Method for exploring functional molecules that cause intracellular responses

Abstract

A vector or set of vectors for analyzing the function of a functional molecule, a polynucleotide encoding an expression system encoding a candidate molecule of a functional molecule, a polynucleotide encoding a transcriptional regulatory sequence or a translation regulatory sequence activated by a given intracellular response, and a polynucleotide encoding a reporter gene system operably linked to the transcriptional regulatory sequence or the translation regulatory sequence. A method for exploring a functional molecule that causes an intracellular response, comprising the steps of introducing the vector or vector group into a cell, and measuring the expression of a reporter gene system contained in the vector or vector group in the cell.

Description

Technical Field

[0001] The present invention relates to a method for searching for a functional molecule that induces a response in a cell, a vector or a vector group used in the searching method, and various applications of the searching method. Background Art

[0002] Elucidating the functions of each gene in various physiological processes such as disease generation and differentiation is very important in exploring effective new drug targets and understanding the molecular mechanisms of physiological processes.

[0003] In the functional analysis of genes, there are methods for analyzing the amount of mRNA or protein of target genes in cells in a specific state, or performing post-translational modification of proteins. As a more direct functional analysis method, phenotypic analysis based on artificial expression inhibition or expression enhancement of target genes is adopted. As a general phenotypic analysis method, there are methods for selectively inhibiting or activating any target gene and analyzing its effect at the cellular level, tissue level or individual level. However, in previous phenotypic analysis, basically only one gene or any one group of gene combinations can be investigated under one experimental condition, so comprehensive analysis of phenotypes requires a lot of effort and time.

[0004] In recent years, in order to achieve comprehensive phenotypic analysis, a screening method combining RNAi, CRISPR / Cas9 systems and large-scale parallel sequencing technology has been developed (non-patent literature 1, 2). In this method, shRNA or gRNA vectors that have an inhibitory effect on individual genes are collected and introduced into cells and tissues, thereby producing individual gene inhibition in each cell under the same experimental conditions. Then, cells that exhibit a phenotype or cells that do not exhibit a phenotype are enriched, and the amount of shRNA or gRNA in the obtained cell population is quantified by large-scale parallel sequencing, thereby screening for responsible genes involved in a specific phenotype. Alternatively, single-cell sequencing analysis of cells is performed without phenotype-based cell enrichment, and the sequence and gene expression of gRNA in single cells are analyzed at the same time, thereby achieving comprehensive phenotypic analysis (non-patent literature 3~5). Phenotypic analysis combining such gene inhibition and large-scale parallel sequencing technology achieves high-throughput functional analysis of genes compared to previous phenotypic analysis. However, these analysis methods also require long-term culture for the enrichment of cell populations, which generates a lot of work in the enrichment operation and library preparation for single-cell sequencing, so there is room for further improvement.

[0005] As a tool for functional analysis of genes, lentiviral vectors (e.g., shRNA cloning vectors of System Biosciences, LLC, etc.) that co-express DNA encoding shRNA and a reporter gene that visualizes the vector introduction into cells are commercially available. In addition, reporter gene assays that use transcriptional regulators (e.g., p53 response elements) activated in response to cell stress such as DNA damage and oxidation linked to reporter genes as markers for analyzing cell stress states and drug responses are known in the past (Non-Patent Document 6).

[0006] Non-patent document 7 and patent document 1 describe a method for evaluating enzyme activity, wherein a vector comprising a variant of a gene encoding a known promoter or a known enzyme and a Canvas sequence connected thereto is introduced into a cell, and the enzyme expressed by the variant is used to promote the expression of a mutagenic protein in the cell to induce mutation of the Canvas sequence, and the activity of the enzyme encoded by the variant is evaluated according to the number of mutations in the Canvas sequence. Non-patent document 8 describes the following method: a gRNA that inhibits the expression of a specific transcription factor and an enhancer connected to a barcode sequence are introduced into a cell, and the gRNA is associated with the enhancer activity based on the barcode sequence, thereby evaluating the effect of the transcription factor relative to the enhancer.

[0007] Prior art literature

[0008] Patent Literature

[0009] Patent Document 1: International Publication No. 2023 / 028476

[0010] Non-patent literature

[0011] Non-patent literature 1: Cell, 2013, 152(4): 909-922

[0012] Non-patent literature 2: Nature biotechnology, 2016, 34(6): 634-636

[0013] Non-patent literature 3: Cell, 2016, 167(7): 1853-1866

[0014] Non-patent literature 4: Cell, 2016, 167(7): 1883-1896

[0015] Non-patent literature 5: Nature methods, 2017, 14(3): 297-301

[0016] Non-patent literature 6: Mutation Research, Genetic Toxicology and Environmental Mutagenesis, 2010, 696(1): 21-40.

[0017] Non-patent literature 7: bioRxiv preprint, doi: doi.org / 10.1101 / 2022.03.09.483646, Version 1, March 9, 2022

[0018] Non-patent literature 8: bioRxiv preprint, doi: doi.org / 10.1101 / 2020.09.30.321323, 2020 Summary of the invention

[0019] We hope to improve the efficiency and throughput of comprehensive analysis of functional molecules such as RNA and peptides.

[0020] The inventors have constructed a vector comprising a polynucleotide encoding an expression system of an RNA or peptide to be analyzed, and a polynucleotide encoding a transcriptional regulatory sequence activated by a response in a cell caused by a disturbance of the RNA or peptide and a reporter gene system operably connected to the transcriptional regulatory sequence. A vector group in which each polynucleotide is configured in different vectors can also be used. When the vector or vector group is introduced into a cell, if the disturbance of the expressed RNA or peptide produces the response in the cell, the reporter gene system will be expressed correspondingly thereto. Therefore, the RNA or peptide can be associated with the response in the cell based on the expression of the reporter gene system in the cell, and then its function can be analyzed. In addition, it is found that if a plurality of the above-mentioned vectors or vector groups containing different RNAs or peptides or reporter gene systems are introduced into one cell or cell group, and the expression of the reporter gene system from each vector is measured respectively, the functions of multiple RNAs or peptides can be analyzed in one cell or cell group at one time.

[0021] Therefore, the present invention provides the following solutions.

[0022] [1] A vector or vector set for analyzing the function of a functional molecule, comprising: a polynucleotide encoding an expression system of a candidate molecule of the functional molecule, a polynucleotide encoding a transcriptional regulatory sequence or a translational regulatory sequence activated by a predetermined intracellular response, and a polynucleotide encoding a reporter gene system operably linked to the transcriptional regulatory sequence or the translational regulatory sequence.

[0023] [2] The vector or vector set according to [1], wherein the functional molecule is RNA or a peptide.

[0024] [3] The vector or vector set according to [1] or [2], wherein the RNA is shRNA or guide RNA.

[0025] [4] A vector or vector group according to any one of [1] to [3], wherein the transcriptional regulatory sequence or translational regulatory sequence activated by a predetermined intracellular response is a p53 binding sequence, an antioxidant response sequence, a nuclear factor κB binding sequence, a transcription activator factor 6 response sequence, a metal regulatory element, a heat shock element, a hypoxia response element, a nuclear factor of activated T cells binding sequence, a TCF / LEF type DNA binding protein binding sequence, a sesRNA, or a toehold RNA.

[0026] [5] The vector or vector set according to any one of [1] to [4], wherein the transcriptional regulatory sequence activates a promoter located downstream thereof.

[0027] [6] The vector or vector set according to [5], wherein the reporter gene system comprises the promoter.

[0028] [7] The vector or vector set according to any one of [1] to [6], wherein the reporter gene system is expressed in response to activation of the transcriptional regulatory sequence or translational regulatory sequence.

[0029] [8] The vector or vector set according to any one of [1] to [7], wherein the reporter gene system is a luminescent or fluorescent protein reporter gene system, or an enzyme reporter gene system.

[0030] [9] The vector or vector set according to [8], wherein the enzyme reporter gene system comprises a combination of a protein having the function of changing a target nucleotide sequence and its target sequence.

[0031]

[10] The vector or vector set according to [8], wherein the enzyme reporter gene system expresses a DNA nuclease, a DNA recombinase, a transposase, or an integrase.

[0032]

[11] The vector or vector set according to [8], wherein the enzyme reporter gene system comprises: a combination of an artificial nuclease and its recognition sequence, and a combination of a restriction enzyme and its corresponding restriction enzyme recognition sequence.

[0033]

[12] A vector or vector group according to [8], wherein the enzyme reporter gene system comprises: a combination of a Cas family, a guide RNA, and a Cas recognition sequence, a combination of a TALEN (transcription activator-like effector nuclease) and its recognition sequence, a combination of a ZFN and its recognition sequence, or a combination of a base editor or a prime editor and its recognition sequence.

[0034]

[13] The vector or vector set according to

[11] , wherein the restriction enzyme is I-CeuI, I-SceI, PI-PspI or PI-SceI.

[0035]

[14] A vector or vector set according to [8], wherein the enzyme reporter gene system comprises: a CRE-LoxP system, a system in which a sequence replacing the LoxP sequence or having a LoxP variant sequence in addition to the LoxP sequence in the CRE-LoxP system, a Vika-Vox system, a Dre-rox system, or a Flp-FRT system.

[0036]

[15] The vector or vector group according to any one of [1] to

[14] , wherein the vector is a plasmid vector, a linear DNA sequence, a transposon vector, or a viral vector.

[0037]

[16] The vector or vector group according to

[15] , wherein the viral vector is a lentiviral vector, an adeno-associated viral vector, a baculoviral vector, an MMLV retroviral vector, or an MSCV retroviral vector.

[0038]

[17] The vector or vector set according to any one of [1] to

[16] , further comprising a unique molecular barcode sequence.

[0039]

[18] A method for exploring functional molecules that induce responses in cells, comprising the following steps:

[0040] Introducing the vector or vector group described in any one of [1] to

[17] into a cell, and

[0041] The expression of the reporter gene system contained in the vector or vector set is measured in the cell.

[0042]

[19] The method according to

[18] , wherein the expression of the reporter gene system is quantified by luminescence or fluorescence measurement, protein quantification, quantitative RT-PCR, quantitative PCR, or sequencing.

[0043]

[20] The method according to

[18] or

[19] , which includes the following steps: adding two or more vectors or vector groups to a cell group and introducing each vector into any cell in the cell group, wherein the two or more vectors or vector groups each contain a polynucleotide encoding a different functional molecule.

[0044]

[21] A method according to any one of

[18] to

[20] , wherein the cells are cells collected from humans or non-human animals, cells collected from samples from patients or experimental animals, primary cultured cells, organoids, cell spheroids, immortalized cultured cells, or cells in the body of an experimental animal individual.

[0045]

[22] A method for exploring genes involved in a response in a cell, comprising the following steps:

[0046] Introducing a plurality of vectors or vector groups into a cell population, wherein the plurality of vectors or vector groups each encode: an RNA interfering with a test subject gene, a transcriptional regulatory sequence or a translational regulatory sequence activated by a predetermined intracellular response, and a reporter gene system operably linked to the transcriptional regulatory sequence or the translational regulatory sequence, but the RNAs encoded by the plurality of vectors or vector groups are different from each other;

[0047] Determining the expression of the reporter gene system encoded by each of the plurality of vectors or vector groups in the cell population; and

[0048] Whether the test subject gene is a gene involved in the predetermined intracellular response is determined based on the expression of the reporter gene system contained in each of the plurality of vectors or vector groups.

[0049]

[23] The method according to

[22] , wherein whether the above-mentioned subject gene is a gene involved in the above-mentioned predetermined intracellular response is determined based on the statistical value of the expression of the reporter gene system contained in each of the above-mentioned multiple vectors or vector groups.

[0050]

[24] The method according to

[22] or

[23] , wherein the RNA interfering with the gene of the test subject is shRNA or gRNA.

[0051]

[25] A kit comprising the vector or vector set described in any one of [1] to

[17] .

[0052]

[26] The kit according to

[25] , which is a diagnostic drug or a companion diagnostic drug for a disease.

[0053]

[27] A method for diagnosing a disease, comprising the following steps: implementing the method for searching for functional molecules that induce intracellular responses described in any one of

[18] to

[21] .

[0054]

[28] A companion diagnostic method comprising the following steps: implementing the method for searching for functional molecules that induce intracellular responses described in any one of

[18] to

[21] .

[0055]

[29] Use of the vector or vector group according to any one of [1] to

[17] for searching for a functional molecule that induces a response in a cell.

[0056]

[30] Use of the vector or vector group according to any one of [1] to

[17] for searching for functional molecules that induce responses in cells.

[0057]

[31] Use of the vector or vector group described in any one of [1] to

[17] in disease diagnosis.

[0058]

[32] Use of the vector or vector group described in any one of [1] to

[17] in companion diagnosis.

[0059]

[33] Use of the vector or vector group according to any one of [1] to

[17] in the production of a diagnostic drug or companion diagnostic drug for a disease.

