Adeno-associated viral vectors capable of delivering specific genes to lung bronchus

Abstract

The invention provides a mutant of adeno-associated virus serotype 1 (AAV1) capsid protein, nucleic acid for coding the AAV1 capsid protein mutant, a recombinant AAV1 vector carrying the nucleic acid for coding the AAV1 capsid protein mutant, and a pharmaceutical composition containing the vector. Wherein the mutant has a specific amino acid substitution at a position compared to the amino acid sequence of a wild-type AAV capsid protein. Specifically, a recombinant viral vector carrying a nucleic acid encoding an AAV1 capsid protein mutant can enhance the expression of an introduced gene in the pulmonary bronchial tube when delivered through the bronchial tube in an aerosol state, and thus can be used for preventing or treating diseases associated with the pulmonary bronchial tube.

Description

Technical Field

[0001] The present invention relates to mutants of adeno-associated virus (AAV) capsid protein, which are particularly useful for expressing introduced genes in lung bronchi when a recombinant viral vector containing the mutant AAV1 capsid protein is delivered through the bronchi in an aerosol state. Background Art

[0002] In order to effectively carry out gene therapy, it is imperative to develop gene delivery technologies that can deliver therapeutic genes to desired target cells and achieve high expression efficiency.

[0003] Among these gene delivery technologies, AAV is a non-pathogenic virus with no side effects on invaded infected cells and a low probability of causing mutations in the genetic information of target cells. Compared with other gene therapy technologies, AAV has more advantages in terms of safety.

[0004] Adeno-associated virus (AAV) is a non-enveloped, single-stranded DNA virus that can infect both dividing and non-dividing cells. AAV can replicate only in the presence of a helper virus and is non-pathogenic to humans. Due to these properties, AAV is a useful method for introducing genes into various cells and can be used as a useful vector for gene therapy.

[0005] It is known that AAV has multiple serotypes, and the characteristics of the host or virus vary depending on the serotype. Serotype 2 (AAV2) is a serotype that has been widely studied for a long time, and it can infect a variety of cells. Serotype 1 (AAV1), serotype 5 (AAV5), and serotype 6 (AAV6) are serotypes that are specific to infection of more tissues. It is known that AAV1 has high efficiency in gene introduction into muscle, liver, trachea, and central nervous system, AAV5 has high efficiency in gene introduction into the central nervous system, liver, and retina, and AAV6 has high efficiency in gene introduction into the heart, muscle, and liver. Although the characteristics of gene delivery to specific tissues vary depending on the serotype, it is still easy to transfer to other tissues, so it can be said that it is crucial to develop new AAV vectors that can improve safety and efficiency by enhancing tissue specificity.

[0006] Meanwhile, bronchitis and bronchiectasis are the main diseases that occur in the bronchial tubes of the lungs. In particular, bronchiectasis can cause complications such as hemoptysis (symptoms of coughing up blood or blood mixed in sputum), persistent dyspnea, respiratory failure, etc., and therefore requires prompt diagnosis and treatment. Hemoptysis is a potentially life-threatening complication of bronchiectasis, and bronchial artery embolization or surgical treatment can be considered to control hemoptysis.

[0007] Although attempts have been made to improve gene transfer efficiency by modifying the AAV capsid protein, there are no reports on AAV targeting the lung bronchi.

[0008] [Related technical literature]

[0009] [Patent Document]

[0010] International Publication No. WO / 2017 / 201121 (November 23, 2017)

[0011] Japanese Patent Publication No. 2021-0010372 (February 4, 2021) Summary of the invention

[0012] [Technical issues]

[0013] Therefore, the inventors of the present invention have made great efforts to solve the above-mentioned problems and completed the present invention by developing a protein variant based on a novel adeno-associated virus (AAV) serotype 1 capsid that targets the lung bronchi, which has the potential to deliver gene therapeutic agents and solves the root genetic causes of lung bronchial diseases such as bronchitis or bronchiectasis.

[0014] Therefore, the present invention aims to provide mutants of AAV1 capsid protein to improve the efficiency of gene transfer to target tissues or cells and / or the efficiency of expressing genetic information through recombinant AAV.

[0015] The present invention also aims to provide nucleic acids encoding AAV1 capsid protein mutants.

[0016] The present invention also aims to provide a recombinant AAV1 vector comprising a nucleic acid encoding an AAV1 capsid protein mutant.

[0017] The present invention also aims to provide a pharmaceutical composition comprising a recombinant AAV1 vector.

[0018] The present invention also aims to provide a gene delivery vehicle comprising a recombinant AAV1 vector.

[0019] [Technical solution]

[0020] The present invention will be described in detail below.

[0021] The present invention relates to mutants of adeno-associated virus serotype 1 (AAV1) capsid protein.

[0022] The term "adeno-associated virus" or "AAV" as used herein refers to all adeno-associated viruses used for gene therapy, including derivatives, viral subtypes, and naturally occurring and recombinant forms thereof. Various AAV serotypes can be used as recombinant gene delivery viruses for transducing different types of cells. The genomic sequences of various AAV serotypes are known in the art, as well as the sequences of natural terminal repeats (TRs), Rep proteins, and capsid subunits. These sequences can be found in public databases such as the literature or GenBank. For example, reference can be made to GenBank accession numbers NC_002077 (AAV-1) and AF063497 (AAV-1).

[0023] As used herein, the term "serotype" can be identified by serological or DNA sequencing methods and refers to a subpopulation of AAV that can be distinguished by its antigenic properties.

[0024] The term "capsid" as used herein is a protein encoded by the cap gene present in the viral genome, and refers to a protein that constitutes the viral coat. The wild-type AAV genome or cap gene encodes three types of capsid proteins (VP1, VP2, and VP3). The wild-type AAV1 capsid protein comprises an amino acid sequence represented by SEQ ID NO: 1.

[0025] In one embodiment, the present invention provides a mutant of an adeno-associated virus serotype 1 (AAV1) capsid protein, wherein the mutant is an AAV1 capsid protein mutant in which one or more of the amino acids at positions 326, 452, and 456 of the amino acid sequence represented by SEQ ID NO: 1 of the wild-type AAV1 capsid protein is substituted.

[0026] In one embodiment, the present invention provides a mutant of an AAV1 capsid protein, wherein the mutant is an AAV1 capsid protein mutant in which the threonine at position 326 is substituted by alanine and the glutamine at position 452 is substituted by proline in the amino acid sequence of the wild-type AAV1 capsid protein represented by SEQ ID NO: 1.

