Synchronous multiple AAV titer detection method and kit capable of realizing dual-function application

Abstract

The invention relates to a synchronous multiple AAV titer detection method capable of realizing dual-function application and a kit, and belongs to the technical field of biological medicine industry. The primer probe set provided by the invention comprises an AAV-ITR primer probe set, an AAV5 primer probe set and an AAV8 primer probe set. Through verification, the invention realizes simultaneous and synchronous detection of a plurality of different AAV serotypes in the same system. The synchronous detection method or kit for multiple different AAV serotypes provides convenience for detection personnel to select and detect required serotypes according to specific requirements, saves materials and manpower cost, and provides wider economic and commercial practical values for distribution detection of AAV vectors or detection application of AAV pathogens.

Description

Technical Field

[0001] The present invention relates to a synchronous multiple AAV titer detection method and a kit with dual-function application, belonging to the fields of biopharmaceutical industry, gene therapy, molecular virology, molecular biology, virus detection, preclinical drug research, and drug analysis. Background Art

[0002] Adeno-associated virus (AAV) is the simplest, non-enveloped, single-stranded DNA virus discovered so far. It consists of a protein capsid and a 4.7kb single-stranded DNA genome. The capsid is 20-25nm long and belongs to the parvovirus family. In the field of biomedicine, as gene therapy has become increasingly popular in recent years, the utilization value of this type of virus and research related to drug development have attracted much attention. Adeno-associated virus has become one of the most widely used viral vectors in gene therapy. At present, the global AAV-related drug development pipeline is increasing, and several drugs using AAV as a vector have been approved for marketing. There are more than 3,200 AAV-related clinical trials underway, many of which are in the early stages and preclinical research stages.

[0003] AAV is a very common virus that is widely found in mammals such as humans, monkeys, and mice, as well as in a large number of invertebrates and birds. The widespread distribution of AAV in nature poses a challenge to the development of AAV drugs. For example, in addition to the distribution detection of AAV vector drugs in preclinical animal trials or human trials, it is also necessary to pre-screen the subjects for pre-existing antibodies or pre-infection with AAV viruses. However, AAV has multiple different serotypes, including AAV1, AAV2~AAV9, DJ, DJ / 8, Rh10, and at least 12 other serotypes. It has been reported that more than 100 serotypes of AAV have been found in nature (Flotte TR, Berns KI. Adeno-associated virus: a ubiquitous commensal of mammals. Hum Gene Ther. 2005 Apr; 16(4): 401-7.). The viral vectors currently used to develop gene therapy products are mainly AAV2, AAV5, AAV8, and AAV9. Since there are many serotypes of AAV, it is time-consuming and costly to conduct a single test on a single serotype of AAV.

[0004] The patent "A method for detecting multiple AAV virus titers" (application number: 201911408708X) proposes multiple AAV detection and also realizes multiple detection of dual AAV. However, the patent still targets the same AAV vector rather than vectors of different serotypes. It targets different combinations of sequences inserted into an AAV vector and expression frames of different gene insertions. It uses the sequence of the inserted gene expression frame, such as the sequence of the AP gene, to measure the titer of the AAV packaged by the first gene expression frame inserted and calibrate the titer of another AAV constructed by another gene insertion expression frame. Summary of the invention

[0005] Technical problems solved by the present invention: 1. Whether it is the nucleic acid level or the protein level, how to achieve the synchronous and simultaneous detection and differentiation of different target analytes (such as the genome sequences of different serotypes of AAV) in the same system is a challenging and complex technical problem. For example, for multiple protein detection, there is cross-interference between different antibodies or antibody pairs. For example, for nucleic acid-based detection of multiple serotypes of AAV, it is necessary to overcome the specificity, cross-talk, interference, self- or non-self-primer pairs, probes, etc. of different pairs of primer probes in the same reaction system to form dimers or polymers. The denaturation, annealing, and extension conditions for different primers, probes, and target sequences during the reaction are difficult to optimize and unify to an appropriate degree, which poses a realistic technical challenge.