[0060]

[34] A method for analyzing the activity of a transcriptional regulatory sequence or a translational regulatory sequence in response to an intracellular response, comprising the following steps:

[0061] A cell into which a vector is introduced is prepared, wherein

[0062] The vector comprises: a polynucleotide encoding a transcriptional regulatory sequence or a translational regulatory sequence, a polynucleotide encoding a reporter gene system operably connected to the transcriptional regulatory sequence or the translational regulatory sequence, and a marker sequence for identifying the transcriptional regulatory sequence or the translational regulatory sequence.

[0063] The reporter gene system comprises a protein having the function of changing a target nucleotide sequence and a target sequence thereof, and the recognition sequence changes through the expression of the reporter gene system;

[0064] elicits a defined intracellular response in that cell;

[0065] After inducing the response, the region of the vector containing the target sequence and the marker sequence is analyzed to quantify the change in the target sequence;

[0066] The target sequence is associated with the transcriptional regulatory sequence or the translational regulatory sequence based on the marker sequence,

[0067] Based on the amount of change in the target sequence, the activity of the transcriptional regulatory sequence or translational regulatory sequence associated with the target sequence with respect to the response in the predetermined cell is evaluated.

[0068]

[35] The method according to

[34] , wherein the above-mentioned vector contains: a polynucleotide encoding a transcriptional regulatory sequence, and a marker sequence for identifying the transcriptional regulatory sequence.

[0069]

[36] The method according to

[34] or

[35] , wherein the region containing the target sequence and marker sequence is analyzed by sequencing.

[0070]

[37] The method according to any one of

[34] to

[36] , comprising the steps of: introducing a plurality of vectors into a cell population;

[0071] The multiple vectors contain polynucleotides encoding different transcriptional regulatory sequences or translational regulatory sequences.

[0072] The present invention provides a useful vector or carrier for exploring functional molecules that cause responses in cells. The vector or carrier is designed to express the reporter gene system encoded in the same vector or carrier group when the specified response is caused in the cell by the RNA, peptide and other molecules encoded in the vector. Therefore, according to the exploration method of the functional molecule of the present invention using the vector or carrier, the molecule can be associated with the response based on the expression of the reporter gene system, and the function of the molecule is analyzed. That is, the function of RNA, peptide and other molecules can be inferred using simple steps. In addition, according to the present invention, the function of multiple molecules can be analyzed once in 1 cell or cell group, and the throughput of the analysis is improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] Figure 1A These are the structures of plasmids 1 and 2.

[0074] Figure 1B This is the structure of plasmid 3.

[0075] Figure 1C This is the behavior of the reporter gene system in plasmids 1 to 3.

[0076] Figure 1D This is the structure of plasmid 4.

[0077] Figure 1E It is the structure of linear DNA1.

[0078] Figure 1F This is the structure of plasmid 5.

[0079] Figure 2 It is the fluorescence expression based on doxorubicin treatment in cells introduced with plasmid 1. Vertical axis: red fluorescence positive cells / green fluorescence positive cells, horizontal axis: doxorubicin concentration and time after doxorubicin treatment. Each point represents the value obtained by dividing the number of red fluorescence positive cells obtained from each culture well by the number of green fluorescence positive cells. The bar represents the average value.

[0080] Figure 3 The inversion rate (RQ) of the mKate2 sequence in Plasmid 1 after doxorubicin treatment is shown.

[0081] Figure 4 The ratio of red fluorescence positive cells to green fluorescence positive cells in cells introduced with plasmid 1 and plasmid 2 after doxorubicin treatment is shown. DMSO: no doxorubicin added, Doxo: doxorubicin added. shCon: cells introduced with shScramble (plasmid 1), shRAD51: cells introduced with shRAD51 (plasmid 2). Each point represents the value obtained by dividing the number of red fluorescence positive cells obtained in each culture well by the number of green fluorescence positive cells. The bar represents the average value.

[0082] Figure 5 The inversion rate of the mKate2 sequence in plasmid 3 after TBHQ treatment is shown. Flip: inversion sequence ratio, Original: non-inversion sequence ratio. The horizontal axis represents the TBHQ concentration.

[0083] Figure 6 The activation of the intracellular Wnt pathway at 6 hours and 24 hours after CHIR99021 treatment is shown. Top: AXIN2 expression, bottom: SP5 expression. The expression level is a relative value to CHIR996021 untreated (0 μM). Horizontal axis: CHIR99021 concentration.

[0084] Figure 7 The inversion amount of the marker sequence in the vector after CHIR99021 treatment is shown. Linear: linear DNA 1, Plasmid: plasmid 4. The horizontal axis is the CHIR99021 concentration. The expression amount is a relative value to that of the vector without CHIR99021 treatment (0 μM).

[0085] Figure 8 The inversion amount of mKate2 sequence induced by shRNA in cells introduced with viral vectors is shown. Scramble: cells introduced with viral vector 1A, shRAD51: cells introduced with viral vector 1B. Top: expression amount in cells at MOI 0.4, bottom: expression amount in cells at MOI 2.

[0086] Fig. 9 This is a schematic diagram of the amplicons used for the quantification of the inverted DNA sequence in Example 7. shCon: an amplicon containing shScramble, shRad_2 and shRad_4: an amplicon containing shRAD51_2 and an amplicon containing shRAD51_4.

[0087] Fig.10The inversion rate (inversion / non-inversion) of the mKate2 sequence in each plasmid in cells into which the plasmid pool was introduced is shown. Left: no doxorubicin was added, right: 1 μM doxorubicin was added. The numbers on the horizontal axis are the well numbers. shControl: plasmid containing shScramble, shRad51_2 and shRad51_4: plasmid containing shRAD51_2 and plasmid containing shRAD51_4.

[0088] Fig.11A The inversion rate of the marker sequence on each vector in the DNA derived from cells into which the shRNA pooled vector linear DNA 2 was introduced is shown. Scramble: cells into which shScramble was introduced, Targeting: cells into which gene-targeting shRNA was introduced. The horizontal axis is the gene targeted by the expressed shRNA and the ID number of the shRNA targeting each gene.

[0089] Fig. 11B The inversion probability of the marker sequence on each vector in the cell-derived DNA introduced into the linear DNA 2 is averaged for each shRNA target gene. The horizontal axis is the gene targeted by the shRNA. The graph in the chart is the inversion probability of the marker sequence on the same vector as each shRNA.

[0090] Fig.12 The inversion and deletion rates of marker sequences on each vector in the cell-derived DNA into which the shRNA pooled vector linear DNA 3 was introduced. The horizontal axis represents the gene targeted by the expressed shRNA and the ID number of the shRNA targeting each gene.

[0091] Fig.13 It is the structure of linear DNA4.

[0092] Fig.14A This is the preparation order of linear DNA4A.

[0093] Fig. 14B This is the preparation sequence of linear DNA4B.

[0094] Fig.15 This is the structure of plasmid 6.

[0095] Fig.16 The inversion rate of the marker sequence on each vector in the cell-derived DNA into which the shRNA pooled vector linear DNA 4 was introduced. The horizontal axis is the gene targeted by the expressed shRNA and the ID number of the shRNA targeting each gene. Left: Filtering without UMI, right: Filtering with UMI.

[0096] Fig.17is the inversion probability of the mKate2 sequence in cells into which the minP variant sequence has been introduced. Original: original minP, Variant: minP variant. DETAILED DESCRIPTION

[0097] All patent documents, non-patent documents and other publications cited in this specification are incorporated herein by reference in their entirety.

[0098] Each component exemplified in the present specification may be used alone or in combination of two or more unless otherwise specified.

[0099] In this specification, the description indicating a numerical range such as “A to B” has the same meaning as “A or more and B or less”, and the numerical range includes A and B.

[0100] The proteins exemplified in the present specification include mutant proteins in which the amino acid sequence or the base sequence encoding the amino acid sequence is substituted, repeated, deleted, inserted, or frameshifted when the proteins have the same function as before mutation.

[0101] In this specification, the "operably connected" of the sequence encoding RNA, peptide, reporter gene, etc. and the regulatory sequence comprising the transcriptional regulatory sequence such as promoter and the translation regulatory sequence refers to the functional connection of the above-mentioned RNA, peptide, reporter gene, etc. in a manner that can be expressed under the control of the regulatory sequence. The step of "operably connected" of the expressed sequence and the regulatory sequence is well known to those skilled in the art. For example, "transcriptional regulatory sequence and reporter gene are operably connected" refers to that the reporter gene is transcribed under the control of the transcriptional regulatory sequence, and in addition, "translation regulatory sequence and reporter gene are operably connected" refers to that the reporter gene is translated under the control of the translation regulatory sequence. Therefore, the "operably connected" of the above-mentioned coding sequence in this specification and the above-mentioned regulatory sequence not only refers to the situation that the coding sequence is controlled to be expressed by the regulatory sequence present in the same nucleotide chain, but also includes the situation that the coding sequence and the regulatory sequence controlling its expression are present in different nucleotide chains.

[0102] In this specification, "expression" of a gene or its expression product includes transcription of the gene and translation of the transcript. For example, "expression" includes transcription from a gene into mRNA, translation from mRNA into protein, and expression of the protein itself and the mRNA encoding the protein.

[0103] In the present specification, "upstream" and "downstream" with respect to a nucleotide sequence refer to the regions on the 5' side and 3' side of the sense strand of the DNA of the nucleotide sequence, respectively.

[0104] In this specification, "perturbation" in cells refers to knockdown, knockout or expression activation of the target induced by the expression of RNA complementary to the target (e.g., gene, its mRNA), or the intracellular expression of functional molecules such as peptides. Examples of RNA that induces perturbation include shRNA, gRNA, etc.

[0105] In this specification, "response" within a cell refers to an intracellular event caused by a disturbance, for example, DNA damage within the cell caused by the expression of the above-mentioned RNA or peptide, stress such as oxidation, changes in the expression level or activity of a given gene, or changes in the intracellular environment caused by them.

[0106] The "functional molecule" in this specification refers to a molecule that induces disturbance in a cell. When the disturbance causes a response in a cell, the functional molecule causes a response in the cell.

[0107] The "polynucleotide" in this specification may be single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA, or other artificial nucleic acids as long as it can retain the information of the RNA or peptide it encodes. Among them, double-stranded DNA is preferred from the viewpoint of being able to stably store information.

[0108] (Method for exploring functional molecules that induce responses within cells)

[0109] The present invention provides a method for exploring functional molecules that cause responses in cells. Examples of the functional molecules (hereinafter also referred to as "target molecules") that are targets to be explored by the present method, i.e., that cause responses in cells, include low molecular weight hairpin RNA (shRNA), guide RNA (gRNA), enhancer RNA, small activating RNA, long non-coding RNA and other RNAs and peptides.

[0110] The shRNA explored in the method of the present invention is an RNA having a stem-loop structure, and the stem-loop structure is composed of 40 to 100 nucleotides, the stem portion is composed of 19 to 45 nucleotides, and the loop portion is composed of 4 to 25 nucleotides. Preferably, the stem-loop structure is composed of 45 to 75 nucleotides, the stem portion is composed of 19 to 30 nucleotides, and the loop portion is composed of 6 to 15 nucleotides. The sequence of the stem portion of the shRNA is complementary to the nucleotide sequence (mRNA, genomic DNA, genomic RNA, etc.) in the cell and can bind to the nucleotide sequence.

[0111] The guide RNA (gRNA) explored in the method of the present invention refers to an RNA having a sequence of 10 to 250 bases that is complementary to a target sequence.

[0112] The length of the enhancer RNA explored in the method of the present invention is 15 to 2000 nucleotides.

[0113] The small activating RNA explored in the method of the present invention refers to an RNA having a 14-30 nucleotide sequence complementary to the target gene from 2000 bp upstream to 2000 bp downstream of the transcription start site.

[0114] The long non-coding RNA explored in the method of the present invention refers to an RNA sequence of more than 200 nucleotides that does not have a coding region.

[0115] The peptides explored in the method of the present invention have no particular limitation on their molecular size, and examples thereof include proteins, polypeptides, or oligopeptides. The target peptides explored in the method of the present invention are, for example, peptides that can function as signaling factors, enzymes, coenzymes, etc. in cells and cause intracellular disturbances.

[0116] The method for exploring the above-mentioned functional molecules of the present invention basically includes screening the RNA, peptide and other molecules as candidates of the above-mentioned target molecules. From them, the functional molecules that cause the response in a specific cell as the target are determined. The method is characterized in that the vector or vector group provided by the present invention is used, and the vector or vector group comprises: a polynucleotide encoding an expression system of a functional molecule (hereinafter, also referred to as a "candidate molecule") as a candidate of the above-mentioned target molecule (i.e., the correlation with the intracellular response is unknown), a polynucleotide encoding a regulatory sequence (transcriptional regulatory sequence or translation regulatory sequence) activated by a predetermined intracellular response that can be caused by the target molecule (i.e., the correlation with the candidate molecule is desired to be investigated), and a polynucleotide encoding a reporter gene system that is operably connected to the regulatory sequence.