[0027] In one embodiment, the present invention is a mutant of an AAV1 capsid protein, wherein the mutant is an AAV1 capsid protein mutant in which alanine at position 456 in the amino acid sequence represented by SEQ ID NO: 1 of the wild-type AAV1 capsid protein is substituted by threonine.

[0028] In one embodiment, the mutant of the AAV1 capsid protein according to the present invention comprises the amino acids represented by SEQ ID NO:2 or SEQ ID NO:3, or consists of the amino acids represented by SEQ ID NO:2 or SEQ ID NO:3.

[0029] In one embodiment of the present invention, the AAV1 capsid protein mutant represented by SEQ ID NO:2 is named #3-32, and the AAV1 capsid protein mutant represented by SEQ ID NO:3 is named #3-65.

[0030] The term "wild type" as used herein refers to the most common type in wild populations. For mutant types, wild type refers to the phenotype or individual that is considered to be the basis. Wild type is also called "normal type". At the same time, "mutant" as used herein refers to a protein, virus, cell or individual produced by a characteristic change in a mutant gene. In addition, "mutant" as used herein may also refer to the gene itself that causes the mutation.

[0031] In one embodiment, the present invention includes a nucleic acid encoding an AAV1 capsid protein mutant. The nucleic acid of the present invention encodes an AAV1 capsid protein mutant. The nucleic acid of the present invention is prepared by replacing at least one base in the base sequence of the nucleic acid encoding the AAV1 capsid protein (cap gene) with another base. The nucleic acid of the present invention may exist in the form of DNA, but may also exist in the form of RNA or a chimera of DNA and RNA. In addition, the nucleic acid of the present invention also includes complementary nucleic acids (e.g., cDNA). The nucleic acid of the present invention may be single-stranded or double-stranded, and is preferably double-stranded.

[0032] The present invention provides a nucleic acid encoding an AAV1 capsid protein mutant, wherein the AAV1 capsid protein consists of an amino acid sequence represented by SEQ ID NO:2 or SEQ ID NO:3, and although not particularly limited, as an embodiment, a nucleic acid having a base sequence represented by SEQ ID NO:4 or SEQ ID NO:5 is taken as an example.

[0033] The nucleic acid of the present invention can be operably linked to a suitable control sequence. Control sequences include promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, internal ribosome entry sites (IRES) and enhancers. Promoter sequences include inducible promoter sequences and constitutive promoter sequences. Control sequences can be unique to the AAV that produces the capsid protein, or they can be foreign, natural or synthetic. The present invention also includes recombinant DNA comprising the nucleic acid of the present invention, which is capable of expressing mutants of the AAV1 capsid protein.

[0034] Recombinant DNA can be used to deliver the nucleic acid of the present invention to cells in vitro, ex vivo and in vivo, and to confer the ability of the corresponding cells to express AAV1 capsid protein mutants. In addition, cells delivered with the nucleic acid of the present invention can be used to produce recombinant AAV particles. Recombinant DNA can be used to deliver or introduce the nucleic acid of the present invention into, in particular, eukaryotic cells, preferably animal cells, and more preferably mammalian cells.

[0035] In the present invention, recombinant DNA can be prepared by using DNA used as a vector to carry the nucleic acid of the present invention. For example, as recombinant DNA, plasmid, phage, transposon, cosmid, episomal DNA or viral genome can be used.

[0036] For example, a packaging plasmid can be produced by carrying a nucleic acid (cap gene) encoding an AAV1 capsid protein mutant of the present invention in a plasmid. The packaging plasmid can also include any nucleic acid sequence, such as a nucleic acid (rep gene) encoding a replicase (Rep) protein. Preferably, the rep gene includes AAV2-derived Rep.

[0037] In the nucleic acid sequence of the cap gene contained in the known packaging plasmid, at least one base in the PLA2 domain coding region is replaced with another base, and a recombinant DNA containing the nucleic acid of the present invention can also be prepared. The packaging plasmid is not particularly limited, but the embodiment includes a packaging plasmid carrying a cap gene, preferably a packaging plasmid carrying a cap gene and a rep gene. In one embodiment, in the present invention, a recombinant AAV1 vector p#3-32 or p#3-65, represented by SEQ ID NO: 6 or SEQ ID NO: 7, is constructed as a packaging plasmid carrying a nucleic acid encoding the AAV1 capsid protein mutant of the present invention (cap gene) and a rep gene.

[0038] The method of introducing a substituted base into a nucleic acid can be performed by a known method, and can be accomplished, but is not particularly limited to, by performing PCR using a commercially available reagent such as a Mutagenesis Basic Kit (TAKARA BIO INC.) according to the instructions included in the kit.

[0039] Therefore, the present invention provides a recombinant AAV1 vector comprising a nucleic acid encoding an AAV1 capsid protein variant.

[0040] The recombinant AAV vector of the present invention can be used to introduce genes into target cells. The genes introduced into the recombinant AAV vector of the present invention are strongly expressed in target cells.

[0041] As used herein, "AAV vector" refers to any vector comprising or derived from components of an adeno-associated virus (AAV) and suitable for infecting any mammalian cell, including human cells of various tissue types, such as the brain, heart, lung, skeletal muscle, liver, kidney, spleen or pancreas, whether in vitro or in vivo. The term "AAV vector" may be used to refer to an AAV-type viral particle (or virion) comprising at least one nucleic acid molecule encoding a protein of interest.

[0042] As used herein, "AAV virus", "AAV virus particle" or "rAAV vector particle" refers to a virus particle composed of at least one AAV capsid protein (e.g., any capsid protein of wild-type AAV) and a polynucleotide rAAV vector encapsulated in the capsid. When the particle contains a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene delivered to a mammalian cell), it is generally referred to as a "rAAV vector particle" or simply "rAAV vector". Therefore, the production of rAAV particles must include the production of rAAV, because such a vector is contained in the rAAV particle.

[0043] "Packaging" refers to the series of intracellular events that lead to the assembly and encapsidation of AAV particles.

[0044] The "rep" and "cap" genes of AAV refer to polynucleotide sequences encoding the replication protein and capsid protein of AAV. In this specification, the rep and cap of AAV are referred to as AAV "packaging genes".