[0006] 2. The selection and screening of specific target sequences for specific AAV serotypes, the consideration of sequence size, specificity, Tm value, and the interference of sequences of different AAV serotypes in detection in a reaction system are all challenges encountered in the implementation process of the technology of the present invention.

[0007] 3. During the design process of the present invention, it is necessary to consider not only the future detection application of the biological distribution of AAV as a gene therapy vector, but also the detection application of the titer of different serotypes of AAV in animals or humans.

[0008] 4. Different from basic research and academic research, the present invention also needs to consider the high technical standards required for industrial application research. At present, the accuracy of the detection method of different analytes being detected by the same reaction system is very limited. How to achieve high quantitative accuracy detection in industry is a challenging content of the present invention.

[0009] 5. The present invention uses the ddPCR method. The components, proportion adjustment, enzyme reagent selection, temperature optimization, etc. in the ddPCR reaction system are a complex process. ddPCR can save the tedious steps of preparing a standard curve for each target analyte, and uses digital droplets to achieve absolute quantification. Based on the ddPCR platform, it is a better technical combination to achieve simultaneous multiple detection of multiple AAVs of different blood types.

[0010] The technical solution adopted by the present invention is: In a first aspect, the present invention provides an AAV-ITR primer pair, which is used to amplify the ITR target sequence shown in SEQ ID No.10; the AAV-ITR primer pair consists of a first Primer-F forward primer and a first Primer-R reverse primer, the first Primer-F forward primer is the primer shown in SEQ ID No. 1, and the first Primer-R reverse primer is the primer shown in SEQID No. 2.

[0011] In a second aspect, the present invention provides an AAV-ITR primer probe set, comprising the AAV-ITR primer pair and a Taqman probe; the Taqman probe is a probe molecule having a luminescent group coupled to the 5' end and a quenching group coupled to the 3' end of the gene sequence shown in SEQ ID No. 3.

[0012] In a third aspect, the present invention provides the use of the AAV-ITR primer probe set in the preparation of a synchronous multiplex AAV titer detection product.

[0013] In a fourth aspect, the present invention provides an AAV5 primer pair, which is used to amplify the AAV5 target sequence shown in SEQ ID No. 11; the AAV5 primer pair consists of a second Primer-F forward primer and a second Primer-R reverse primer, the second Primer-F forward primer is the primer shown in SEQ ID No. 4, and the second Primer-R reverse primer is the primer shown in SEQ ID No.5.

[0014] In a fifth aspect, the present invention provides an AAV5 primer probe set, comprising the AAV5 primer pair and a BHQ probe; the BHQ probe is a probe molecule having a luminescent group coupled to the 5' end and a quenching group coupled to the 3' end of the gene sequence shown in SEQ ID No. 6.

[0015] In a sixth aspect, the present invention provides the use of the AAV5 primer probe set in the preparation of a synchronous multiplex AAV titer detection product.

[0016] In the seventh aspect, the present invention provides an AAV8 primer pair, which is used to amplify the AAV8 target sequence shown in SEQ ID No. 12; the AAV8 primer pair consists of a third Primer-F forward primer and a third Primer-R reverse primer, the third Primer-F forward primer is the primer shown in SEQ ID No. 7, and the third Primer-R reverse primer is the primer shown in SEQ ID No.8.

[0017] In an eighth aspect, the present invention provides an AAV8 primer probe set, comprising the AAV8 primer pair and the MGB probe; the MGB probe is a probe molecule having a luminescent group coupled to the 5' end and a quenching group coupled to the 3' end of the gene sequence shown in SEQ ID No. 9.

[0018] In a ninth aspect, the present invention provides the use of the AAV8 primer probe set in the preparation of a synchronous multiplex AAV titer detection product.

[0019] In a tenth aspect, the present invention provides a primer probe set, which includes the AAV-ITR primer probe set, the AAV5 primer probe set, and the AAV8 primer probe set.

[0020] In an eleventh aspect, the present invention provides the use of the primer probe set in the preparation of a synchronous multiplex AAV titer detection product.