[0117] In the present invention, the polynucleotide encoding the expression system of the candidate molecule, the polynucleotide encoding the regulatory sequence activated by the response in the predetermined cell, and the polynucleotide encoding the reporter gene system operably linked to the coding regulatory sequence may be arranged on the same vector, or may be arranged on different vectors. The arrangement of the polynucleotide encoding the expression system of the candidate molecule, the polynucleotide encoding the regulatory sequence activated by the response in the predetermined cell, or the polynucleotide encoding the reporter gene system on each vector is not particularly limited as long as the candidate molecule is expressed, the regulatory sequence is activated by the response in the cell, and the expression of the reporter gene system is promoted by the activation of the regulatory sequence.

[0118] In one embodiment, a vector is provided, which is configured with a polynucleotide encoding the expression system of the candidate molecule, and a polynucleotide encoding the regulatory sequence and a polynucleotide encoding the reporter gene system arranged in sequence from upstream. In another embodiment, a vector set is provided, which includes a vector configured with a polynucleotide encoding the expression system of the candidate molecule, and a vector configured with a polynucleotide encoding the regulatory sequence and a polynucleotide encoding the reporter gene system in sequence from upstream. In another embodiment, a vector set is provided, which includes a vector configured with a polynucleotide encoding the expression system of the candidate molecule and a polynucleotide encoding a part of the reporter gene system (for example, the enzyme recognition sequence described later, LoxP or its variant and marker sequence, or a sequence transferred by a transposase or integrase), and a vector configured with a polynucleotide encoding the regulatory sequence and a polynucleotide encoding the remaining part of the reporter gene system in sequence from upstream.

[0119] In one embodiment, as a polynucleotide encoding the expression system of the above-mentioned candidate molecule, a polynucleotide encoding an RNA expression system can be cited. For example, the expression system includes: a sequence encoding a double-stranded RNA (e.g., shRNA) containing an RNA sequence as the above-mentioned candidate molecule, and a transcriptional regulatory sequence such as an RNAPol III promoter (e.g., U6 promoter, H1 promoter, etc.) or an RNAPol II promoter (CMV promoter, etc.) operably connected thereto. In the case where the above-mentioned candidate molecule is a gRNA, a protein (e.g., Cas9 protein, Cas9 nickase, dCas9 / VP64, dCas9 / VPR, dCas9 / KRAB, dCas9 / KRAB / MeCP2, base editor, etc.) for enabling the gRNA to function can also be co-expressed. In another embodiment, the polynucleotide encoding peptide expression system of the expression system of the above-mentioned candidate molecule, the expression system of the peptide includes a sequence encoding a peptide as the above-mentioned candidate molecule and a transcriptional regulatory sequence such as a promoter operably connected thereto. Nucleotide sequences encoding target RNA or target peptide, and vectors containing these expression systems can be synthesized or purchased through commercially available services.

[0120] As the regulatory sequence activated by the above-mentioned predetermined intracellular response, a transcriptional regulatory sequence and a translational regulatory sequence can be cited. As the transcriptional regulatory sequence, a transcriptional regulatory sequence directly or indirectly activated by the intracellular response caused by the candidate molecule, such as DNA damage response, oxidative stress response or protein expression, such as activation of signal pathways such as Wnt pathway, etc. can be cited. As a more specific example of such a transcriptional regulatory sequence, p53 binding sequence (p53RE), antioxidant response sequence (ARE), nuclear factor κB (NF-kB) binding sequence, transcription activator 6 response sequence (ATF6 ERSE), metal regulatory element (MRE), heat shock element (HSE), hypoxia response element (HRE), exogenous substance response element (XRE, Xenobiotic Responsive Element), activated T cell nuclear factor (NFAT) binding sequence, and TCF / LEF type DNA binding protein binding sequence can be cited. These transcriptional regulatory sequences activate the promoter configured downstream thereof, which promotes the expression of the reporter gene system described later. The type of the promoter is not limited as long as it can be activated under the control of the transcriptional regulatory sequence. The promoter may be contained in a polynucleotide encoding the transcriptional regulatory sequence, or may be contained in a reporter gene system described below.

[0121] The above-mentioned translation regulatory sequence activated by a predetermined intracellular response is, for example, a sequence that is activated as the intracellular response caused by the candidate molecule is investigated, and promotes the translation of the downstream coding RNA. As a more specific example of the translation regulatory sequence, sesRNA can be cited. sesRNA is a module that expresses downstream coding RNA through the activity of any mRNA molecule and ADAR protein in the cell, and is a sensor for mRNA expression (see Nature, 2022, 610: 713-721, Nature Biotechnology, 2023, 41: 698-707, Nature Biotechnology, 2023, 41: 482-487, WO / 2023 / 077135, WO / 2023 / 077138, US20230123513). sesRNA contains an RNA sequence complementary to a specific target mRNA. If the ADAR protein in the cell acts on the double strand of sesRNA and the mRNA molecule, the downstream connected coding RNA can be translated. If a sequence encoding a reporter gene system is arranged downstream of the sesRNA coding sequence, the expression of the reporter gene system reflects the expression of the target mRNA.

[0122] As another specific example of the above-mentioned translation regulatory sequence, toehold RNA can be cited. The toehold RNA contains a sequence complementary to the target mRNA, a ribosome binding sequence, and is connected to the downstream coding RNA. The toehold RNA usually forms a hairpin loop, so the coding RNA is not translated, but if it binds to the target mRNA, the hairpin disappears and translation is performed (see Toehold switch, Nature Biotechnology, 2022, 40: 53-545). If a sequence encoding a reporter gene system is configured downstream of the toehold RNA coding sequence, the expression of the reporter gene system reflects the expression of the target mRNA.

[0123] The reporter gene system encoded by the vector provided by the present invention is operably connected to the above-mentioned regulatory sequence and expressed by activation of the regulatory sequence. Therefore, the expression of the reporter gene system indicates that a predetermined intracellular response has been generated by the above-mentioned candidate molecule. By measuring the expression of the reporter gene system, it can be determined whether the candidate molecule is a substance that causes the predetermined intracellular response (i.e., whether it is the target molecule to be explored).

[0124] As the above-mentioned reporter gene system, luminescent or fluorescent protein reporter gene system, enzyme reporter gene system and the like can be cited. The luminescent or fluorescent protein reporter gene system expresses luminescent or fluorescent protein. The expressed luminescent or fluorescent protein is detected as a marker. The enzyme reporter gene system expresses an enzyme that generates a detectable marker molecule. The molecule generated by the action of the expressed enzyme is detected as a marker. As examples of enzymes expressed by the enzyme reporter gene system, DNA nucleases, DNA recombinases, hydrolases (such as β-glucuronidase), transposases, integrases and the like can be cited. Among them, proteins (DNA nucleases, DNA recombinases, transposases, integrases, etc.) that have the effect of changing the target nucleotide sequence are preferred. Therefore, as an example of the enzyme reporter gene system, a combination of a protein that has the effect of changing the target nucleotide sequence and the target sequence can be cited.

[0125] Examples of the above-mentioned DNA nucleases include Cas family such as Cas9 nuclease, transcription activator-like effector nuclease (TALEN), artificial nucleases such as zinc finger nuclease (ZFN), base editors, lead editors, etc.; restriction enzymes, etc. As the restriction enzyme, a restriction enzyme that forms a sticky end at the cleavage site is preferred, for example, I-CeuI, I-SceI, PI-PspI and PI-SceI can be cited.

[0126] As an example of an enzyme reporter gene system using an artificial nuclease, a combination of an artificial nuclease and its recognition sequence can be cited, such as a combination of a Cas family such as Cas9 nuclease and a guide RNA (gRNA or sgRNA) and a Cas recognition sequence, a combination of a base editor or a lead editor and its recognition sequence, a combination of a TALEN and its recognition sequence, or a combination of a ZFN and its recognition sequence. Preferably, the recognition sequence of the TALEN or ZFN consists of 30 to 50 nucleotides. As an example of an enzyme reporter gene system using a restriction enzyme, a combination of a restriction enzyme and a corresponding restriction enzyme recognition sequence can be cited. In these systems, a DNA sequence cut by an artificial nuclease or restriction enzyme can be detected as a marker. The recognition sequence of the artificial nuclease or the restriction enzyme recognition sequence can be configured on the same vector as the vector containing the polynucleotide encoding the artificial nuclease or restriction enzyme, or it can be configured on a different vector. For example, the recognition sequence can be configured on a vector containing a polynucleotide encoding the expression system of the candidate molecule. As a method for detecting a cut DNA sequence, next-generation sequencing, PCR, etc. such as large-scale parallel sequencing can be cited.

[0127] As an example of an enzyme reporter gene system using the above-mentioned DNA recombinase, the CRE-LoxP system can be cited. This system consists of a CRE recombinase, two LoxP sequences, and a marker sequence arranged between them. The LoxP sequence and the marker sequence can be arranged on the same vector as the vector containing the polynucleotide encoding the CRE recombinase, or they can also be arranged on different vectors. For example, the LoxP sequence and the marker sequence can be arranged on a vector containing a polynucleotide encoding the expression system of the above-mentioned candidate molecule. These two LoxP sequences can be arranged in series in the same direction, or they can be arranged in series in opposite directions. When the LoxP sequences are arranged in the same direction, the marker sequence between them is cut out under the action of CRE, and on the other hand, when the LoxP sequences are arranged in the opposite direction, the marker sequence between them is inverted under the action of CRE. Therefore, it is sufficient to detect the cut-out sequence itself as a marker sequence, or to detect the sequence generated on the vector by excising the sequence as a marker sequence, or to detect the inverted marker sequence. Examples of methods for detecting marker sequences include next generation sequencing such as massively parallel sequencing, and PCR.

[0128] Alternatively, a marker sequence is arranged in the direction opposite to the transcription direction between two LoxP sequences arranged in opposite directions, and a promoter is connected to the upstream of the LoxP sequence on the vector. In a state where CRE does not function, the marker is not expressed, but if the marker sequence is inverted between the LoxP sequences under the action of CRE, that is, reconfigured in a transcribable direction, the marker will be expressed under the action of the promoter. It is sufficient to detect the expressed marker. In this case, a sequence encoding a luminescent or fluorescent protein is preferably the marker sequence because it is easy to detect. As an example of an ideal combination of a promoter and a marker sequence, a combination of an EF1 promoter and an mKate2 coding sequence can be cited.

[0129] Examples of reporter gene systems having the same function as the CRE-LoxP system include systems that replace the LoxP sequence in the CRE-LoxP system or have a sequence of a LoxP variant in addition thereto, the Vika-Vox system, the Dre-Rox system, and the Flp-FRT system. Examples of LoxP variants include Lox71, Lox66, Lox5171, Lox2722, and Loxm2. In this specification, the CRE-LoxP system and reporter gene systems having the same function are also collectively referred to as "CRE-LoxP-like systems".

[0130] As an example of an enzyme reporter gene system using the above-mentioned transposase, the piggyBac transposon system can be cited. The system comprises a combination of piggyBac transposase and two inverted repeat sequences (inverted terminal repeat sequence, Inverted Terminal Repeat Sequence; ITR). These two ITRs are arranged in series in opposite directions to each other, and any marker sequence can be arranged between them. The ITR and the marker sequence can be arranged on the same vector as the vector containing the polynucleotide encoding the transposase, or can also be arranged on different vectors. For example, the ITR and the marker sequence can be arranged on a vector containing a polynucleotide encoding the expression system of the above-mentioned candidate molecule. It is sufficient to detect the translocation of the marker sequence between the two ITRs under the action of the transposase (the marker sequence disappears from between the ITRs). Alternatively, it is sufficient to set a TTAA sequence in the vector and detect the marker sequence translocated to the position of the TTAA sequence. Alternatively, it is sufficient to detect the marker sequence of the TTAA sequence translocated to the genome. In one embodiment, a polynucleotide encoding the expression system of the candidate molecule is configured as the marker sequence, and the disappearance of the polynucleotide from the ITR or the translocation of the polynucleotide to the position of the TTAA sequence is detected. As a method for detecting the marker sequence, next generation sequencing such as massive parallel sequencing, PCR, etc. can be cited.

[0131] As an example of an enzyme reporter gene system using the above-mentioned integrase, the phiC31 / attP system can be cited. The system includes: a vector containing the phiC31 integrase, and a donor vector containing an attB site. The phiC31 integrase recombines the attP site of the host genome and the attB site of the donor vector, and integrates the donor vector into the genome. Using the sequence of the donor vector as a marker, the marker sequence translocated into the genome can be detected. As a method for detecting the marker sequence, next-generation sequencing such as massively parallel sequencing, PCR, etc. can be cited.

[0132] The vector or vector group used in the present invention may further have an inherent molecular barcode (Unique Molecular Identifier; UMI) sequence. For example, each vector molecule is identified by an inherent UMI regardless of the candidate molecule, regulatory sequence, or reporter gene system encoded. By performing analysis taking UMI into consideration, the influence of amplification of sequences generated during the analysis process (cell division, PCR during library creation, etc.) can be eliminated and deviations can be reduced. For example, only the expression level of the reporter gene system assigned a unique UMI can be analyzed, or the expression level of the reporter gene associated with the UMI can be corrected based on the number of UMI detections.