[0045] AAV "helper virus" refers to a virus that allows AAV (e.g., wild-type AAV) to replicate and package in mammalian cells. Various AAV helper viruses are known in the art, such as adenovirus, herpes virus, and pox virus (e.g., vaccinia). Although subgroup C adenovirus serotype 5 is the most commonly used, adenovirus includes several different subgroups. Many adenoviruses derived from humans, non-human mammals, and birds are known and can be obtained from depositories such as ATCC. Herpes viruses include not only, for example, herpes simplex virus (HSV) and Epstein-Barr virus (EBV), but also cytomegalovirus (CMV) and pseudorabies virus (PRV); and these viruses can also be obtained from depositories such as ATCC.

[0046] "Helper virus function" refers to the function encoded in the helper virus genome that allows AAV replication and packaging (as well as other requirements for replication and packaging described herein). As described herein, "helper virus function" can be provided in various ways, including providing a helper virus, or, for example, providing a polynucleotide sequence encoding the necessary function to the production cell in a transfection. For example, a plasmid or another expression vector containing a nucleotide sequence encoding one or more adenoviral proteins is transfected into the production cell together with the rAAV vector.

[0047] In one embodiment, the AAV1 vector according to the present invention has improved transduction properties for target tissues compared to an AAV1 vector comprising a wild-type capsid protein. That is, the AAV1 vector according to the present invention has significant tissue targeting ability (eg, tissue tropism).

[0048] As used herein, the term "tropism" refers to the specificity of the AAV capsid protein present in the AAV viral particle for infecting or transducing a particular type of cell or tissue.

[0049] The tropism of the AAV capsid for a particular cell or tissue type can be determined by measuring the ability of the AAV vector particles to transfect or transduce a particular cell or tissue type due to the AAV1 capsid protein therein using standard assays well known in the art, such as those described in the Examples herein.

[0050] That is, "tropism" refers to the ability of an AAV vector or virion to infect one or more specific cell types. However, it can also include whether the vector is used to transduce one or more specific cell types. That is, tropism refers to the expression (e.g., transcription, in some cases translation) of a sequence delivered by an AAV vector or virion depending on the situation, and preferably in a cell, for example, in the case of a recombinant virus, after the AAV vector or virion is preferentially introduced into a specific cell or tissue type and / or preferentially interacts with the cell surface to facilitate entry into a specific cell or tissue type. After expressing a heterologous nucleotide sequence.

[0051] The term "transduction" as used herein refers to the ability of an AAV vector or virion to infect one or more specific cell types. That is, transduction means introducing an AAV vector or virion into a cell to deliver the genetic material contained in the AAV vector or virion into the cell, thereby achieving expression of the vector genome. In some cases (but not all cases), transduction and tropism may be related.

[0052] The AAV of the present invention comprises one or more amino acid modifications in the capsid protein, which impart new or enhanced tissue tropism properties. The AAV1 variant according to the present invention targets the lung bronchi.

[0053] The term "pulmonary bronchial tropism" used in the present specification refers to tropism for pulmonary bronchus.

[0054] In some embodiments, the lung bronchial tropism of the peptide-modified hybrid AAV capsid protein is further increased by at least 5%, 10%, 20%, 30%, 40% or 50% or more compared to the lung bronchial tropism of the wild-type AAV capsid protein without the peptide.

[0055] In addition, the present invention may include a pharmaceutical composition comprising a recombinant AAV1 vector. The composition may further include a pharmaceutically acceptable carrier.

[0056] "Pharmaceutically acceptable carrier" includes any material that allows the active ingredient of the composition to retain biological activity when combined with the ingredient and does not cause adverse physiological reactions (such as unintended immune responses). Pharmaceutically acceptable carriers include water, phosphate buffered saline, emulsions (such as oil / water emulsions) and wetting agents. Compositions containing these carriers are formulated by well-known conventional methods, such as those described in Remington's Pharmaceutical Sciences, current Ed., Mack Publishing Co., Easton Pa. 18042, USA; A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) HC Ansel et al., 7th edition, Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) AK Kibbe et al., 3rd edition. Amer. Pharmaceutical Assoc.

[0057] In one embodiment, the pharmaceutical composition according to the present invention may be a pharmaceutical composition for preventing or treating pulmonary bronchial diseases, specifically bronchitis or bronchiectasis.

[0058] The term "treatment" as used herein refers to administering an active agent to a subject in any type of intervention or process to reverse, alleviate, ameliorate, inhibit, delay or prevent the progression, development, severity or recurrence of a disease-related syndrome, complication, symptom or biochemical sign. Treatment can be performed on a subject with a disease or a subject without a disease (e.g., for prevention).

[0059] Furthermore, in one embodiment, the present invention includes a method for preventing or treating pulmonary bronchial diseases (particularly bronchitis or bronchiectasis), comprising administering to a subject a therapeutically effective amount of the pharmaceutical composition.

[0060] As used herein, "administering" refers to physically introducing a therapeutic agent or a composition comprising a therapeutic agent into a subject using any of a variety of methods and delivery systems known to those of ordinary skill in the art. Preferred routes of administration include parenteral routes of administration, such as intravenous, intraperitoneal, intramuscular, subcutaneous, intrathecal, intravitreal routes of administration, such as by injection or infusion. As used herein, the phrase "parenteral administration" generally refers to methods of administration other than intestinal and local injection administration, which may be, but is not limited to, intravenous, intraperitoneal, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, transtracheal, subcutaneous, subcutaneous, intravitreal, intraarticular, subcapsular, subarachnoid, intraspinal, epidural or intrasternal injection or infusion, or in vivo electroporation. In a specific embodiment, the AAV vector of the present invention was administered to the respiratory tract in the form of an aerosol by animal experiments using pigs, confirming that the AAV vector is capable of bronchial-specific gene delivery.

[0061] As used herein, the term "therapeutically effective amount" refers to an amount of a drug that, when used alone or in combination with a different therapeutic agent, is effective in "treating" a disease or condition in a subject, or reducing the risk, potential, likelihood, or occurrence of a disease or condition (e.g., pulmonary hypertension). A "therapeutically effective amount" includes an amount of a drug or therapeutic agent that provides some improvement or benefit to a subject suffering from a disease or condition (e.g., pulmonary hypertension disclosed herein) or at risk of a disease or condition. Thus, a "therapeutically effective amount" is an amount that reduces the risk, potential, likelihood, or occurrence of a disease or condition, or provides some relief or reduction, and / or reduces at least one indicator (e.g., lung bronchial disease), and / or reduces at least one clinical symptom of a disease or condition.