[0021] Preferably, the synchronous multiple AAV titer detection product is a product that simultaneously detects multiple AAV virus titers of AAV5, AAV8, and a third AAV serotype different from AAV5 and AAV8 in the same system. For example, the third AAV serotype is AAV2 serotype.

[0022] Preferably, the synchronous multiple AAV titer detection product is a dual-function product integrating the biodistribution detection function and the titer detection function.

[0023] In a twelfth aspect, the present invention provides an AAV-ITR standard, wherein the AAV-ITR standard is the ITR target sequence shown in SEQ ID No. 10.

[0024] In a thirteenth aspect, the present invention provides an AAV5 standard, wherein the AAV5 standard is the AAV5 target sequence shown in SEQ ID No. 11.

[0025] In a fourteenth aspect, the present invention provides an AAV8 standard product, wherein the AAV8 standard product is the AAV8 target sequence shown in SEQ ID No. 12.

[0026] In a fifteenth aspect, the present invention provides a set of standards, which includes the AAV-ITR standard, the AAV5 standard, and the AAV8 standard.

[0027] In a sixteenth aspect, the present invention provides the use of the standard set in the preparation of a synchronous multiple AAV titer detection product.

[0028] In the seventeenth aspect, the present invention provides a synchronous multiplex AAV titer detection product, comprising: the primer probe set and the standard set.

[0029] Preferably, the method further comprises: a DNA diluent and a ddPCR Master Mix mixed component.

[0030] The present invention has the beneficial effects: The "multiple" of the present invention means that different AAV serotypes can be detected synchronously in the same system (single sample). The present invention proposes for the first time a method for synchronous detection of different AAV serotypes in the same reaction system. After verification, it was found that the present invention realizes the simultaneous and synchronous detection of multiple different AAV serotypes in the same system. The synchronous detection method or kit of multiple different AAV serotypes provides convenience for detection personnel to select the required serotype according to specific needs, saves material and labor costs, and provides a wider range of economic and commercial practical value for the distribution detection of AAV vectors or the detection application of AAV pathogens. Moreover, the present invention realizes accurate quantification on the basis of qualitative detection. In the future, users can realize detection for the purpose of distribution and detection of different serotypes of viruses or vectors, which has extremely high commercial value. DETAILED DESCRIPTION

[0031] The present invention is further described by the following embodiments. It should be understood that the following embodiments are only used to illustrate the present invention, but not to limit the present invention.

[0032] The present invention uses ddPCR technology to screen and design the primer and probe reaction conditions of three commonly used AAV serotypes (AAV5, AAV8, AAV2 or others) in detail, thereby realizing synchronous multiplexed virus titer detection of these three common serotypes at the genomic DNA level.

[0033] In order to achieve sequence-specific distinction on different genomes of multiple AAV serotypes and to be able to be quantitatively detected simultaneously in the same reaction tube (microdroplet), that is, the same reaction system, the present invention searches for and designs specific primer pairs and probes for the homology of the common ITR sequences of different serotypes and the differences of the Cap sequences, and adopts multiple different fluorescent labels to avoid the interference of these fluorescent signals during detection and affect the results. Based on the TaqMan probe method, BHQ probes and MGB probes are combined to design multiple probe molecules. For the common ITR sequences of AAV, the Cap sequences of AAV5 and AAV8, the 5'-end coupling luminescent groups are designed to be FAM, ROX, and VIC respectively, and the 3' ends of the ITR sequences and AAV5 are coupled with quenching groups TAMRA and BHQ-2 respectively, and the 3' end of AAV8 controls the detection of fluorescent signals during amplification based on the fluorescence resonance energy transfer of the MGB conjugate. The present invention relies on the design of primer pairs, the design of probe sequences, the pairing selection of fluorescent groups of probe sequences, and the correct combination of primer pairs and probes for different serotypes to achieve the final technical purpose of accurate multiple detection.