[0133] The type of vector provided by the present invention is not particularly limited as long as it can express the above-mentioned candidate molecules and reporter gene systems carried in the host cell into which the vector is introduced. Examples of the vector include plasmid vectors, linear DNA sequences, transposon vectors, viral vectors, etc. The viral vector can be a DNA vector or an RNA vector, and examples thereof include lentiviral vectors, adeno-associated viral vectors, baculoviral vectors, MMLV retroviral vectors, and MSCV (mouse stem cell virus, Murine stem cell virus) retroviral vectors, etc. The vector can be present outside the nucleus of the cell introduced, or it can be integrated into the genome and exist. The above-mentioned polynucleotide can be integrated into the vector according to a conventional method.

[0134] In the method for searching for functional molecules of the present invention, the above-mentioned vector or vector group is introduced into a cell, and then the expression of the above-mentioned reporter gene system contained in the vector or vector group in the cell is measured.

[0135] The cell (host cell) into which the above-mentioned vector is introduced can be a mammalian cell or a non-mammalian cell. Preferably, the cell is a cell of a mammal such as a human, a mouse, or a rat. Preferably, the cell is a microbial cell. Preferably, the cell is a cultured cell. Examples of the cell include cells taken from humans or non-human animals (e.g., mice, rats, etc.), cells taken from samples derived from patients or experimental animals, primary cultured cells, organoids, cell spheroids, immortalized cultured cells, cells in tissue sections derived from samples, microbial cells such as Escherichia coli, etc. Cells in the body of an individual experimental animal can also be used.

[0136] The introduction of the vector into the host cell can be carried out by conventional methods such as the calcium phosphate method, electroporation, liposome method, gene gun method, PEG method, etc. Reagents and instruments for introducing the vector into cells are commercially available.

[0137] The method for measuring the expression of the above-mentioned reporter gene system can be appropriately selected according to the type of the reporter gene system. Preferably, it is a method that can quantify the marker produced by the reporter gene system. In one example, when the marker is a protein, known protein quantification methods, such as colorimetric methods, absorbance measurement, chromatography, immunoassay, etc., and methods for quantifying mRNA encoding proteins, such as quantitative RT-PCR, sequencing, etc. can be cited. In another example, when the marker is a luminescent or fluorescent protein, as its measurement method, luminescent or fluorescent imaging, luminescent or fluorescent photometry, etc. can be cited.

[0138] In another example, when the marker generated from the reporter gene system is a DNA sequence cleaved by an artificial nuclease or restriction enzyme, a mutation of a DNA sequence induced by cleavage by an artificial nuclease or restriction enzyme (substitution or deletion of a base generated at the cleavage site during cleavage), or a DNA sequence mutated by a protein that mutates a recognition sequence such as a base editor or a lead editor, as a method for measuring the expression of the reporter gene system, a method that can detect the amount of the cleaved sequence or the mutated DNA sequence such as next-generation sequencing such as quantitative PCR and massively parallel sequencing can be cited. For example, when an artificial nuclease recognition sequence or a restriction enzyme recognition sequence is configured on the vector, the expression level of the reporter gene system can be quantified by amplifying and quantifying a portion of the vector sequence containing the cleavage site using PCR, or by quantifying the sequence reads using a portion of the vector sequence containing the cleavage site as a reference sequence.

[0139] In another example, when the reporter gene system is the CRE-LoxP system, as the measurement method, there can be cited a method for quantifying the marker sequence cut out from between LoxP sequences arranged in the same direction, a method for quantifying the vector sequence remaining after the sequence is cut, and a method for quantifying the inverted marker sequence between LoxP sequences arranged in opposite directions. The quantification of the sequence can be performed using quantitative PCR, next generation sequencing such as massive parallel sequencing, etc. Alternatively, if a marker sequence encoding a protein is connected in the opposite direction between LoxP sequences arranged in the opposite direction as described above, the marker protein expressed by the marker sequence inverted by CRE can be quantified using the above-mentioned protein quantification method, luminescence or fluorescence measurement method. The same is true for other CRE-LoxP-like systems.

[0140] In another example, when the reporter gene system is a system using the transposase or integrase, the determination method may include a method for quantifying the sequence of the translocated marker sequence or the deletion marker sequence. The quantification of the sequence may be performed using next generation sequencing such as quantitative PCR, massively parallel sequencing, etc.

[0141] The expression of the reporter gene system indicates that a predetermined intracellular response that activates the regulatory sequence contained in the vector or vector set is generated by the candidate molecule. By measuring the expression of the reporter gene system, it can be determined whether the candidate molecule is a substance that causes the predetermined intracellular response (i.e., whether it is the target molecule to be explored).

[0142] In one embodiment, the method of the present invention comprises the steps of introducing at least one vector or vector group into one cell, and measuring the expression of a reporter gene system from the vector or vector group.

[0143] In this specification, "introducing at least one vector into one cell" means that at least one common vector is introduced into one cell, including the case where one or more vectors are introduced into a single cell, the case where at least one or more common vectors are introduced into multiple cells, and the case where different types of vectors are introduced into each of multiple cells. In any case, the total number of vectors introduced into each cell can be one or more than two. Each of the introduced vectors contains: a polynucleotide encoding the expression system of the candidate molecule, a polynucleotide encoding the regulatory sequence, and a polynucleotide encoding the reporter gene system.

[0144] In addition, "introducing at least one vector group into one cell" in this specification means introducing at least one common vector group into one cell, including the case of introducing one or more vector groups into a single cell, the case of introducing at least one or more common vector groups into multiple cells, and the case of introducing different types of vector groups into each of multiple cells. In any case, the total number of vector groups introduced into each cell can be one or more than two. The introduced vector group includes: a polynucleotide encoding the expression system of the candidate molecule, a polynucleotide encoding the regulatory sequence, and a polynucleotide encoding the reporter gene system, and these polynucleotides are contained in any one of the two or more vectors constituting the vector group.

[0145] Preferably, in the method of the present invention, the intracellular response caused by the candidate molecules respectively contained in two or more vectors or two or more vector groups is analyzed. For example, in the method of the present invention, two or more vectors or two or more vector groups are added to a cell population and each vector or vector group is introduced into any cell in the cell population, and then the expression of the reporter gene system from each vector or vector group is measured.

[0146] Hereinafter, the composition and steps of the method of the present invention when using two or more vectors (each comprising a polynucleotide encoding the expression system of the candidate molecule, a polynucleotide encoding the regulatory sequence, and a polynucleotide encoding the reporter gene system) are described. It is clear to those skilled in the art that the method of the present invention can be implemented with the same composition and steps when two or more vector groups (each group comprising a polynucleotide encoding the expression system of the candidate molecule, a polynucleotide encoding the regulatory sequence, and a polynucleotide encoding the reporter gene system) are used to replace the two or more vectors.

[0147] In one embodiment, the above two or more vectors each contain a polynucleotide encoding a different regulatory sequence activated by a response in a different cell, and a polynucleotide encoding a different reporter gene system operably connected to the regulatory sequence, on the other hand, the candidate molecules encoded in each vector may be the same or different from each other, preferably different from each other in each vector. Preferably, the reporter gene system is a luminescent or fluorescent protein reporter gene system.

[0148] In another embodiment, the reporter gene system is a combination of an artificial nuclease and its recognition sequence, or a combination of a restriction enzyme and a corresponding restriction enzyme recognition sequence.

[0149] In one example, the above two or more vectors include: polynucleotides encoding candidate molecules that are identical or different from each other, polynucleotides encoding regulatory sequences that are different from each other and activated by responses in different cells, and polynucleotides encoding reporter gene systems that are operably connected to the regulatory sequences. In another example, the above two or more vectors encode common candidate molecules, and on the other hand, they encode regulatory sequences that are different from each other (activated by responses in different cells) and sequences of reporter gene systems. In another example, the above two or more vectors encode different candidate molecules, respectively, and on the other hand, they encode common regulatory sequences and sequences of reporter gene systems.

[0150] In the present embodiment, a vector cut by an enzyme is generated along with the response in the cell. Then, the vector fragment cut due to the action of each candidate molecule is quantified. When quantified by PCR, two kinds of reverse primers are used that are respectively bound to the upstream and downstream of the inferred cleavage site (enzyme recognition sequence) of the vector. The forward primer can use a primer that is bound to the sequence encoding each candidate molecule. Alternatively, the forward primer can also be a primer that is bound to a barcode sequence corresponding to the sequence encoding each candidate molecule (for example, a sequence that is different for each shRNA adjacent to the shRNA coding sequence). When the value obtained by the amount of the amplified product generated by the reverse primer bound to the upstream of the inferred cleavage site divided by the amount of the amplified product generated by the reverse primer bound to the downstream is a high value compared to the value in the control template where no cutting occurs, it is considered that the cutting is generated in the vector due to the presence of the candidate molecule. Detection of the cutting of the vector indicates that each candidate molecule has caused a response in the cell.

[0151] In another embodiment, the reporter gene system of the above-mentioned vector is a combination of a base editor or a lead editor and its recognition sequence.

[0152] In one example, the above two or more vectors include: polynucleotides encoding candidate molecules that are identical or different from each other, polynucleotides encoding regulatory sequences that are different from each other and activated by responses in different cells, and polynucleotides encoding reporter gene systems that are operably connected to the regulatory sequences. In another example, the above two or more vectors encode common candidate molecules, and on the other hand, different regulatory sequences (respectively activated by responses in different cells) and reporter gene system sequences are encoded. In another example, the above two or more vectors encode different candidate molecules, respectively, and on the other hand, common regulatory sequences and reporter gene system sequences are encoded.

[0153] In the present embodiment, mutations are introduced into the sequence on the vector along with the response in the cell. Next, the vector fragments that have mutated due to the action of each candidate molecule are quantified. When quantification is performed using PCR, the vector fragments containing each candidate molecule sequence or a marker sequence associated therewith and a mutated sequence are amplified and quantified using PCR in the same manner as described above. In PCR, a forward primer that binds to the same candidate molecule sequence as described above or a marker sequence associated with the candidate molecule sequence, and a reverse primer that binds to the mutated sequence can be used. Detection of the amplified product indicates that each candidate molecule has caused a response in the cell. When quantification is performed using sequencing, the sequence of the vector fragment containing each candidate molecule sequence or the above-mentioned marker sequence and the mutated sequence is used as a reference sequence. The mutated sequence can be, for example, the sequence targeted by the above-mentioned protein that has the effect of changing the target nucleotide sequence and its surrounding sequence. Various vectors in the cell are sequenced together, and the reads corresponding to each reference sequence are detected or quantified. When there are reads corresponding to the reference sequence, for example, when a sequence change occurs in the targeted sequence or its surrounding sequence region in the matched reads, it indicates that each candidate molecule causes a response in the cell.

[0154] In another embodiment, the reporter gene system comprises a CRE-LoxP-like system.

[0155] In one example, the above two or more vectors contain: polynucleotides encoding candidate molecules that are the same or different from each other, polynucleotides encoding regulatory sequences that are different from each other and activated by responses in different cells, and polynucleotides encoding reporter gene systems that are different from each other and operably linked to the regulatory sequences. In another example, the above two or more vectors encode a common candidate molecule, and on the other hand, sequences encoding different regulatory sequences (activated by responses in different cells) and reporter gene systems. The CRE-LoxP-like system is selected from the CRE-LoxP (and / or LoxP variant) system, the Vika-Vox system, the Dre-Rox system, and the Flp-FRT system, and different types of CRE-LoxP-like systems can be used for each vector.

[0156] In another example, the two or more vectors encode different candidate molecules and, on the other hand, encode a common regulatory sequence and a sequence of a reporter gene system (CRE-LoxP-like system).

[0157] The two LoxP-like sequences (two LoxP sequences or sequences of variants thereof, two Vox sequences, two Rox sequences, or two FRT sequences) of the reporter gene system can be arranged on a vector encoding the candidate molecule, and in this case, different types of LoxP-like parts can be arranged on the same vector. For example, the two LoxP-like sequences are arranged opposite to each other, and the marker sequence is arranged between them. The type of marker sequence can be the same or different for each vector.