[0062] The term "subject" as used herein includes humans or non-human animals. The term "non-human animals" includes all vertebrates, including mammals, non-human primates, sheep, dogs, cows, chickens, and non-mammals such as amphibians and reptiles.

[0063] In addition, the present invention may also include a drug delivery vector comprising a recombinant AAV1 vector. The composition may also include a known pharmaceutically acceptable carrier for the above-mentioned applications.

[0064] The AAV1 vector of the present invention exhibits bronchial tropism and has the ability to specifically express genes in the bronchial tubes, and thus can be used as a vector for delivering drugs to the bronchial tubes. Specifically, the AAV1 vector of the present invention can be used as an AAV1 vaccine for infectious agents that infect the respiratory tract. Existing vaccines injected intravenously have the disadvantage of spreading throughout the body, thereby reducing the possibility of producing antibodies in the lung or respiratory tract area, but when the vector of the present invention is used to deliver genes, the efficiency of gene expression can be improved near the respiratory tract where the infectious agent first contacts, thereby improving mucosal immunity compared to existing vaccines.

[0065] [Beneficial Effects]

[0066] The present invention relates to a recombinant AAV1 capsid variant capable of achieving efficient gene delivery by specifically targeting the lung bronchi, and a recombinant viral vector comprising a nucleic acid encoding an AAV1 capsid protein mutant, which, when delivered through the bronchi in an aerosol state, can be used to express the introduced gene in cells targeted to the lung bronchi, thereby preventing or treating lung bronchial diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 Shown is a comparison of the packaging efficiency of wild-type AAV1 and recombinant AAV1 vectors of the present invention (#3-32 and #3-65 variants) by quantitative PCR analysis of genome titers.

[0068] Figure 2 Shown is the improvement in HEK293T transduction efficiency analyzed by the proportion of cells expressing GFP among total cultured cells.

[0069] Figure 3 shows the results of effective local delivery in lung tissue, where LacZ expression was confirmed by staining lungs taken from 8-week-old C57BL / 6 male mice using whole-body β-galactosidase to confirm the lung bronchial specificity of the recombinant AAV1 vectors (#3-32 (a) and #3-65 (b) variants).

[0070] FIG. 4 shows LacZ expression of recombinant AAV1 vectors (#3-32 (a) and #3-65 (b) variants) in lung bronchi by eosin / LacZ staining to confirm lung bronchi specificity.

[0071] Figures 5A and 5B show the cleavage maps of AAV1 vectors (#3-32 and #3-65 variants), respectively.

[0072] Figure 5C shows the cleavage map of the phelper plasmid.

[0073] Figure 5D shows the cleavage map of the pCMV GFP plasmid.

[0074] Figure 5E shows the cleavage map of the pCMV LacZ plasmid.

[0075] Figure 6 Shown are the results of injecting a recombinant AAV1 vector (#3-65 variant) through the airways of pigs to confirm lung bronchial specificity. DETAILED DESCRIPTION

[0076] The present invention will be further described in detail below in conjunction with the embodiments of the present invention, but the scope of the present invention is not limited to the embodiments given below.

[0077] [Example]

[0078] Example 1: Selection and construction of AAV1 capsid protein variants

[0079] 1) Selection of AAV1 capsid protein variants

[0080] The plasmid library was generated by inducing random point mutations in the cap gene of each wild-type AAV variant (AAV1, AAV2, AAV4, AAV6, AAV8 and AAV9) using error-prone PCR and inserting random 7-mer / 9-mer into the 3-fold protrusion region of each serotype. After forming calcium phosphate complexes using 7ng to 70ng AAV plasmid library, 25μg pBluescript, 25μg p helper plasmid, the calcium phosphate complexes were transfected into AAV293 cells for AAV packaging to generate an AAV library pool carrying the cap gene information of each variant.

[0081] After 8-week-old C57BL / 6 male mice were anesthetized with isoflurane inhalation, an incision of approximately 1 cm was made in the skin over the trachea area. 11 vg / 100 μL PBS solution of AAV library pool was loaded into PenWu microatomizer (BioJane, Shanghai, China) (length of intratracheal part: 1.25", outer diameter: 700 μm, inner diameter: 430 μm), and intratracheal injection was performed while confirming that the needle passed through the airway.

[0082] One week later, 0.9% saline was perfused into the heart and the lungs were removed. After homogenization, DNA was extracted from the whole lung using a DNA mini kit (Qiagen), and the cap gene of the AAV variant showing tropism for the whole lung was amplified using the AAV cap gene-specific forward primer 5′-GCGGAAGCTTCGATCAACTACG-3′ (SEQ ID NO: 8) and the reverse primer 5′-CGCAGAGACCAAAGTTCAACTGA-3′ (SEQ ID NO: 9). Using the same method as described above, a lung-tropic AAV library was constructed using the gene for intratracheal injection. One week later, perfusion and lung extraction were performed, and the lungs were cut into small pieces for 30 seconds before cell dissociation using collagenase II. DNase I was added here to prevent cell aggregation caused by chromosomal DNA released by dead cells, thereby minimizing cell loss. After incubation at 37°C for 4 to 6 hours, the overall lung cell population in the form of single cells was obtained by pipetting, red blood cell lysis was performed at room temperature in the dark, and the cells were transferred to FACS buffer through a cell filter with a pore size of 70 μm. After that, in order to select AAV variants that show local tropism in lung tissue, 10 μg of α-sma-APC antibody (anti-α smooth muscle actin antibody) was added, and then incubated at 4°C. Subsequently, APC-positive cells were sorted, bronchial-related cells were selected, and after cell lysis and DNA extraction, the cap gene of the AAV variant entering the cell was amplified using the above-mentioned AAV cap gene-specific primer information. This generated a secondary AAV library, and the intratracheal injection and sorting operations were performed in the same way. After three rounds of in vivo selection, the final amplified cap gene was subcloned into the pSub2 plasmid containing HindIII and NotI sequences at both ends by HindIII / NotI restriction enzyme digestion and ligation, and electroporated into DH10β. The plasmid was subsequently purified (Qiagen Plasmid Maxi Kit) and maintained as a bronchial tropism plasmid pool (pSub2 is a plasmid based on pSub201 (ATCC) generated in David Schaffer Lab (University of California, Berkeley)), and the cap gene was subcloned using HindIII and NotI, references 1. Narendra Maheshri et al., Nature Biotechnology, 2006; 2. James T Koerber, Nature Protocols, 2006).