[0034] Primer and probe design: 1) Primer and probe set for AAV-ITR Primer-F forward primer (20 bases): 5' AACCCCTAGTGATGGAGTTG 3' (SEQ ID NO: 1) Primer-R reverse primer (16 bases): 5' GGCCTCAGTGAGCGAG3' (SEQ ID NO: 2) Taqman probe: 6-FAM 5' CACTCCCTCTCTGCGCGCTCG 3' TAMRA (SEQ ID NO: 3) 2) Primer and probe set for AAV5 Primer-F forward primer (20 bases): 5' CTTTAACCGCTTCCACAGCC3' (SEQ ID NO:4) Primer-R reverse primer (19 bases): 5' ACTCTGAGGGACCGGGGTC 3' (SEQ ID NO:5) BHQ probe: 6-ROX'AGACTGGCAAAGACTCA3' BHQ-2 (SEQ ID NO: 6) 3) Primer and probe set for AAV8 Primer-F forward primer (20 bases): 5' GCTCTTCAACATCCAGGTCAA3' (SEQ ID NO:7) Primer-R reverse primer (19 bases): 5' TGGTACTCCGAGTCCGTAAA3' (SEQ ID NO:8) MGB probe: 6-VIC' AAGACCATCGCCAATAACCTCACCAG3' MGB (SEQ ID NO:9) Specific target sequence amplified (150 bases): ITR target sequence (AAV-ITR, 59 bp) 5'AACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCC3' (SEQID NO:10) AAV5 target sequence (90 bp) 5'CTTTAACCGCTTCCACAGCCACTGGAGCCCCCGAGACTGGCAAAGACTCATCAACAACTACTGGGGCTTCAGACCCCGGTCCCTCAGAGT3' (SEQ ID NO: 11) AAV8 target sequence (105 bp) 5'GCTCTTCAACATCCAGGTCAAGGAGGTCACGCAGAATGAAGGCACCAAGACCATCGCCAATAACCTCACCAGCACCATCCAGGTGTTTACGGACTCGGAGTACCA3' (SEQ ID NO:12) Although ddPCR does not require standards to prepare standard curves, these target sequences are needed to prepare standards for preparing samples of known concentrations to examine the accuracy of concentration detection and recovery rates implemented by the technology or for preparing quality control samples. Therefore, the target sequences determined by the present invention and the combination of target sequences in the system have protection value in the technology of the present invention.

[0035] Instruments and Equipment 1) Digital droplet PCR instrument (QIAGEN, QIAcuity One 5Plex or equivalent); 2) Vortexer (IKA, LAB DANCER S000 or equivalent); 3) -10℃ ~ -30℃ refrigerator (Haier, DW-30L818, or equivalent substitute); 4) -60℃~ -90℃ refrigerator (Haier, DW-86L959BPT, or equivalent substitute); 5) Tabletop mini centrifuge (IKA, mini G, or equivalent); 6) 24-well plate, each well containing 8500 nanowells (QIAGEN, 250102, or equivalent); 7) 2~8℃ refrigerator (Midea, MC-4L1005, or equivalent substitute); 8) Pipette (Eppendorf, 0.1~2.5 µL, 0.5~10 µL, 2~20 µL, 10~100 µL, 20~200 µL, 100~1000 µL); 9) Biological safety cabinet (Haier, 1780-ⅡA2, or equivalent alternative).

[0036] Reagents and Materials 1) Plasmid standard containing AAV-ITR target sequence (Shanghai Bio-Tech, -60℃~ -90℃); 2) Plasmid standard containing AAV5 target sequence (Shanghai Biotechnology, -60℃~ -90℃); 3) Plasmid standard containing AAV8 target sequence (Shanghai Bio-Tech, -60℃~ -90℃); 4) Primer and probe set of AAV-ITR (Shanghai Bioengineering, -10℃ ~ -30℃); 5) Primer and probe set of AAV5 (Shanghai Bioengineering, -10℃ ~ -30℃); 6) Primer and probe set of AAV8 (Shanghai Bioengineering, -10℃ ~ -30℃); 7) QIAcuity® Probe PCR kit (QIAGEN, 250102 or other alternatives, -10℃ ~ -30℃); 8) AAV2 virus liquid (Fubaio Biotechnology, -60℃~ -90℃); 9) AAV5 virus liquid (Fubaio Biotechnology, -60℃~ -90℃); 10) AAV8 virus liquid (Fubaio Biotechnology, -60℃~ -90℃); 11) DNA diluent (BBI, Cat#: B639270-0010, -10℃~-30℃); 12) DNase / RNase-free double distilled water (Shanghai Bioengineering, Cat# B541018-0010, -10℃~-30℃); 13) ddPCR nano-microplate (can be equipped with different specifications).