[0158] In this embodiment, the marker sequence between LoxP is inverted with the response in the cell. Then, the vector fragment containing the sequence encoding each candidate molecule and the inverted marker sequence is quantified. When quantified by PCR, the vector fragment containing each candidate molecule sequence or the marker sequence associated therewith and the inverted marker sequence is amplified and quantified by PCR as described above. In PCR, the forward primer bound to each candidate molecule sequence or the marker sequence associated therewith and the reverse primer bound to the inverted marker sequence as described above can be used. The presence of the amplified product indicates that each candidate molecule has caused a response in the cell. In another example, the vector sequence obtained from the cell is amplified using a sequence of a forward primer annealed to each candidate molecule sequence or the marker sequence associated therewith and a reverse primer designed in a manner to increase the sequence containing the marker sequence. The inversion amount of the marker sequence in the amplified product can be quantified by performing quantitative PCR. When quantified in sequencing, the sequence of the vector fragment containing the sequence encoding the candidate molecule and the marker sequence is used as a reference sequence. At this time, a series of reference sequences covering the combination of each candidate molecule sequence or the above-mentioned marker sequence and the inversion marker sequence are prepared. Various vectors in the cell are sequenced intensively, and the reads corresponding to each reference sequence are detected or quantified. The presence of reads corresponding to each reference sequence, for example, the presence of reads corresponding to each reference sequence in which the marker sequence has changed from the original sequence, indicates that each candidate molecule has caused a response in the cell.

[0159] In another embodiment, the reporter gene system comprises the piggyBac transposon system or the phiC31 / attP system.

[0160] In one example, the above two or more vectors include: polynucleotides encoding candidate molecules that are identical or different from each other, polynucleotides encoding regulatory sequences that are activated by responses in different cells, and polynucleotides encoding reporter gene systems that are operably connected to the regulatory sequences. In another example, the above two or more vectors encode common candidate molecules, on the other hand, sequences encoding regulatory sequences that are different from each other (activated by responses in different cells) and reporter gene systems. The type of marker sequence that is translocated due to the reporter gene system is different in each vector.

[0161] In another example, the two or more vectors encode different candidate molecules and, on the other hand, encode common regulatory sequences and reporter gene system sequences.

[0162] In this embodiment, a predetermined marker sequence is translocated in accordance with the response in the cell. Next, the sequence encoding each candidate molecule and the translocated marker sequence or the vector sequence remaining after the marker sequence is translocated are quantified. Preferably, the sequence is pre-constructed so that the sequence of the vector containing the candidate molecule or the marker sequence associated therewith is changed by the translocation of the marker sequence, and then the sequence encoding the candidate molecule and the sequence are quantified for the presence or absence of sequence changes caused by the translocation of the marker sequence.

[0163] When quantification is performed using PCR, for example, each candidate molecule sequence and marker sequence are amplified. The presence of the amplified product indicates that each candidate molecule has caused a response in the cell. When quantification is performed in sequencing, a sequence containing each candidate molecule sequence and a marker sequence is used as a reference sequence, and the reads corresponding to each reference sequence are detected or quantified. The presence of reads corresponding to each reference sequence, for example, the presence of reads corresponding to each reference sequence in which the marker sequence has changed from the original sequence, indicates that each candidate molecule has caused a response in the cell.

[0164] In the above series of embodiments, when each vector encodes a common candidate molecule, the function of the candidate molecule can be inferred based on the type of reporter gene system expressed. That is, it can be inferred that the intracellular response associated with the expressed reporter gene system (the intracellular response that activates the regulatory sequence operably linked to the reporter gene system) is caused by the candidate molecule. On the other hand, when each vector encodes a different candidate molecule and encodes a common regulatory sequence, a functional molecule that causes a specific intracellular response can be screened.

[0165] When the vector molecule contains a unique molecular barcode (UMI), each vector molecule can be individually identified. The sequence of the UMI can be investigated by sequencing. By associating the UMI with the candidate molecule and the reporter gene, the deviation in the expression level of the reporter gene accompanying the sequence amplification generated during the analysis process can be reduced.

[0166] According to the above method of the present invention, the intracellular response caused by the candidate molecule can be easily detected according to the expression of the reporter gene, and in addition, the candidate molecule can be easily associated with the intracellular response caused by it. Therefore, according to the method of the present invention, the efficiency of the functional analysis of functional molecules such as RNA, peptides is improved. In addition, in the method of the present invention, more than two carriers or carrier groups can be imported into a cell group, and the behavior of each carrier or carrier group is analyzed. In this case, more than two candidate molecules can be investigated once with a cell group (for example, in a hole), or the function of a candidate molecule can be investigated once from different aspects, so the throughput of the comprehensive analysis of functional molecules can be improved.

[0167] The method for exploring functional molecules that cause intracellular responses of the present invention can be applied to new drugs, diagnosis, etc. For example, when the present method is applied to new drug screening, the candidate molecules encoded by the vector or vector group of the present invention are used as candidate molecules of the drug, and the vector or vector group is constructed in a manner that encodes a regulatory sequence activated by an intracellular response caused by or bringing about the target drug effect and a reporter gene system operably connected to the regulatory sequence. In addition, for example, when the present method is applied to the exploration of target genes of drugs, the candidate molecules encoded by the vector or vector group of the present invention are used as molecules that specifically inhibit candidate genes of new drug targets, and the regulatory sequence activated by the intracellular response encoded by the vector or vector group and the reporter gene system operably connected to the regulatory sequence are used as a system for detecting signal pathways related to drug efficacy. As one example, when exploring therapeutic targets for cancer, a variety of shRNAs that inhibit various genes are used as candidate molecules, and a reporter gene bound to a regulatory sequence (p53 binding sequence (p53RE), antioxidant responsive sequence (ARE), etc.) that is believed to be related to the efficacy of a cancer drug and is activated during a stress response in cancer cells is used as a reporter gene system.

[0168] (Diagnostic methods, kits)

[0169] In one embodiment, the present invention provides a method for diagnosing a disease, the method comprising the steps of administering the vector or vector set of the present invention to a patient or a cell derived from a sample collected from a patient, and measuring the expression of the reporter gene system from the administered vector or vector set. Preferably, the candidate molecule encoded by the vector or vector set is an shRNA that specifically inhibits the pathogenic gene (e.g., mutant gene, genetic polymorphism, etc.) of the diagnostic target. The regulatory sequence encoded by the vector or vector set that is activated by the response in the cell uses a sequence that responds to the changes caused by the inhibition of the pathogenic gene. As specific examples of regulatory sequences, p53 binding sequence (p53RE), antioxidant response sequence (ARE), nuclear factor κB (NF-kB) binding sequence, transcription activator 6 response sequence (ATF6 ERSE), metal regulatory element (MRE), heat shock element (HSE), hypoxia response element (HRE), exogenous substance response element (XRE), nuclear factor of activated T cells (NFAT) binding sequence, TCF / LEF type DNA binding protein binding sequence, sesRNA, or toehold RNA can be cited. The expression of the reporter gene system from the vector or vector set indicates the activation or abnormal expression of the subject disease-causing gene in the patient.

[0170] In one embodiment, the present invention provides a companion diagnostic method, which comprises the steps of administering the vector or vector group of the present invention to a patient or a cell derived from a sample taken from a patient, and measuring the expression of the above-mentioned reporter gene system from the administered vector or vector group. In one embodiment, the candidate molecule encoded by the vector or vector group is an shRNA that complementarily binds to the target gene of the drug whose effect in the patient is to be investigated and inhibits its expression. In another embodiment, the candidate molecule encoded by the vector or vector group is an shRNA that complementarily binds to a mutant (genetic polymorphism, etc.) of the target gene and inhibits its expression. In another embodiment, the candidate molecule encoded by the vector or vector group is an shRNA that complementarily binds to a gene related to the metabolism of the drug whose effect in the patient is to be investigated and inhibits its expression. The regulatory sequence encoded by the vector or vector group that is activated by a response in the cell selects a sequence that responds to the following biological signal, and the activation of the biological signal can be expected to reflect the therapeutic effect. As specific examples of regulatory sequences, there can be cited p53 binding sequence (p53RE), antioxidant response sequence (ARE), nuclear factor κB (NF-kB) binding sequence, transcription activator 6 response sequence (ATF6 ERSE), metal regulatory element (MRE), heat shock element (HSE), hypoxia response element (HRE), xenobiotic response element (XRE), nuclear factor of activated T cells (NFAT) binding sequence, TCF / LEF type DNA binding protein binding sequence, sesRNA, and toehold RNA. In actual diagnosis, for example, in companion diagnosis for cancer treatment, in order to clarify the therapeutic target that has an inhibitory effect on the target cancer cells, it is considered to use sequences that respond to intracellular stress, such as p53 response sequence and ATF6 ERSE. The expression of the reporter gene system from the vector or vector group is an indicator for predicting the therapeutic effect when the functional molecule is inhibited or the target gene is activated in the tissue of the patient. For example, in the example of companion diagnosis for the above-mentioned cancer treatment, the target gene for stressing cancer cells can be determined in the patient's tissue. The results of this assay can be used as a stratification marker when prescribing molecular targeted drugs for target genes to cancer patients.

[0171] The present invention further provides a kit comprising the above-mentioned vector or vector set of the present invention, that is, a vector or vector set comprising a polynucleotide encoding an expression system of a candidate molecule, a polynucleotide encoding a regulatory sequence activated by a predetermined intracellular response, and a polynucleotide encoding a reporter gene system operably linked to the regulatory sequence. The kit may further comprise, as necessary, a reagent for detecting the expression of the reporter gene system from the vector or vector set, a reagent for introducing the vector or vector set into cells, a pharmaceutically acceptable carrier for administering the vector or vector set to a patient, and the like.

[0172] In one embodiment, the above-mentioned kit is a diagnostic drug for a disease. In one embodiment, the candidate molecule encoded by the vector or vector group used in the diagnostic drug is a shRNA or siRNA that complementarily binds to the pathogenic gene (e.g., mutant gene, genetic polymorphism, etc.) of the diagnostic object and inhibits its expression. In one embodiment, as the regulatory sequence encoded by the vector or vector group, p53 binding sequence (p53RE), antioxidant response sequence (ARE), and nuclear factor κB (NF-kB) binding sequence, transcription activator 6 response sequence (ATF6 ERSE), metal regulatory element (MRE), heat shock element (HSE), hypoxia response element (HRE), exogenous substance response element (XRE), activated T cell nuclear factor (NFAT) binding sequence, TCF / LEF type DNA binding protein binding sequence, sesRNA, and toehold RNA can be cited.

[0173] In one embodiment, the above-mentioned kit is a companion diagnostic drug. In one embodiment, the candidate molecule encoded by the vector or vector group used in the companion diagnostic drug is a shRNA or siRNA that complementarily binds to the target gene of the drug whose effect in the patient is to be investigated or a mutant (genetic polymorphism, etc.) of the target gene to inhibit its expression. In another embodiment, the candidate molecule encoded by the vector or vector group used in the companion diagnostic drug is a shRNA or siRNA that complementarily binds to a gene related to the metabolism of the drug whose effect in the patient is to be investigated to inhibit its expression. In one embodiment, the regulatory sequences encoded by the vector or vector group include p53 binding sequence (p53RE), antioxidant response sequence (ARE), nuclear factor κB (NF-kB) binding sequence, transcription activator 6 response sequence (ATF6 ERSE), metal regulatory element (MRE), heat shock element (HSE), hypoxia response element (HRE), exogenous substance response element (XRE), nuclear factor of activated T cells (NFAT) binding sequence, TCF / LEF type DNA binding protein binding sequence, sesRNA, and toehold RNA, etc.

[0174] (Method for analyzing the activity of regulatory sequences)

[0175] The present invention further provides a method for analyzing the activity of a regulatory sequence (transcriptional regulatory sequence or translational regulatory sequence). This analytical method uses a vector comprising a polynucleotide encoding a regulatory sequence as an analysis object, a polynucleotide encoding a reporter gene system operably connected to the regulatory sequence, and a marker sequence that recognizes the regulatory sequence. In this analytical method, in a cell into which the vector is introduced, a predetermined intracellular response is induced, and then the expression of the reporter gene system encoded by the vector is quantified. The activity of the regulatory sequence for the predetermined intracellular response is evaluated based on the expression of the reporter gene system and the marker sequence.

[0176] The regulatory sequence encoded by the above-mentioned vector is not particularly limited as long as it is a transcriptional regulatory sequence or a translational regulatory sequence that is intended to analyze the activity of the response in a given cell. The type of the given intracellular response is not particularly limited, for example, DNA damage response, oxidative stress response, specific protein or mRNA expression can be cited. Preferably, the regulatory sequence is a transcriptional regulatory sequence. Preferably, the transcriptional regulatory sequence is a promoter or a promoter variant.

[0177] As the marker sequence for identifying the regulatory sequence contained in the above-mentioned vector, for example, a barcode sequence for identifying the regulatory sequence according to each type and a molecular barcode sequence (Unique Molecular Identifier; UMI) for inherently identifying the regulatory sequence can be cited. For example, a different barcode sequence is assigned to the type, structure or sequence of each regulatory sequence. Alternatively, the marker sequence may also exist in the region of the regulatory sequence. For example, a regulatory sequence variant having a mutation in the sequence itself can become a marker sequence.

[0178] Examples of reporter gene systems encoded by the above-mentioned vectors include luminescent or fluorescent protein reporter gene systems, enzyme reporter gene systems, etc. Examples of enzymes expressed by the enzyme reporter gene system include DNA nucleases, DNA recombinases, hydrolases (e.g., β-glucuronidase), transposases, integrases, etc. Specific examples of the enzyme reporter gene system are as described above.