[0083] 2) Construction of recombinant AAV1 vectors (AAV1 #3-32 and #3-65 variants)

[0084] ① Construction of packaging plasmid mutants

[0085] The construction of multiple bronchial-specific plasmid mutants for loading reporter genes was completed by subcloning multiple bronchial-tropic cap genes into a vascular-tropic plasmid library by restriction digestion with HindIII and NotI in pXX2 (University of California, Berkeley, David Schaffer Lab), and HindIII and NotI were introduced in pXX2 for cap gene insertion.

[0086] ② Plasmid transfection into AAV293 cells

[0087] Construction of AAV1 #3-32 and #3-65 variants

[0088] 17 μg of mutant plasmid, 17 μg of ITR-flanked reporter gene (pCMV-GFP, pCMV-LacZ or pCMV-FGF12-IRES-GFP) and 17 μg of p helper plasmid were formed into calcium phosphate complexes and transfected into AAV293 cells. After about 48 hours, only the cell pellet was collected, and then the intracellular AAV was extracted from it by freezing and thawing. Subsequently, the cell debris was removed by centrifugation, and 10 U / mL nuclease was added and incubated at 37°C for 30 minutes to remove nucleic acids derived from virus-producing cells.

[0089] The cleavage diagrams of the constructed AAV1#3-32 and #3-65 variants are shown in Figures 5A and 5B, and the complete base sequences of the AAV1#3-32 and #3-65 variants are shown below.

[0090] AAV-2Rep gene #3-32 Cap gene Ampicillin resistance (bla) gene (SEQ ID NO:6)

[0091] ATGGCTGCCGATGGTTATCTTCCAGATTGGCTCGAGGACAACCTCTCTGAGGGCATTCG CGAGTGGTGGGACTTGAAACCTGGAGCCCCGAAGCCCAAAGCCAACCAGCAAAAGCAGGACGACGGCCGGGGTCTGG TGCTTCCTGGCTACAAGTACCTCGGACCCTTCAACGGACTCGACAAGGGGGAGCCCGTCAACGCGGCGGACGCAGCG GCCCTCGAGCACGACAAGGCCTACGACCAGCAGCTCAAAGCGGGTGACAATCCGTACCTTCGGTATAACCACGCCGA CGCCGAGTTTCAGGAGCGTCTGCAAGAAGATACGTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAGA AGCGGGTTCTCGAACCTCTCGGTCTGGTTGAGGAAGGCGCTAAGACGGCTCCTGGAAAGAAACGTCCGGTAGAGCAG TCGCCACAAGAGCCAGACTCCTCCTCGGGCATCGGCAAGACAGGCCAGCAGCCCGCTAAAAAGAGACTCAATTTTGG TCAGACTGGCGACTCAGAGTCAGTCCCCGACCCACAACCTCTCGGAGAACCTCCAGCAACCCCCGCTGCTGTGGGAC CTACTACAATGGCTTCAGGCGGTGGCGCACCAATGGCAGACAATAACGAAGGCGCCGACGGAGTGGGTAATGCCTCA GGAAATTGGCATTGCGATTCCACATGGCTGGGCGACAGAGTCATCACCACCAGCACCCGCACCTGGGCCTTGCCCAC CTACAATAACCACCTCTACAAGCAAATCTCCAGTGCTTCAACGGGGGCCAGCAACGACAACCACTACTTCGGCTACA GCACCCCCTGGGGGTATTTTGATTTCAACAGATTCCACTGCCACTTTTCACCACGTGACTGGCAGCGACTCATCAAC AACAATTGGGGATTCCGGCCCAAGAGACTCAACTTCAAACTCTTCAACATCCAAGTCAAGGAGGTCACGGCGAATGA TGGCGTCACAACCATCGCTAATAACCTTACCAGCACGGTTCAAGTCTTCTCGGACTCGGAGTACCAGCTTCCGTACG TCCTCGGCTCTGCGCACCAGGGCTGCCTCCCTCCGTTCCCGGCGGACGTGTTCATGATTCCGCAATACGGCTACCTG ACGCTCAACAATGGCAGCCAAGCCGTGGGACGTTCATCCTTTTACTGCCTGGAATATTTCCCTTCTCAGATGCTGAG AACGGGCAACAACTTTACCTTCAGCTACACCTTTGAGGAAGTGCCTTTCCACAGCAGCTACGCGCACAGCCAGAGCC TGGACCGGCTGATGAATCCTCTCATCGACCAATACCTGTATTACCTGAACAGAACTCAAAATCCGTCCGGAAGTGCC CAAAACAAGGACTTGCTGTTTAGCCGTGGGTCTCCAGCTGGCATGTCTGTTCAGCCCAAAAACTGGCTACCTGGACC CTGTTATCGGCAGCAGCGCGTTTCTAAAACAAAAACAGACAACAACAACAGCAATTTTACCTGGACTGGTGCTTCAA AATATAACCTCAATGGGCGTGAATCCATCATCAACCCTGGCACTGCTATGGCCTCACACAAAGACGACGAAGACAAG TTCTTTCCCATGAGCGGTGTCATGATTTTTGGAAAAGAGAGCGCCGGAGCTTCAAACACTGCATTGGACAATGTCAT GATTACAGACGAAGAGGAAATTAAAGCCACTAACCCTGTGGCCACCGAAAGATTTGGGACCGTGGCAGTCAATTTCC AGAGCAGCAGCACAGACCCTGCGACCGGAGATGTGCATGCTATGGGAGCATTACCTGGCATGGTGTGGCAAGATAGA GACGTGTACCTGCAGGGTCCCATTTGGGCCAAAATTCCTCACACAGATGGACACTTTCACCCGTCTCCTCTTATGGG CGGCTTTGGACTCAAGAACCCGCCTCCTCAGATCCTCATCAAAAACACGCCTGTTCCTGCGAATCCTCCGGCGGAGT TTTCAGCTACAAAGTTTGCTTCATTCATCACCCAATACTCCACAGGACAAGTGAGTGTGGAAATTGAATGGGAGCTG CAGAAAGAAAACAGCAAGCGCTGGAATCCCGAAGTGCAGTACACATCCAATTATGCAAAATCTGCCAACGTTGATTT TACTGTGGACAACAATGGACTTTATACTGAGCCTCGCCCCATTGGCACCCGTTACCTTACCCGTCCCCTGTAA

