene orf463a.

[0137] The identification results are as follows: the cytoplasmic mitochondrial genome of variety PI262947 contains the orf463a gene, while the cytoplasmic mitochondrial genomes of other varieties do not contain the orf463a gene.

[0138] S2: Based on the identification results of the orf463a gene, individual plants that do not contain the orf463a gene were selected, and the genotype of the nuclear fertility restorer gene was identified using the Rf-118, 119, 120 or 122 molecular markers according to the method in Example 1 (results are shown in Tables 5 to 8).

[0139] The identification results are as shown in Tables 5 to 8. For the three individual plants of variety PI601000 and the ten individual plants of variety PI262944, PCR amplification with primer Rf-118 only obtained a target band of 156 bp, PCR amplification with primer Rf-119 only obtained a target band of 115 bp, PCR amplification with primer Rf-120 only obtained a target band of 179 bp, and PCR amplification with primer Rf-122 only obtained a target band of 106 bp.

[0140] S3: According to the typing results of molecular markers, individual plants from PI601000 and PI262944 that only obtained a 156bp band by PCR amplification with primer Rf-118, only obtained a 115bp target band by PCR amplification with primer Rf-119, only obtained a 179bp target band by PCR amplification with primer Rf-120, and only obtained a 106bp target band by PCR amplification with primer Rf-122 were selected, respectively, and hybridized with the sterile line YB-A, and backcrossed for 6-7 consecutive generations to obtain radish sterile lines and corresponding maintainer lines with consistent genetic background and stable inheritance.

[0141] Table 5: Genotype detection results of the cytoplasmic sterility gene orf463a and the fertility restorer gene molecular marker Rf-118 of the test materials

[0142]

[0143] Table 6: Genotype detection results of the cytoplasmic sterility gene orf463a and the fertility restorer gene molecular marker Rf-119 of the test materials

[0144]

[0145] Table 7: Genotype detection results of cytoplasmic sterility gene orf463a and fertility restorer gene molecular marker Rf-120 of the test materials

[0146]

[0147] Table 8: Genotype detection results of the cytoplasmic sterility gene orf463a and the fertility restorer gene molecular marker Rf-122 of the test materials

[0148]

[0149]

[0150] Example 4 Molecular markers can assist in tracking the fertility restorer gene Rfn4 locus

[0151] This example is used to illustrate the application of Rf-118, Rf-119, Rf-120, and Rf-122 molecular markers in assisting in tracing the fertility restorer gene Rfn4 locus.

[0152] Because NWB-CMS contains multiple pairs of fertility restorer genes, especially in European cherry radish, where a single material often contains more than two pairs, in order to locate and clone the fertility restorer genes, it is necessary to isolate the different fertility restorer genes into different radish materials to facilitate the cloning of individual genes and avoid the impact of multiple genes on fertility identification.

[0153] The Rfn4 locus discovered in the present invention is an important NWB-CMS fertility restoration locus. The developed molecular marker can be used to track the fertility restoration gene Rfn4 locus and to separate it from other restoration genes.

[0154] The test material was the cherry radish variety GiSi, which was hybridized with the sterile line YB-A to obtain F1. The F1 was self-pollinated to obtain the F2 population. Fertility investigation showed that this variety has two pairs of fertility restoration genes.

[0155] S1: Referring to the method in Example 1, the genotypes of individual plants in the F2 population were identified using molecular markers Rf-118, Rf-119, Rf-120, and Rf-122. The PCR amplification product of primer Rf-118 was only a 156 bp band, the PCR amplification product of primer Rf-119 was only a 115 bp band, the PCR amplification product of primer Rf-120 was only a 179 bp band, and the PCR amplification product of primer Rf-122 was only a 106 bp band. However, the plant fertility was actually fertile, namely GiSi-6. This indicates that the plant does not contain the restorer gene at the Rfn4 locus, but rather contains other fertility restorer genes.

[0156] S2: The single plant was used for three consecutive self-pollination generations to obtain the fertility-stable inbred line GiSi-6-4-2-2.

[0157] S3: The sterile line YB-A was used as the female parent and the inbred line GiSi-6-4-2-2 was used as the male parent to obtain F1. After self-pollination, the F2 population was obtained. The fertility survey showed that there were 132 fertile plants and 41 sterile plants, with a segregation ratio of 3:1, which is consistent with the genetic pattern of single gene inheritance, and the gene is a restorer gene different from the Rfn4 locus.

[0158] S4: Conventional gene mapping methods can be used to locate new fertility restorer genes.