[0179] In a preferred embodiment, the reporter gene system comprises a protein having the function of changing the target nucleotide sequence and its target sequence, and the target sequence is changed by the expression of the reporter gene system. By measuring the amount of change in the target sequence, the expression of the reporter gene system can be quantified. As preferred examples of such a reporter gene system, the above-mentioned CRE-LoxP-like system, piggyBac transposon system, phiC31 / attP system, base editor or lead editor and its recognition sequence can be cited. The CRE-LoxP-like system is composed of a CRE recombinase and two LoxP-like sequences and a marker sequence arranged between them. These two LoxP-like sequences can be arranged in series in the same direction, or in series in opposite directions. When CRE is expressed, when the LoxP-like sequences are arranged in the same direction, the marker sequence between them is cut out from the vector. On the other hand, when the LoxP sequences are arranged in the opposite direction, the marker sequence on the vector is inverted. The piggyBac transposon system is composed of a piggyBac transposase, two ITRs and a marker sequence between them. When the transposase is expressed, the marker sequence between the ITRs is translocated (disappears from between the ITRs). Therefore, by investigating changes or deletions in the target sequence (the marker sequence, enzyme recognition sequence) in the vector, the expression of the reporter gene system can be quantified.

[0180] Specifically, the analysis method comprises the following steps: preparing a cell into which the above-mentioned vector is introduced; inducing a predetermined intracellular response in the cell; after inducing the response, analyzing the region containing the target sequence and the marker sequence in the vector to quantify the change in the target sequence;

[0181] The target sequence is associated with the transcriptional regulatory sequence or the translational regulatory sequence based on the marker sequence,

[0182] Based on the amount of change in the target sequence, the activity of the transcriptional regulatory sequence or translational regulatory sequence associated with the target sequence with respect to the predetermined intracellular response is evaluated.

[0183] Examples of the types of vectors that can be used in the present analytical method, the types of cells (host cells) into which the vectors are introduced, and methods for introducing the vectors into cells include the same examples that can be used in the above-mentioned method for searching for functional molecules that cause intracellular responses.

[0184] The method for inducing the above-mentioned predetermined intracellular response in the present analysis method is not particularly limited, and examples thereof include the use of drugs or stimuli that induce DNA damage or oxidative stress, the use of signaling pathway activators such as the Wnt pathway, the inhibition of genes and proteins involved in DNA repair and anti-oxidation, the activation of genes and proteins involved in specific signaling pathways, the activation or inhibition of genes involved in target protein or mRNA expression, etc. Such drugs, stimuli, or methods for activating or inhibiting target genes and proteins are well known in the art.

[0185] The method for analyzing the region containing the target sequence and the marker sequence in the vector may be any method as long as it can detect and quantify changes in the nucleotide sequence, and examples thereof include quantitative RT-PCR, quantitative PCR, and sequencing.

[0186] The amount of change of the target sequence reflects the expression of the reporter gene system and even the activity of the regulatory sequence. On the other hand, the marker sequence present in the same region as the target sequence is owing to determining the regulatory sequence that brings the change of the target sequence, so the target sequence can be associated with the regulatory sequence based on the marker sequence. Therefore, the activity of the regulatory sequence associated with the target sequence for the above-mentioned established intracellular response can be evaluated based on the amount of change of the target sequence. For example, the amount of the change of the target sequence produced after the established intracellular response is larger, and the activity produced by the regulatory sequence associated with the target sequence for the established intracellular response is stronger.

[0187] This analysis method includes the following steps: introducing at least one vector into a cell, and measuring the expression of a marker or reporter gene system from the vector. The "introducing at least one vector into a cell" is as defined above. Preferably, a pool of multiple (more than two) vectors containing polynucleotides encoding different regulatory sequences is used in this analysis method to comprehensively analyze the activity of each regulatory sequence. For example, in the method of the present invention, after adding the pool of the vector to a cell group and introducing each vector into any cell in the cell group, the changes in the target sequence in each vector are comprehensively quantified. For example, by centrally sequencing the regions containing the target sequence and the marker sequence from different vectors, the changes in each target sequence can be quantified, and the regulatory sequence that brings about the changes in each target sequence can be determined based on the marker sequence.

[0188] (Method for exploring genes involved in intracellular responses)

[0189] The present invention further provides a method for exploring genes involved in a response within a cell. The method comprises the following steps:

[0190] Introducing a plurality of vectors or vector groups into a cell population, wherein the plurality of vectors or vector groups each encode: an RNA that interferes with a gene of a test subject, a regulatory sequence activated by a predetermined intracellular response, and a reporter gene system operably linked to the regulatory sequence, wherein the RNAs encoded by the plurality of vectors or vector groups are different from each other;

[0191] Determining the expression of the reporter gene system encoded by each of the plurality of vectors or vector groups in the cell population; and

[0192] Whether the test subject gene is a gene involved in the predetermined intracellular response is determined based on the expression of the reporter gene system contained in each of the plurality of vectors or vector groups.

[0193] Therefore, the vector or vector group used in the present method encodes: RNA that interferes with the above-mentioned subject gene, a regulatory sequence activated by a predetermined intracellular response to investigate the relationship with the above-mentioned subject gene, and a reporter gene system operably connected to the regulatory sequence. In other words, the vector or vector group comprises: a polynucleotide encoding the expression system of the RNA, a polynucleotide encoding the regulatory sequence, and a polynucleotide encoding the reporter gene system. These polynucleotides can be configured on the same vector, or they can also be configured on different vectors. The configuration of the polynucleotide encoding the expression system of the RNA, the polynucleotide encoding the regulatory sequence, or the polynucleotide encoding the reporter gene system on each vector is not particularly limited as long as the RNA is expressed and the expression of the reporter gene system is promoted by the activation of the regulatory sequence.

[0194] As the RNA that interferes with the above-mentioned subject gene encoded by the above-mentioned vector or vector group, shRNA, gRNA, miRNA, saRNA, lncRNA, eRNA, etc. can be cited. Among them, shRNA and gRNA are preferred. The expression system of the RNA can include a sequence encoding the RNA and a transcriptional regulatory sequence such as a promoter operably connected to the sequence. The subject gene is not particularly limited as long as it is a gene to be investigated for the relationship with the above-mentioned established intracellular response. The type of the established intracellular response is not limited, for example, DNA damage response, oxidative stress response, specific protein or mRNA expression can be cited.

[0195] The above-mentioned control sequence encoded by the above-mentioned vector or vector group is not particularly limited as long as it is a transcription control sequence or a translation control sequence activated by the response in the established cell to investigate the relationship with the above-mentioned subject gene. In addition, the above-mentioned reporter gene system encoded by the vector or vector group is not particularly limited as long as it can be expressed under the control of the control sequence. As examples of the control sequence and the reporter gene system, the examples illustrated by the control sequence and the reporter gene system encoded by the vector used in the exploration method of the functional molecule causing the response in the cell can be cited. The activity of the control sequence and the expression level of the reporter gene system controlled by it reflect the size of the response in the established cell caused by the introduction of the above-mentioned RNA.

[0196] The above-mentioned multiple vectors or vector groups used in the present method are preferably 3 or more, more preferably 4 or more vectors or vector groups. The above-mentioned RNAs encoded by each of the multiple vectors or vector groups interfere with the common subject gene, but are different from each other. For example, the above-mentioned RNA is a shRNA or gRNA that targets a common subject gene but is composed of sequences that are different from each other.

[0197] The reporter gene system encoded by the above-mentioned multiple vectors or vector groups is constructed to identify whether it is a sequence expressed due to any of the above-mentioned RNAs encoded by the multiple vectors or vector groups. Preferably, the reporter gene system encoded by the multiple vectors or vector groups marks its expression as being associated with the RNA encoded by the same vector or vector group.

[0198] In the present method, the expression of the reporter gene system encoded by each of the plurality of vectors or vector groups is measured respectively. Then, based on the expression of each of the measured reporter gene systems, it is determined whether the test subject gene is a gene involved in the predetermined intracellular response.

[0199] In one embodiment, the method comprehensively analyzes the size of the response in a given cell caused by the introduction of the above-mentioned RNA encoded by each of the above-mentioned multiple vectors or vector groups. For example, in the method of the present invention, after adding a pool of the multiple vectors or vector groups to a cell group and introducing each vector or vector group into any cell in the cell group, the expression of the reporter gene from each vector or vector group is measured. Based on the association between the above-mentioned reporter gene system and the above-mentioned RNA, the changes in the response in a given cell caused by each of the above-mentioned RNA can be comprehensively analyzed.

[0200] When the change of the above-mentioned predetermined intracellular response (e.g., promotion or inhibition of the response) is produced regardless of the type of the RNA introduced, it can be determined that the subject gene targeted by the RNA is involved in the predetermined intracellular response (promotion or inhibition). On the other hand, when the change of the predetermined intracellular response is produced only in the RNA of a specific type, the possibility that the subject gene targeted by the RNA is not involved in the predetermined intracellular response is higher.

[0201] In one embodiment, based on the statistical value of the expression of the reporter gene system included by each of the above-mentioned multiple vectors or vector groups (in other words, the change of the above-mentioned established intracellular response caused by the introduction of the RNA associated with the reporter gene system), it is determined whether the above-mentioned subject gene is a gene participating in the above-mentioned established intracellular response. For example, the mean value and median of the expression of all reporter gene systems can be calculated, and the subject gene is ranked based on this value. Alternatively, because the expression of more than half of the reporter gene systems has changed with the same trend (such as promoting or inhibiting), it can be determined that the subject gene has participated in the established intracellular response.

[0202] Examples of the types of vectors that can be used in the present method, the types of cells (host cells) into which the vectors are introduced, the methods for introducing the vectors into cells, and the methods for measuring the expression of the reporter gene system include the same examples that can be used in the above-mentioned method for exploring functional molecules that cause responses in cells.

[0203] Example

[0204] Hereinafter, the present invention will be described in more detail based on examples, but the present invention is not limited to these examples and the like.

[0205] The primers and templates for PCR used in the following Examples are shown in Tables 1 to 7 and Tables A1 to J.

[0206] [Table 1]

[0207] Table 1 Primers for plasmid 1 preparation

[0208]

[0209] [Table 2]

[0210] Table 2 Primers for making plasmid 2

[0211]

[0212] [Table 3]

[0213] Table 3 Primers for plasmid 3 preparation

[0214]

[0215] [Table 4]

[0216] Table 4 Primers used to calculate the inversion rate of mKate2 sequence

[0217]

[0218] [Table 5]

[0219] Table 5 Primers for amplicon production (common to plasmids 1 and 2)

[0220] Primers Sequence (5′-3′) Serial Number Positive GGCCAGCTTGGCACTTGATG 25 Reverse GGACGTGAAGAATGTGCGAG 26

[0221] [Table 6]

[0222] Table 6 Primers for making amplicons of each shRNA

[0223]

[0224] [Table 7]

[0225] Table 7 Primers used to calculate the inversion rate of mKate2 sequence

[0226]

[0227] [Table A1]

[0228] Table A1 Primers for making linear DNA 1

[0229] Serial Number Primers Sequence (5′-3′) 30 Positive GTTAAGCCAGCCCCGACACTGTTCACGTAGAGGAGGTTATCC 31 Reverse CTATGCGGCATCAGAGCAGGTACCGTTATATGCCGGCGG

[0230] [Table A2]

[0231] Table A2 Primers for making linear DNA 2A

[0232] Serial Number Primers Sequence (5′-3′) 30 Positive GTTAAGCCAGCCCCGACACTGTTCACGTAGAGGAGGTTATCC 32 Reverse CGGTGTTTCGTCCTTTCCACAAGATATATAAAGCC 33 Positive tagtacagtagtaatagtatatgtgatggaTC 31 Reverse CTATGCGGCATCAGAGCAGGTACCGTTATATGCCGGCGG

[0233] [Table B]

[0234] Table B Linear DNA 2A / Linear DNA 3B with shRNA (the lower line indicates the same region of the target sequence)

[0235]

[0236] [Table C1]

[0237] Table C1 Primers for linear DNA 3A production

[0238] Serial Number Primers Sequence (5′-3′) 45 Positive TGTTCACGTAGAGGAGGTTATCC 46 Reverse GTACCGTTATATGCCGGCGG

[0239] [Table C2]

[0240] Table C2 Primers for linear DNA3B production

[0241] Serial Number Primers Sequence (5′-3′) 45 Positive TGTTCACGTAGAGGAGGTTATCC 47 Reverse CCGGTGTTTCGTCCTTTCCACAAG 48 Positive TAGTACAGTAGTAATAGTATATGGTGATGGATC 46 Reverse GTACCGTTATATGCCGGCGG

[0242] [Table D]

[0243] Table D Primers for analysis of genes related to the Wnt pathway

[0244]

[0245] [Table E]

[0246] Table E Primers for inter-Lox sequence analysis

[0247]