[0092] <AAV1#3-32 variant>

[0093] AAV-2 Rep gene #3-65 Cap gene Ampicillin resistance (bla) gene (SEQ ID NO:7)

[0094] GCGCGCCGATATCGTTAACGCCCCGCGCCGGCCGCTCTAGAACTAGTGGATCCCCCG

[0095] GAAGATCAGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCTGAT

[0096] CTGCGCAGCCGCCATGCCGGGGTTTTACGAGATTGTGATTAAGGTCCCCAGCGACC

[0097] TTGACGGGCATCTGCCCGGCATTTCTGACAGCTTTGTGAACTGGGTGGCCGAGAA

[0098] GGAATGGGAGTTGCCGCCAGATTCTGACATGGATCTGAATCTGATTGAGCAGGCA

[0099] CCCCTGACCGTGGCCGAGAAGCTGCAGCGCGACTTTCTGACGGAATGGCGCCGT

[0100] GTGAGTAAGGCCCCGGAGGCCCTTTTCTTTGTGCAATTTGAGAAGGGAGAGAGCT

[0101] ACTTCCACATGCACGTGCTCGTGGAAACCACCGGGGTGAAATCCATGGTTTTGGG

[0102] ACGTTTCCTGAGTCAGATTCGCGAAAAACTGATTCAGAGAATTTACCGCGGGATCG

[0103] AGCCGACTTTGCCAAACTGGTTCGCGGTCACAAAGACCAGAAATGGCGCCGGAGG

[0104] CGGGAACAAGGTGGTGGATGAGTGCTACATCCCCAATTACTGCTCCCCAAAACC

[0105] CAGCCTGAGCTCCAGTGGGCGTGGACTAATGGAACAGTATTTAAGCGCCTGTTT

[0106] GAATCTCACGGAGCGTAAACGGTTGGTGGCGCAGCATCTGACCCACGTGTCGCAG

[0107] ACGCAGGAGCAGAACAAAGAGAATCAGAATCCCAATCTCTGATGCGCCGGTGATCA

[0108] GATCAAAAACTTCAGCCAGGTACATGGAGCTGGTCGGGTGGCTCGTGGACAAGGG

[0109] GATTACCTCGGAGAAGCAGTGGATCCAGGAGGACCAGGCCTCATACATCTCCTTC

[0110] AATGCGGCCTCCAACTCGGTCCCAAATCAAGGCTGCCTTGGACAATGCGGGAA

[0111] AGATTATGAGCCTGACTAAAACCGCCCCCGACTACCTGGTGGGCCAGCAGCCCGT

[0112] GGAGGACATTTCCAGCAATCGGATTTATAAATTTTGGAACTAAACGGGTACGATC

[0113] CCCAATATGCGGCTTCCGTCTTTCTGGGATGGGCCACGAAAAAGTTCGGCAAGAG

[0114] GAACACCATCTGGCTGTTTGGGCCTGCAACTACCGGGAAGACCAACATCGCGGAG

[0115] GCCATAGCCCACACTGTGCCCTTCTACGGGTGCGTAAACTGGACCAATGAACTT

[0116] TCCCTTCAACGACTGTGTCGACAAGATGGTGATCTGGTGGGAGGAGGGGAAGATG

[0117] ACCGCCAAGGTCGTGGAGTCGGCCAAAGCCATTCTCGGAGGAAGCAAGGTGCGC

[0118] GTGGACCAGAAATGCAAGTCCTCGGCCCAGATAGACCCGACTCCCGTGATCGTCA

[0119] CCTCCAACACCAACATGTGCGCCGTGATTGACGGGAACTCAACGACCTTCGAACA

[0120] CCAGCAGCCGTTGCAAGACCGGATGTTCAAATTTGAACTCACCCGCCGTCTGGAT

[0121] CATGACTTTGGGAAGGTCACCAAGCAGGAAGTCAAAGACTTTTTCCGGTGGGCAA

[0122] AGGATCACGTGGTTGAGGTGGAGCATGAATTCTACGTCAAAAAGGGTGGAGCCAA

[0123] GAAAAGACCCGCCCCCAGTGACGCAGATATAAGTGAGCCCAAACGGGTGCGCGAG

[0124] TCAGTTGCGCAGCCATCGACGTCAGACGCGGAAGCTTCGATCAACTACGCAGACA

[0125] GGTACCAAAACAAATGTTCTCGTCACGTGGGCATGAATCTGATGCTGTTTCCCTGC

[0126] AGACAATGCGAGAGAATGAATCAGAATTCAAATATCTGCTTCACTCACGGACAGAA

[0127] AGACTGTTTAGAGTGCTTTCCCGTGTCAGAATCTCAACCCGTTTCTGTCGTCAAAA

[0128] AGGCGTATCAGAAACTGTGCTACATTCATCATATCATGGGAAAGGTGCCAGACGCT

[0129] TGCACTGCCTGCGATCTGGTCAATGTGGATTTGGATGACTGCATCTTTGAACAATA

[0130] AATGATTTAAATCAGGT ATGGCTGCCGATGGTTATCTTCCAGATTGGCTCGAGGACAACC

[0131] TCTCTGAGGGCATTCGCGAGTGGTGGGACTTGAAACCTGGAGCCCCGAAGCCCAAAGC

[0132] CAACCAGCAAAAGCAGGACGACGGCCGGGGTCTGGTGCTTCCTGGCTACAAGTACCTC

[0133] GGACCCTTCAACGGACTCGACAAGGGGGAGCCCGTCAACGCGGCGGACGCAGCGGCC

[0134] CTCGAGCACGACAAGGCCTACGACCAGCAGCTCAAAGCGGGTGACAATCCGTACCTTC

[0135] GGTATAACCACGCCGACGCCGAGTTTCAGGAGCGTCTGCAAGAAGATACGTCTTTTGGG

[0136] GGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAGAAGCGGGTTCTCGAACCTCTCGGTC