[0159] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. Indel molecular markers closely linked to the radish NWB-CMS fertility restorer gene, including the first Indel molecular marker, the second Indel molecular marker, the third Indel molecular marker, and the fourth Indel molecular marker; The first Indel molecular marker has a size of 156 bp, and its nucleotide sequence is shown in SEQ ID NO: 1; and: the first Indel molecular marker has a size of 150 bp, and its nucleotide sequence is shown in SEQ ID NO: 2; The second Indel molecular marker has a size of 115 bp, and its nucleotide sequence is shown in SEQ ID NO: 3; and: the first Indel molecular marker has a size of 109 bp, and its nucleotide sequence is shown in SEQ ID NO: 4; The third Indel molecular marker has a size of 179 bp, and its nucleotide sequence is shown in Sequence 5; and: the third Indel molecular marker has a size of 171 bp, and its nucleotide sequence is shown in Sequence 6; The size of the fourth Indel molecular marker is 106 bp, and its nucleotide sequence is shown in Sequence 7; and: the size of the fourth Indel molecular marker is 90 bp, and its nucleotide sequence is shown in Sequence 8.

2. A primer set for identifying / assisting in identifying an Indel molecular marker tightly linked to the radish NWB-CMS fertility restorer gene, characterized in that: The Indel molecular marker is the first Indel molecular marker, the second Indel molecular marker, the third Indel molecular marker, and the fourth Indel molecular marker according to claim 1; The primer set used to identify / assist in identifying the first Indel molecular marker is: Forward primer: 5′- AGTGACGTGGCACTCTCAAA -3′; Reverse primer: 5′-TTTATCGTCGGCAAAATTTGATGA -3′; The primer set used to identify / assist in identifying the second Indel molecular marker is: Forward primer: 5′- CCCGAGAAAGCCTAACTGCT -3′; Reverse primer: 5′- AAGGAACAAAGGCCAAGGGT-3′; The primer set used to identify / assist in identifying the third Indel molecular marker is: Forward primer: 5′- CCACATACAGATTAACAGTGCCC-3′; Reverse primer: 5′- AGATTTCACTTTTGGGTTTTGGTTT -3′; The primer set used to identify / assist in identifying the fourth Indel molecular marker is: Forward primer: 5′- GGCATAGGTAGCAGGAGGC -3′; Reverse primer: 5′-TCCGTAAAACCCTAAACCGCA -3′.

3. A kit for identifying / assisting in identifying the radish NWB-CMS fertility restorer gene, characterized in that: The kit comprises any one of the primer set for identifying / assisting identification of the first Indel molecular marker, the primer set for the second Indel molecular marker, the primer set for the third Indel molecular marker, and the primer set for the fourth Indel molecular marker according to claim 2.

4. The kit for identifying / assisting in identifying the radish NWB-CMS fertility restorer gene according to claim 3, wherein: The kit further comprises at least one of a PCR amplification buffer, dNTPs, and Taq enzyme.

5. A method for identifying / assisting the identification of a radish NWB-CMS fertility restorer gene, characterized in that: The method comprises the steps of using the primer set for identifying / assisting the identification of an Indel molecular marker tightly linked to the radish NWB-CMS fertility restorer gene according to claim 2, or using the kit for identifying / assisting the identification of the radish NWB-CMS fertility restorer gene according to claim 3 or 4, to identify any one of the first Indel molecular marker, the second Indel molecular marker, the third Indel molecular marker, and the fourth Indel molecular marker tightly linked to the radish NWB-CMS fertility restorer gene according to claim 1; The method comprises using the radish genome as a template, employing the primer set for identifying / assisting indel molecular markers tightly linked to the radish NWB-CMS fertility restorer gene according to claim 2, performing a PCR amplification reaction on the radish genome, and then detecting and analyzing the PCR amplification product. If the PCR amplification result is any one of the following four types, the radish genome does not contain the fertility restorer gene: The primer set used to amplify the first Indel molecular marker only amplified a 156 bp band; The primer set used to amplify the second Indel molecular marker only amplified a 115 bp band; The primer set used to amplify the third Indel molecular marker only amplified a 179 bp band; The primer set used to amplify the fourth Indel molecular marker only amplified a 106 bp band.

6. The method for identifying / assisting identification of the radish NWB-CMS fertility restorer gene according to claim 5, wherein: The PCR amplification reaction procedure was as follows: 94°C, 4 min; 94°C 20 s, 60°C 20 s, 72°C 30 s, for a total of 35 cycles; 72°C, 10 min; and storage at 4°C.

7. The primer set for identifying / assisting the identification of an Indel molecular marker tightly linked to the radish NWB-CMS fertility restorer gene according to claim 2, the kit for identifying / assisting the identification of the radish NWB-CMS fertility restorer gene according to claim 3 or 4, the method for identifying / assisting the identification of the radish NWB-CMS fertility restorer gene according to claim 5 or 6, and their use in identifying / assisting the identification of the radish NWB-CMS fertility restorer gene.

Images