[0248] [Table F]

[0249] Table F Primers for amplification of inter-Lox sequences

[0250] Serial Number Primers Sequence (5′-3′) 25 Positive GGCCAGCTTGGCACTTGATG 59 Reverse AAAGCCATACGGGAAGCAATAG

[0251] [Table G]

[0252] Table G Primers for amplification of inter-Lox sequence-shRNA coding sequence

[0253] Serial Number Primers Sequence (5′-3′) 60 Positive AATAGGGCCGGTGGAAAGGACGAAACACCG 61 Reverse TGACTCGTCGCCAGTTCTACATTCGCTCTC 62 Positive CAACGGCTACGTGGAAAGGACGAAACACCG 63 Reverse CTCCATGTTGCCAGTTCCTACATTCGCTCTC 64 Positive CAGCGAATGCGTGGAAAGGACGAAACACCG 65 Reverse CTACAAGGATCCAGTTCCTACATTCGCTCTC

[0254] [Table H1]

[0255] Table H1 Primers for linear DNA4 production

[0256] Serial Number Primers Sequence (5′-3′) 45 Positive TGTTCACGTAGAGGAGGTTATCC 66 Reverse AGATCCATCACATATACTATTACTACTGTAC 45 Positive TGTTCACGTAGAGGAGGTTATCC 47 Reverse CCGGTGTTTCGTCCTTTCCACAAG 67 Positive TGCGACTGACGGTTGCAACG 46 Reverse GTACCGTTATATGCCGGCGG

[0257] [Table H2]

[0258] Table H2 Primers for linear DNA4 amplification

[0259] Serial Number Primers Sequence (5′-3′) 45 Positive TGTTCACGTAGAGGAGGTTATCC 46 Reverse GTACCGTTATATGCCGGCGG

[0260] [Table I]

[0261] Table 1 Primers for making plasmid 7

[0262]

[0263] [Table J]

[0264] Table J Primers for amplification of minP variant sequences-mKate2 sequences

[0265] Serial Number Primers Sequence (5′-3′) 69 Positive GGATATCAAGATCTGGCCTCG 26 Reverse GGACGTGAAGAATGTGCGAG

[0266] Example 1 Preparation of carrier

[0267] 1) Preparation of Plasmid 1

[0268] PCR was performed using the template and primer combinations shown in Table 1. TM SuperFiIIPCRMaster Mix (ThermoFisher). Perform agarose gel electrophoresis on the PCR product. When a single band is detected in the electrophoresis, send it to Wizard TM The PCR reaction solution was directly added to the column of SV Gel and PCR Clean-Up System (Promega), and the PCR fragment was purified according to the manufacturer's recommended protocol. When non-specific sequences were detected during electrophoresis, the gel containing the target fragment was cut out and added to the Wizard TM The PCR fragments were purified using the SV Gel and PCR Clean-Up System (Promega). The purified fragments were assembled using the Cell-Free Cloning System (OriCiro) according to the manufacturer's protocol and amplified in vitro. The resulting reaction solution was directly added to the Wizard TM The plasmid vector (plasmid 1) was purified in a column of SV Geland PCRClean-Up System (Promega) according to the manufacturer's recommended protocol. The obtained plasmid was cut with XbaI (New England Biolabs) and the molecular weight was confirmed by agarose gel electrophoresis. This plasmid has a sequence (sh Scramble) encoding a Scramble shRNA without a target in the region of the functional molecule, has p53RE as a transcriptional regulatory sequence, and has a CRE-loxP-like sequence as a reporter gene system downstream of the transcriptional regulatory sequence. The CRE-loxP-like sequence has a CRE gene sequence and two Lox2722-LoxP sequences configured in opposite directions to each other, and a red fluorescent protein mKate2 coding sequence (mKate2 sequence) configured therebetween ( Figure 1A ). The mKate2 sequence is configured in the opposite direction of transcription in the original state and is not expressed. When the transcriptional regulatory sequence is activated, the mKate2 sequence can be inverted through the action of CRE and transcribed under the action of the upstream EF1 promoter ( Figure 1C ). Cells expressing mKate2 are labeled with red fluorescence, indicating that the functional molecule generates an intracellular response that activates p53RE. This plasmid has GFP linked to a promoter that is constantly expressed, and transformants having this plasmid are labeled with green fluorescence.

[0269] 2) Preparation of Plasmid 2

[0270] PCR was performed using the template and primer combination shown in Table 2. In addition, the same procedure as for plasmid 1 was followed to prepare a plasmid vector (plasmid 2) and confirm the molecular weight. This plasmid has a sequence encoding shRNA targeting RAD51 in the functional molecule region (shRAD51), and as described above, has a CRE-loxP-like sequence containing p53RE and mKate2 sequences as transcriptional regulatory sequences and a reporter gene system ( Figure 1A ). The shRAD51 in the plasmid is any one of the four types (shRAD51_1 to shRAD51_4) shown in Table 2. The four plasmids having the respective shRAD51 sequences were combined and used as plasmid 2. The mKate2 sequence in plasmid 2 is inverted and expressed by activation of the transcriptional regulatory sequence in the same manner as in plasmid 1 ( Figure 1C ), whereby the cells are labeled with red fluorescence. This plasmid has GFP linked to a promoter for constant expression, and transformants having this plasmid are labeled with green fluorescence.

[0271] 3) Preparation of Plasmid 3

[0272] PCR was performed using the template and primer combination shown in Table 3. In addition, the plasmid vector (plasmid 3) was prepared according to the same steps as plasmid 1, and the molecular weight was confirmed. This plasmid has shScramble in the functional molecule region, an antioxidant response sequence (ARE) as a transcriptional regulatory sequence, and a CRE-loxP-like sequence as a reporter gene system downstream of the transcriptional regulatory sequence. The CRE-loxP-like sequence has a CRE gene sequence and two Lox2722-LoxP sequences arranged in opposite directions to each other, and an mKate2 coding sequence arranged therebetween ( Figure 1B ). The mKate2 sequence in plasmid 3 is inverted and expressed by activation of the transcriptional regulatory sequence in the same manner as plasmid 1 ( Figure 1C ), whereby the cells are labeled with red fluorescence. This plasmid has GFP linked to a promoter for constant expression, and transformants having this plasmid are labeled with green fluorescence.

[0273] 4) Preparation of Plasmid 4

[0274] Produced by GenScript Japan Co., Ltd. Figure 1DThis plasmid vector has a structure of . This plasmid has shScramble in the region of the functional molecule, a TCF / LEF DNA binding protein binding sequence as a transcriptional regulatory sequence, and a CRE-loxP-like sequence as a reporter gene system downstream of the transcriptional regulatory sequence. The CRE-loxP-like sequence has a CRE gene sequence and a Lox71 sequence and a Lox66 sequence that are arranged in opposite directions to each other (Lee et al., Gene, 1998, 216(1): 55-65). The spacer sequence between the Lox sequences uses the m2 variant (Parrish et al., BioMed Research International, 2011, doi.org / 10.1155 / 2011 / 924068). In addition, this plasmid has a Rox sequence arranged in the same direction as a part of the CRE-loxP-like sequence. The Rox sequence is generally known as the target sequence of the Dre recombinase, but it is reported that it also has cross-reactivity with the Cre recombinase (Nat. Methods, 11(2014), pp.763-772). The marker sequence sandwiched by the Lox sequence in plasmid 4 is inverted under the activity of CRE induced by the activation of the transcriptional regulatory sequence. The transcriptional regulatory sequence is a TCF / LEF DNA binding protein binding sequence, which is activated by binding to TCF / LEF, and the activity of TCF / LEF is increased by the activation of the Wnt / β-Catenin signaling pathway. The inversion of this marker sequence is used to reflect the activation of the Wnt / β-Catenin signaling pathway in the cells into which the plasmid has been introduced.

[0275] 5) Preparation of viral vector

[0276] Lentiviral vectors 1A, 1B, and 1C are prepared. Lentiviral vector 1A has the same shRNA (shScramble) as plasmid 1 and a loxP-like sequence as a reporter gene system. Lentiviral vector 1B has the same shRNA (shRAD51) as plasmid 2 and a loxP-like sequence as a reporter gene system. The loxP-like sequences of these vectors contain two Lox2722-LoxP sequences arranged inversely to each other and a red fluorescent protein mKate2 coding sequence arranged inverted therebetween. Lentiviral vector 1C has a p53RE transcriptional regulatory sequence and a CRE gene sequence. A vector set is constructed by combining lentiviral vector 1A or 1B with lentiviral vector 1C. This vector set functions in the following manner: when a DNA damage response is induced in a cell by the shRNA of vector 1A or 1B, the p53RE of vector 1C is activated to express CRE in response to the DNA damage response, thereby causing a change in the loxP-like sequence of vector 1A or 1B (inversion of the mKate2 sequence). Viral vectors 1A, 1B, and 1C were produced by Vector Builder Japan Co., Ltd. through plasmid synthesis and lentiviral packaging.

[0277] 6) Preparation of linear DNA 1

[0278] Using the above plasmid 4 as a template, PCR was performed using the primers shown in Table A1, and the resulting fragment was PCR amplified using Wizard TM The DNA fragment was purified by SV Gel and PCR Clean-Up System (Promega). The obtained DNA fragment was referred to as linear DNA 1. Linear DNA 1 has a region containing the functional molecule of shScramble similar to plasmid 4, a transcriptional regulatory sequence, a reporter gene system, and a sequence for making these sequences function in cells ( Figure 1E ).

[0279] 7) Preparation of linear DNA2

[0280] Based on the above linear DNA 1, linear DNAs containing sequences encoding various shRNAs were prepared, and these were collected and used as linear DNA 2. As shRNA, shRNAs targeting genes involved in the Wnt pathway were selected. The specific sequence preparation was carried out in the following order. PCR was performed using the above plasmid 4 as a template and the primers shown in Table A2, and the obtained PCR products were used by Wizard TMSV Gel and PCR Clean-Up System (Promega) was used for purification to produce a DNA fragment in which the region containing the shRNA was deleted from the linear DNA 1. A pool of single-stranded oligonucleotide DNA fragments containing sequences encoding shRNAs targeting genes involved in the Wnt pathway (USP7, DHX29 or SETDB1) (Table B) was commissioned to Integrated DNA Technologies Co., Ltd. for production. The above-mentioned genes involved in the Wnt pathway are genes that activate the Wnt pathway by knocking out (Evron et al., Oncogenesis, 2021, 10(9): 63). These DNA fragments are designed to overlap with each other. These DNA fragments are mixed as templates, and the fragments are combined by PCR. After the obtained PCR product is subjected to electrophoresis in a 1% agarose gel, the band of the fragment is cut out and analyzed using Wizard TM The purified linear DNA 2A was obtained by purification using SV Gel and PCR Clean-Up System (Promega). The solution of the purified linear DNA 2A was mixed with the solution of the linear DNA 1 to obtain linear DNA 2. Linear DNA 2 has a functional molecular region including a sequence encoding shRNA targeting the Wnt pathway or shScramble, a transcriptional regulatory sequence and a reporter gene system similar to plasmid 4, and a sequence for making these sequences function in cells, and the functional molecular region is a collection of heterologous DNA fragments.

[0281] 8) Preparation of linear DNA3

[0282] The DNA encoding sesRNA is integrated into the transcription control region of linear DNA 2 to produce linear DNA 3. sesRNA is a module that expresses downstream reporter genes through the activity of any mRNA molecule and ADAR protein in the cell (Nature, 2022, 610: 713-721, Nature Biotechnology, 2023, 41: 698-707, Nature Biotechnology, 2023, 41: 482-487, WO / 2023 / 077135, WO / 2023 / 077138, US20230123513). A DNA encoding a sesRNA that senses the mRNA of the AXIN2 gene is designed. AXIN2 is expressed more by activation of the Wnt pathway, so this sesRNA increases the expression of downstream genes due to the activation of the Wnt pathway in the cell.

[0283] Plasmid 5 was prepared by replacing the transcription control region of plasmid 4 with the DNA encoding the sesRNA ( Figure 1F). Plasmid 5 was prepared by GenScript Japan Co., Ltd. Plasmid 5 was linearized by PCR with primers in Table C1 to obtain linear DNA 3A. Next, PCR was performed using primers in Table C2 with plasmid 5 as a template, and the obtained PCR product was purified by Wizard TM Purification was performed using SV Gel and PCR Clean-Up System (Promega) to produce a DNA fragment in which the region containing shRNA was deleted from linear DNA 3A. A pool of single-stranded DNA fragments containing sequences encoding shRNA (Table B) targeting genes involved in the Wnt pathway was commissioned to Integrated DNA Technologies, Inc. These DNA fragments were designed to overlap with each other. These DNA fragments were combined using NEBuilder (New England Biolabs Japan Co., Ltd.). PCR was performed using the combined fragments as a template, and the PCR product was cloned using Wizard. TM Purification was performed using SV Gel and PCRClean-Up System (Promega) to obtain linear DNA 3B. The solution of linear DNA 3A was mixed with the solution of linear DNA 3B to obtain linear DNA 3. Linear DNA 3 has a functional molecular region including a sequence encoding shRNA targeting the Wnt pathway or shScramble, a sequence encoding the same sesRNA translation regulatory sequence and reporter gene system as plasmid 5, and a sequence for making these sequences function in cells, and the functional molecular region is a collection of heterologous DNA fragments.