[0137] TGGTTGAGGAAGGCGCTAAGACGGCTCCTGGAAAGAAACGTCCGGTAGAGCAGTCGCC

[0138] ACAAGAGCCAGACTCCTCCTCGGGCATCGGCAAGACAGGCCAGCAGCCCGCTAAAAAG

[0139] AGACTCAATTTTGGTCAGACTGGCGACTCAGAGTCAGTCCCCGACCCACAACCTCTCGG

[0140] AGAACCTCCAGCAACCCCCGCTGCTGTGGGACCTACTACAATGGCTTCAGGCGGTGGCG

[0141] CACCAATGGCAGACAATAACGAAGGCGCCGACGGAGTGGGTAATGCCTCAGGAAATTG

[0142] GCATTGCGATTCCACATGGCTGGGCGACAGAGTCATCACCACCAGCACCCGCACCTGGG

[0143] CCTTGCCCACCTACAATAACCACCTCTACAAGCAAATCTCCAGTGCTTCAACGGGGGCC

[0144] AGCAACGACAACCACTACTTCGGCTACAGCACCCCCTGGGGGTATTTTGATTTCAACAG

[0145] ATTCCACTGCCACTTTTCACCACGTGACTGGCAGCGACTCATCAACAACAATTGGGGAT

[0146] TCCGGCCCAAGAGACTCAACTTCAAACTCTTCAACATCCAAGTCAAGGAGGTCACGAC

[0147] GAATGATGGCGTCACAACCATCGCTAATAACCTTACCAGCACGGTTCAAGTCTTCTCGGA

[0148] CTCGGAGTACCAGCTTCCGTACGTCCTCGGCTCTGCGCACCAGGGCTGCCTCCCTCCGT

[0149] TCCCGGCGGACGTGTTCATGATTCCGCAATACGGCTACCTGACGCTCAACAATGGCAGC

[0150] CAAGCCGTGGGACGTTCATCCTTTTACTGCCTGGAATATTTCCCTTCTCAGATGCTGAGA

[0151] ACGGGCAACAACTTTACCTTCAGCTACACCTTTGAGGAAGTGCCTTTCCACAGCAGCTA

[0152] CGCGCACAGCCAGAGCCTGGACCGGCTGATGAATCCTCTCATCGACCAATACCTGTATTA

[0153] CCTGAACAGAACTCAAAATCAGTCCGGAAGTACCCAAAACAAGGACTTGCTGTTTAGC

[0154] CGTGGGTCTCCAGCTGGCATGTCTGTTCAGCCCAAAAACTGGCTACCTGGACCCTGTTA

[0155] TCGGCAGCAGCGCGTTTCTAAAACAAAAACAGACAACAACAACAGCAATTTTACCTGG

[0156] ACTGGTGCTTCAAAATATAACCTCAATGGGCGTGAATCCATCATCAACCCTGGCACTGCT

[0157] ATGGCCTCACACAAAGACGACGAAGACAAGTTCTTTCCCATGAGCGGTGTCATGATTTT

[0158] TGGAAAAGAGAGCGCCGGAGCTTCAAACACTGCATTGGACAATGTCATGATTACAGAC

[0159] GAAGAGGAAATTAAAGCCACTAACCCTGTGGCCACCGAAAGATTTGGGACCGTGGCAG

[0160] TCAATTTCCAGAGCAGCAGCACAGACCCTGCGACCGGAGATGTGCATGCTATGGGAGCA

[0161] TTACCTGGCATGGTGTGGCAAGATAGAGACGTGTACCTGCAGGGTCCCATTTGGGCCAA

[0162] AATTCCTCACACAGATGGACACTTTCACCCGTCTCCTCTTATGGGCGGCTTTGGACTCAA

[0163] GAACCCGCCTCCTCAGATCCTCATCAAAAACACGCCTGTTCCTGCGAATCCTCCGGCGG

[0164] AGTTTTCAGCTACAAAGTTTGCTTCATTCATCACCCAATACTCCACAGGACAAGTGAGTG

[0165] TGGAAATTGAATGGGAGCTGCAGAAAGAAAACAGCAAGCGCTGGAATCCCGAAGTGCA

[0166] GTACACATCCAATTATGCAAAATCTGCCAACGTTGATTTTACTGTGGACAACAATGGACT

[0167] TTATACTGAGCCTCGCCCCATTGGCACCCGTTACCTTACCCGTCCCCTGTAA TTACGTGTT

[0168] AATCAATAAACCGGTTAATTCGTGTCAGTTGAACTTTGGTCTCATGTCGTTATTATCTTAT

[0169] CTGGTCACCAGATACGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACAGCCCGGGC

[0170] GTTTAAACAGCGGGCGGAGGGGTGGAGTCGTGACGTGAATTACGTCATAGGGTTAGGG

[0171] AGGTCCTGTATTAGAGGTCACGTGAGTGTTTTGCGACATTTTGCGACACCATGTGGTCAC

[0172] GCTGGGGGGGGGGGCCCGAGTGAGCACGCAGGGTCTCCATTTTGAAGCGGGAGGTTTG

[0173] AACGAGCGCTGGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCC

[0174] TGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAG

[0175] CGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGG

[0176] GTAAATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCAT

[0177] TTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGA

[0178] TAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCC

[0179] AACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCAC

[0180] CCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGG

[0181] AGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGG

[0182] AAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGC

[0183] GTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTGGTGGCACTTTTC

[0184] GGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCC

[0185] GCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAG

[0186] TATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTC

[0187] ACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTAC

[0188] ATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCA

[0189] ATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAA

[0190] GAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACA

[0191] GAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAAGCATGAGT

[0192] GATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTT

[0193] TTTCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGC

[0194] CATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAAC

[0195] TATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGA

[0196] TAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATC

[0197] TGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCC

[0198] TCCCGTATCGTAGTTATCTACACGACGGGCAGTCAGGCAACTATGGATGAACGAAATAGACAG

[0199] ATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATAT

[0200] ATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTT

[0201] TTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACC

[0202] CCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCT

[0203] TGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACC

[0204] AACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCT

[0205] AGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCG

[0206] CTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGT

[0207] TGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTC

[0208] GTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGT

[0209] GAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAA

[0210] GCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGGAACGCCTGGT

[0211] ATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTC

[0212] GTCAGGGGGGCCGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTG

[0213] GCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATA

[0214] ACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGC

[0215] AGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCG

[0216] CGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGC

[0217] AGTGAGCGCAACGCAATTAATGTGAGTTACCTCACTCATTAGGCACCCCAGGCTTTACA

[0218] CTTTATGCTTCCGGCTCCTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGG

[0219] AAACAGCTATGACCATGATTACGCCAA

[0220] <AAV1#3-65 variant>

[0221] Construction of wild-type AAV1

[0222] The calcium phosphate complex formed by 17 μg of a packaging plasmid containing the rep gene of AAV2 and the cap gene of AAV1, 17 μg of an ITR-flanked reporter gene (pCMV-GFP, pCMV-LacZ, or pCMV-FGF12-IRES-GFP), and 17 μg of a p helper plasmid was transfected into AAV293 cells. Approximately 48 hours later, only the cell pellet was collected, and AAV inside the cells was extracted by freeze-thawing. Subsequently, cell debris was removed by centrifugation, and 10 U / mL of nuclease was added and incubated at 37 °C for 30 minutes to remove nucleic acids derived from the virus-producing cells.