[0037] Reaction system Table 1

[0038] Reaction steps Table 2

[0039] Sensitivity and quantitative range The quantitative range of the method of the present invention is 2.000×10 7 Copies / reaction or µg total RNA ~ 5.000×10 1 copies / reaction or µg total RNA, with a sensitivity of 50 copies / reaction or µg total RNA.

[0040] The main components of the detection kit formed by the present invention include: 1) Contains quality control calibration standards for AAV5, AAV8 serotypes and AAV-ITR sequences; 2) DNA diluent; 3) Primer pairs and probe set reagents for AAV5, AAV8 serotypes and AAV-ITR serotypes; 4) ddPCR Master Mix mixed components).

[0041] In summary, the method for simultaneous detection of multiple AAV different serotypes of the present invention is based on ddPCR technology for specific detail design and scheme and condition optimization. The advantage of developing a multiple AAV detection method based on ddPCR is that ddPCR can directly use the positive and negative numbers of the reaction droplets dispersed by the reaction to perform absolute quantification through Poisson distribution statistics, thereby eliminating the need for the cumbersome operation of preparing a standard curve for each detection target and each serotype. In addition, the multiple quantitative detection method can avoid the need to prepare a standard curve for each target analyte and save a lot of technical operation troubles, which is convenient for improving efficiency and greatly reducing the detection errors caused by too many artificial preparation procedures. This is another major advantage of the overall design of the technology of the present invention.

[0042] The following examples are further listed to illustrate the present invention in detail. It should also be understood that the following examples are only used to further illustrate the present invention and cannot be construed as limiting the scope of protection of the present invention. Some non-essential improvements and adjustments made by those skilled in the art based on the above content of the present invention all belong to the scope of protection of the present invention. The specific process parameters and the like in the following examples are only examples within a suitable range, that is, those skilled in the art can make selections within a suitable range through the description of this article, and are not limited to the specific values ​​​​exemplified below. The following examples are actual experimental tests using the technical solution of the present invention to prove the applicability, practicality and superior technical performance of the present invention.

[0043] Example 1: Specificity, accuracy and sensitivity of the detection method of the present invention Dilute the known concentrations of AAV-ITR target sequence standards and AAV5 and AAV8 target sequence standards with DNA diluent to a concentration of 1×10 3 The mixed sample was then diluted 10-fold and 2-fold to produce 1×10 2 The three samples with different concentrations thus prepared were used to prepare a reaction system according to the process of the technical solution of the present invention, and each sample was tested in three replicate wells according to the reaction conditions of the technical solution of the present invention.

[0044] 1. The preparation process is as follows: Configuration process 1): Table 3

[0045] Configuration process 2): Table 4

[0046] 2. Test results Because it is a simultaneous multiplex quantitative detection method, each sample well of the reaction will simultaneously detect the copy number concentration results (copy number / μL) of AAV-ITR, AAV5, and AAV8 in the reaction system; all the copy number concentration results are multiplied by the total volume of the reaction system 40 μL, and then all the tested samples are multiplied by the corresponding dilution factor and the initial 1×10 3 The recovery rate was calculated by comparing the theoretical concentration (copies / µL).

[0047] Table 5

[0048] It can be seen that the recovery rates are 120.3%, 97.0%, and 124.1%, respectively, which are very good and meet the acceptance standards of the industry. Moreover, from the test results of the test sample 3, it can be seen that based on the system described in the present invention, the copy number of the single digit or even the concentration of 1 point or several copies can be measured on ddPCR. After multiplying by the system volume and the dilution multiple, the confirmation result is particularly accurate, indicating that the method described in the present invention is very sensitive and accurate. According to this result, the different standards of the three targets can be completely distinguished, and the specificity is very good.

[0049] Example 2: Synchronous detection performance for distribution and different AAV serotypes Example 2 is based on the accuracy, specificity and sensitivity of the technical method of the present invention for detecting different serotypes and target sequences confirmed in Example 1. The quantitative and correction capabilities of ITR sequences based on AAV vectors of different serotypes are investigated by using the characteristics that different serotypes of AAV have ITR sequences and different serotypes of Cap have specificity, but the ITR sequences are consistent. The genomic DNA of AAV2, AAV5, and AAV8 with known concentrations is first diluted with DNA diluent to contain 1×10 5 The number of copies / µL was mixed, and then 10 times, 10 times and 20 times were used to generate 1×10 4 Copies / µL, 1×10 3 The samples with 50 copies / µL and 100 copies / µL were prepared as follows. The four samples with different concentrations were used to prepare the reaction system according to the process of the technical solution of the present invention, and each sample was tested in three replicate wells according to the reaction conditions of the technical solution of the present invention. The recovery rate was calculated by correcting the concentration as in the above embodiment.

[0050] Table 6

[0051] Discussion: The above results show that for AAV5 and AAV8, the recovery rates were 123.9% and 101.9% respectively based on the detection of their specific Cap sequences adopted by the present invention, indicating that the detection results are very accurate; ITR is a common sequence possessed by the three serotypes, so the recovery rate is 305.8%, which is exactly three times that of a single serotype and is completely correct; the total copy number concentration measured by ITR is deducted from the respective copy numbers of AAV2 and AAV8, so the remaining copy number is the copy number of AAV2, and the final calculated copy number of AAV2 is 79.9% compared with the theoretical concentration, which is very accurate; all recovery rate deviations are within ±25%, meeting the technical standard requirements for research and development in the pharmaceutical industry.

[0052] Example 3: Refer to Example 1 and replace AAV8 with AAV9 The specific steps and preparation are exactly the same as those in Example 1, except that the standard containing the AAV-ITR target sequence of known concentration and the target sequence standard of AAV5 and AAV9 are diluted with DNA diluent to contain 1×10 3 The mixed sample was then diluted 10-fold and 2-fold to produce 1×10 2The three samples with different concentrations were prepared in this way to prepare the reaction system according to the process of the technical solution of the present invention, and each sample was tested in three replicate wells according to the reaction conditions of the technical solution of the present invention. The test results are shown in the following table.

[0053] AAV9 forward primer: 5'CTCATCAACAACAACTG3' (SEQ ID NO: 13) AAV9 reverse primer: 5'GCTGGTAAGGTTATTGGC3' (SEQ ID NO: 14) AAV9 target sequence: 5'CTCATCAACAACAACTGGGGATTCCGGCCTAAGCGACTCAACTTCAAGCTCTTTAACATTCAGGTCAAAGAGGTTACGGACAACAATGGAGTCAAGACCATCGCCAATAACCTTACCAGC3' (SEQ ID NO: 15)

[0054] Table 7

[0055] Discussion: As shown in the above results, although the preparation and experimental steps used are exactly the same as those in Example 1, except that AAV8 is replaced by AAV9, the detection accuracy (the recovery rate is up to 180%) is much worse than that in Example 1, which cannot meet the requirements of industrial use.