[0223] 3) Purification of AAV1#3-32 and #3-65 variants

[0224] The AAV solution was ultracentrifuged using an iodixanol gradient. 15%, 25%, 40%, and 54% iodixanol solutions were prepared and loaded into ultracentrifuge tubes in sequence, and then the AAV solution was loaded on top of them. After the tubes were sealed, ultracentrifugation was performed using an Optima XE-90 ultracentrifuge (BECKMAN COULTER) and a Vti65.2 rotor (42,000 RPM, 18 °C, 2 hours). The AAV layer between the 54% and 40% iodixanol gradients was extracted and buffer-exchanged using an Ultra-15 centrifugal filter (MWCO 100,000) with PBS buffer containing 0.01% Tween 20.

[0225] 4) Measurement of the titers of AAV1#3-32 and #3-65 variants

[0226] The virus resistant to DNase I (5U) was treated with proteinase K, and after extracting the viral genome, the titers of wild-type AAV1 and AAV1#3-32 and #3-65 variants carrying CMV-FGF12-IRES-GFP were quantified by qPCR using their standards using quantitative PCR (qPCR) primers for CMV (5-ATGGTGATGCGGTTTTGGCAG-3: SEQ ID NO:10 and 5-GGCGGAGTTGTTACGACATTTTGG-3: SEQ ID NO:11).

[0227] The packaging efficiency of wild-type AAV1 and recombinant AAV1 vectors (#3-32 and #3-65 variants) was compared by genome titer. Figure 1 These results indicate that the packaging efficiency of the #3-32 and #3-65 variants is higher than that of wild-type AAV1, suggesting that they have the potential to remain evolutionarily superior individuals.

[0228] Example 2: Confirmation of infection with recombinant AAV1 variants

[0229] 1) In vitro experiments

[0230] To analyze gene delivery efficiency and reporter gene location, wild-type AAV1 and CMV-GFP-loaded #3-32 and #3-65 variants were packaged and used to infect HEK293T cells (2×10 4 cells / 20 μL).

[0231] Each virus was loaded with CMV-FGF12-IRES-GFP. When loaded with GFP and 48 hours after HEK293T infection (MOI 10,000), the proportion (%) of GFP-expressing cells in the total cultured cells was analyzed by flow cytometry to confirm the infection ability. Figure 2 shown.

[0232] Figure 2 Shown is the improvement in HEK293T transduction efficiency analyzed by the proportion of GFP expressing cells among total cultured cells.

[0233] 2) In vivo experiments

[0234] Each of the AAV1 wild type and #3-32 and #3-65 variants carrying CMV-LacZ was packaged and delivered in the form of an aerosol (1×10 11 vg / 100 μL) were injected intratracheally into 8-week-old C57BL / 6 male mice.

[0235] To confirm the lung bronchial specificity of the recombinant AAV1 vectors (#3-32 and #3-65 variants), the expression of LacZ was confirmed by staining the lungs taken from 8-week-old C57BL / 6 male mice with whole-body β-galactosidase one week after injection. As shown in Figures 3A and 3B, it was confirmed that the recombinant AAV1 vectors (#3-32 and #3-65 variants) were effectively delivered to the lung bronchi.

[0236] In addition, in order to confirm the specificity of the recombinant AAV1 vector (#3-32 and #3-65 variants) to the lung bronchi, 8-week-old C57BL / 6 male mice were injected, and the lungs were removed one week later, and the expression of LacZ in the lung bronchi was confirmed by eosin / LacZ staining. As a result, as shown in Figures 4A and 4B, it was confirmed that the recombinant AAV1 vector was specifically delivered to the lung bronchi.

[0237] In addition, wild-type AAV1 (1.25×10 11 vg / kg) and #3-65(5.38x10 11 vg / kg) vector was dispersed in PBS+0.01% Tween20 and then injected into the airway of pigs in the form of 1 mL of liquid. The experimental animals were sacrificed two weeks later and fixed with 4% PFA and stained with X-gal to confirm that #3-65 showed local expression of LacZ in the airway area and lung tissue compared with wild-type AAV1 which had no gene expression in lung sections with airways ( Figure 6 ).

Claims

1. A mutant of an AAV1 capsid protein, wherein one or more of the amino acids at positions 326, 452 and 456 of the amino acid sequence represented by SEQ ID NO: 1 of the wild-type AAV1 capsid protein is substituted.

2. The mutant according to claim 1, wherein in the amino acid sequence of the wild-type AAV1 capsid protein represented by SEQ ID NO: 1, the threonine at position 326 is substituted by alanine, and the glutamine at position 452 is substituted by proline.

3. The mutant according to claim 1, wherein in the amino acid sequence of the wild-type AAV1 capsid protein represented by SEQ ID NO: 1, alanine at position 456 is substituted by threonine.

4. A nucleic acid encoding the AAV1 capsid protein mutant according to claim 2.

5. A nucleic acid encoding the AAV1 capsid protein mutant according to claim 3. The nucleic acid according to claim 4 , which has a base sequence represented by SEQ ID NO:

4. The nucleic acid according to claim 5 , which has a base sequence represented by SEQ ID NO:

5.

8. A recombinant AAV1 vector comprising a nucleic acid encoding the AAV1 capsid protein mutant according to claim 4 or 5.

9. The recombinant AAV1 vector according to claim 8, which has improved transduction properties to lung bronchi compared with wild-type AAV1 viral vector.

10. A pharmaceutical composition comprising the recombinant AAV1 vector according to claim 8.

11. The pharmaceutical composition according to claim 10, further comprising: A pharmaceutically acceptable carrier.

12. The pharmaceutical composition according to claim 10, which is used for preventing or treating bronchitis or bronchiectasis.

13. A gene delivery vector comprising the recombinant AAV1 vector according to claim 8.

Images