[0056] Therefore, through the technology of the present invention, different serotypes such as AAV5 and AAV8 can be quantitatively detected based on the viral genome based on the Cap sequence specificity of different serotypes of AAV5 and AAV8; synchronously, the total copy number of different AAV serotypes or vectors mixed together (except for the random third AAV serotype of AAV5 and AAV8) can be quantified based on the public ITR sequence, and the total ITR copy number can be deducted from the copy number of AAV5 and AAV8 based on their own Cap sequence to infer the copy number of the third serotype virus vector (specifically AAV2 in the embodiment). Similarly, the copy number titer of the virus mixed with AAV5 and AAV8 can also be detected by this method, not limited to AAV2. The ITR sequence of the present invention can be used for the detection of gene therapy products based on AAV as a vector, because many gene therapy products of AAV vectors must retain the ITR sequence; the detection of the Cap sequence based on AAV5 and AAV8 can also realize the detection of different AAV infection titers of individuals such as animals and humans at the same time, and the total copy number of the ITR sequence can be used to deduct the copy number of the other two serotypes. The method can also detect the third AAV serotype. Therefore, this test can achieve simultaneous bifunctional and multiplex detection of AAV viruses or vectors in 2 to 3 sera.

Claims

1. A primer probe set, characterized in that: The primer probe set includes an AAV-ITR primer probe set, an AAV5 primer probe set, and an AAV8 primer probe set; wherein: The AAV-ITR primer probe set includes an AAV-ITR primer pair and a Taqman probe; the AAV-ITR primer pair is used to amplify the ITR target sequence shown in SEQ ID No. 10; the AAV-ITR primer pair consists of a first Primer-F forward primer and a first Primer-R reverse primer, the first Primer-F forward primer is the primer shown in SEQ ID No. 1, and the first Primer-R reverse primer is the primer shown in SEQ ID No. 2; the Taqman probe is a probe molecule having a luminescent group coupled to the 5' end and a quenching group coupled to the 3' end of the gene sequence shown in SEQ ID No. 3; The AAV5 primer probe set includes an AAV5 primer pair and a BHQ probe; the AAV5 primer pair is used to amplify the AAV5 target sequence shown in SEQ ID No. 11; the AAV5 primer pair consists of a second Primer-F forward primer and a second Primer-R reverse primer, the second Primer-F forward primer is the primer shown in SEQ ID No. 4, and the second Primer-R reverse primer is the primer shown in SEQ ID No. 5; the BHQ probe is a probe molecule having a luminescent group coupled to the 5' end and a quenching group coupled to the 3' end of the gene sequence shown in SEQ ID No. 6; The AAV8 primer probe set includes an AAV8 primer pair and an MGB probe; the AAV8 primer pair is used to amplify the AAV8 target sequence shown in SEQ ID No. 12; the AAV8 primer pair consists of a third Primer-F forward primer and a third Primer-R reverse primer, the third Primer-F forward primer is the primer shown in SEQ ID No. 7, and the third Primer-R reverse primer is the primer shown in SEQ ID No. 8; the MGB probe is a probe molecule with a luminescent group coupled to the 5' end and a quenching group coupled to the 3' end of the gene sequence shown in SEQ ID No.

9.

2. Use of the primer-probe set according to claim 1 in the preparation of a synchronous multiplex AAV titer detection product.

3. The use according to claim 2, characterized in that: The synchronous multiple AAV titer detection product is a product that can simultaneously detect the titers of multiple AAV viruses including AAV5, AAV8, and a third AAV serotype different from AAV5 and AAV8 in the same system.

4. The use according to claim 2, characterized in that: The synchronous multiplex AAV titer detection product is a dual-function product integrating the biodistribution detection function and the titer detection function.

5. A set of standard products, characterized in that: The standard set includes AAV-ITR standards, AAV5 standards, and AAV8 standards; the AAV-ITR standard is the ITR target sequence shown in SEQ ID No. 10; the AAV5 standard is the AAV5 target sequence shown in SEQ ID No. 11; and the AAV8 standard is the AAV8 target sequence shown in SEQ ID No.

12.

6. Use of the standard sample set according to claim 5 in the preparation of a synchronous multiple AAV titer detection product.

7. A synchronous multiple AAV titer detection product, characterized in that: include: The primer-probe set according to claim 1 and the standard set according to claim 5.

8. The synchronous multiple AAV titer detection product according to claim 7, characterized in that: Also includes: DNA diluent and ddPCR Master Mix components.

Images