[0284] Example 2 Plasmid Response to DNA Damage Response

[0285] In order to verify the detection ability of the DNA damage response brought by the plasmid prepared in Example 1, the response of plasmid 1 to artificially induced DNA damage response was investigated. HEK293 cells were seeded in a 96-well plate at a density of 15,000 cells / well and cultured in EMEM (supplemented with NEAA) medium for 1 day. 100 ng / well of plasmid 1 was introduced into the cells using Lipofectamine 3000 kit (ThermoFisher). The amount of P3000 reagent and Lipofectamine 3000 reagent used for introduction was 0.2 μL / well. 40.5 hours after transfection, doxorubicin (Sigma-Aldrich) with a DNA damaging effect was added at a final concentration of 10 μM, 5 μM, 1 μM or 0 μM (DMSO). Before the addition of doxorubicin and 8 hours, 24 hours and 33 hours after the addition, the cells were observed using a fluorescence microscope BZ-X710 (KEYENCE) with a 4x objective lens (BZ-PF04P, KEYENCE). Green fluorescence based on EGFP was detected with a filter set of excitation wavelength 470±20nm and fluorescence wavelength 525±25nm, and red fluorescence based on mKate2 was detected with a filter set of excitation wavelength 545±12.5nm and fluorescence wavelength 605±35nm. The positive or negative determination of fluorescence was performed using the hybrid cell counting function installed in the BZ-x Analyzer software manufactured by KEYENCE. As a result of the analysis, the value of the number of red fluorescence positive cells / the number of green fluorescence positive cells increased depending on the treatment time and concentration of doxorubicin ( Figure 2 ), suggesting that the mKate2 sequence was inverted by activating p53RE and CRE in the plasmid through the induction of DNA damage response by doxorubicin. Based on this result, it was shown that the plasmid of Example 1 can detect the DNA damage response of cells.

[0286] To confirm the inversion of the mKate2 sequence, cells were isolated from the culture 33 hours after doxorubicin treatment, and the cells were extracted with phenol-chloroform and ethanol precipitated to obtain a DNA solution. TM Premix Ex Taq TM II (Takara), qPCR analysis was performed using the SYBR Green method to quantify the inverted sequence. As a result, the inversion rate (RQ) of the mKate2 sequence increased by doxorubicin treatment ( Figure 3 ), which is the result corresponding to the above-mentioned fluorescence analysis.

[0287] Example 3 Enhancement of DNA damage response by plasmid-encoded shRNA

[0288] The enhancement effect of the DNA damage response caused by the shRNA encoded by the plasmid prepared in Example 1 and the detection ability of the plasmid for this effect were investigated. As plasmids, plasmid 1 having Scramble shRNA and plasmid 2 having shRAD51 were used. Both plasmids 1 and 2 were equipped with p53RE, and CRE recombinase was expressed due to DNA damage response. RAD51, which was inhibited by the shRNA contained in plasmid 2, is a protein related to DNA repair, and the DNA damage response is enhanced by inhibiting its expression (Journal of medicinal chemistry, 2012, 55(7): 3011-3020; Oncology Reports, 2019, 42(6): 2426-2434).

[0289] HEK293 cells were seeded in a 96-well plate at a density of 25,000 cells / well and cultured in EMEM (supplemented with NEAA) medium for 1 day. 100 ng / well of plasmid 1 and plasmid 2 were introduced into cells in different wells using Lipofectamine 3000 kit (ThermoFisher). The amount of P3000 reagent and Lipofectamine 3000 reagent used for introduction was 0.2 μL / well. 36 hours after transfection, doxorubicin (Sigma-Aldrich), which has a DNA damaging effect, was added at a final concentration of 5 μM or 0 μM (DMSO). Before the addition of doxorubicin and 26 hours and 74 hours after the addition, the cells were observed in the same order as in Example 2, and the fluorescence-positive or -negative cells were counted. The results of the analysis showed that 74 hours after the addition of doxorubicin, the proportion of red fluorescence-positive cells in the wells containing cells introduced with shRAD51 (plasmid 2) increased compared with the wells containing cells introduced with shScramble (plasmid 1) ( Figure 4 ). According to this result, it was shown that the DNA damage response caused by doxorubicin was enhanced by shRAD51 encoded by the plasmid, and the enhancement of the DNA damage response was detected by the plasmid.

[0290] Example 4 Detection of Antioxidant Stress Response

[0291] Plasmid 3 having ARE responsive to oxidative stress as a transcriptional regulatory sequence activated by intracellular response prepared in Example 1 was used to investigate the response of the plasmid to artificially induced intracellular oxidative stress. HEK293 cells were seeded in a 96-well plate at a density of 25,000 cells / well and cultured in EMEM (NEAA added) medium for 1 day. Using Lipofectamine 3000 kit (ThermoFisher), 100 ng / well of plasmid 3 was introduced into the cells. The amounts of P3000 reagent and Lipofectamine 3000 reagent used in the introduction were both 0.2 μL / well. 66 hours after transfection, tert-butylhydroquinone (TBHQ, Tokyo Chemical Industry) was added at final concentrations of 100 μM, 50 μM and 0 μM (DMSO) to induce oxidative stress. The cells were observed in the same order as in Example 2 26 hours, 75 hours and 99 hours after TBHQ addition. The determination of fluorescence positive or negative cells was performed using CellProfiler (Broad Institute [URL: cellprofiler.org / interfaces]). As a result of the analysis, the ratio of red fluorescence positive cells increased depending on the treatment time and concentration of TBHQ ( Figure 5 ), suggesting that the mKate2 sequence was inverted by ARE activation in the plasmid due to TBHQ-based oxidative stress. This indicates that plasmid 3 can detect cellular oxidative stress.

[0292] Example 5 Detection of Wnt signaling pathway activation

[0293] Using plasmid 4 and linear DNA 1 prepared in Example 1, which have a TCF / LEF DNA binding protein binding sequence that responds to the activation of the Wnt pathway as a transcriptional regulatory sequence, the response of the vector to the activation of the Wnt pathway in the cell was investigated. HEK293 cells were seeded in a 96-well plate at a density of 15,000 cells / well and cultured in EMEM (supplemented with NEAA) medium for 1 day. 25 ng / well of plasmid 4 and linear DNA 1 were introduced into the cells respectively using Lipofectamine 3000 kit (ThermoFisher). The amounts of P3000 reagent and Lipofectamine 3000 reagent used in the introduction were both 0.2 μL / well. Three days after transfection, CHIR99021 (Cayman Chemical) as a GSK3β inhibitor was added at final concentrations of 16 μM, 8 μM, 4 μM, 2 μM and 0 μM (DMSO) to activate the Wnt pathway.

[0294] Confirm activation of the Wnt pathway in cells treated with the drug. Six and 24 hours after drug treatment, the cells were treated with SuperPrep TM Cell Lysis & RT Kit for qPCR (Toyobo Co., Ltd.) was used to extract RNA from cells and synthesize cDNA. RT-qPCR was used to quantify the mRNA expression of AXIN2 and SP5, which are known downstream genes of the Wnt pathway. This analysis used TB Green TM Premix Ex Taq TM II (Takara), implemented using the SYBR Green method. GAPDH was used as the internal standard gene. The primers used in the analysis are shown in Table D. As a result of the analysis, when CHIR99021 was added at a final concentration of 16 μM and 8 μM at two time points after drug treatment, the mRNA expression levels of AXIN2 and SP5, which are known downstream genes of the Wnt pathway, increased, confirming that the Wnt pathway was activated in cells by the addition of the drug ( Figure 6 ).

[0295] Next, the response of the vector to activation of the Wnt pathway was investigated. After 24 hours of drug treatment, cells were isolated from the culture and a DNA solution was obtained from the cells using the Template Prepper for DNA (Japan Gene) kit according to the manual. The obtained DNA solution was used as a template and TB Green TM Premix Ex Taq TM II (Takara) quantified the inversion of the marker sequence (m2 variant) by qPCR analysis using the SYBRGreen method. The primers used in the analysis are shown in Table E. The quantitative values ​​of the backbone sequence were used for standardization. As a result of the analysis, an increase in the inversion sequence dependent on the CHIR99021 concentration was detected in both the plasmid 4 introduction group and the linear DNA 1 introduction group ( Figure 7 ). This indicates that the vector of the present invention can detect Wnt pathway activation in cells. In addition, the results of Examples 2 to 5 indicate that various intracellular responses can be detected by changing the type of transcriptional regulatory sequence in the plasmid.

[0296] Example 6 Detection of intracellular response based on viral vector and analysis of shRNA function

[0297] For the viral vector group prepared in Example 1, the ability to induce intracellular responses caused by shRNA and the ability to detect the intracellular responses were investigated. HEK293 cells were seeded in a 96-well plate at a density of 15,000 cells / well and cultured with EMEM (supplemented with NEAA) medium for 1 day. Viral vector 1A or 1B was introduced into each culture well at a multiplicity of infection (MOI) of 0.4 or 2, and viral vector 1C was introduced at an MOI of 10. 72 hours and 144 hours after transduction, the cells were separated from the culture, and a DNA solution was obtained from the cells using the Template Prepper for DNA (Japan Gene) kit according to the manual. The region containing mKate2 between the Lox sequences in the vector was amplified by PCR using the primers in Table F using the obtained DNA solution as a template. TB Green TM Premix Ex Taq TM II (Takara) was used to quantify the inversion of the mKate2 region in the PCR product by qPCR analysis using the SYBR Green method. The primers listed in Table 4 were used for quantification, and the ratio of the inverted mKate2 region to the non-inverted mKate2 region was calculated. As a result, the inversion of the mKate2 sequence in the vector containing shRAD51 increased ( Figure 8 ). According to the results, it was shown that shRAD51 carried by the viral vector inhibited the expression of RAD51 and induced the DNA damage response in the cell, and the intracellular response was detected by the reporter gene system of the vector group. In addition, according to the results of Examples 2 to 6, it was shown that the intracellular response generated by shRNA can be detected using various vectors.

[0298] Example 7 Comprehensive detection of the enhancement effect of DNA damage response caused by various shRNAs contained in the plasmid pool

[0299] It was verified that even when different plasmids were introduced into cells, reporter gene signals dependent on the shRNA encoded by each plasmid could be detected separately. Plasmid 1 containing scramble shRNA and plasmid 2 containing a pool of four plasmids having different shRAD51 sequences were used as plasmids.

[0300] Prepare a plasmid mixture containing plasmid 1 and plasmid 2 in an equimolar ratio. Seed HEK293 cells at a density of 25,000 cells / well in a 96-well plate and culture with EMEM (supplemented with NEAA) medium for 1 day. Use Lipofectamine 3000 kit (ThermoFisher) to introduce the above plasmid mixture containing a total of 25 ng / well of plasmid 1 and 2 into the cells. The amount of P3000reagent and Lipofectamine 3000reagent used in the introduction was 0.2 μL / well. Add doxorubicin (Sigma-Aldrich) with a DNA damaging effect at a final concentration of 1 μM and 0 μM (DMSO) 72 hours after transfection.

[0301] After 96.5 hours of doxorubicin treatment, cells were isolated from the culture and a DNA solution was obtained from the cells using a Template Prepper for DNA (Japan Gene) kit according to the manual. Next, from the DNA solution, a fragment containing the shRNA region and the mKate2 coding sequence was amplified by PCR using the primers in Table 5. Next, an amplicon containing the mKate2 sequence was prepared for each shRNA region by PCR using the primers in Table 6. Fig. 9 ). Use the primers in Table 7 and TB Green TM Premix Ex Taq TM II (Takara) quantified the inversion rate of mKate2 sequences contained in amplicons containing shScramble, shRAD51_2, and shRAD51_4 by qPCR analysis using the SYBR Green method. The results of the analysis showed that in cells treated with doxorubicin, the inversion rate of mKate2 sequences in amplicons containing shRAD51_2 and shRAD51_4 increased compared to that in amplicons containing shScramble ( Fig.10 ).

[0302] In order to confirm the results by an analysis method different from qPCR, the above-mentioned fragments containing the shRNA region and the mKate2 sequence were analyzed using massively parallel sequencing. The above-mentioned amplicon was attached with a linker using a ligation sequencing kit (Ligation Sequencing Kit, Nanopore, SQK-LSK109), and a library for Nanopore analysis was prepared, and then sequencing was performed using a Flongle Flow Cell (Nanopore). Next, reference sequence data covering the combination of mKate2 sequences and shRNA sequences that can be produced in principle were prepared, and the reads were mapped using BWA-MEM (arXiv: 1303.3997 [q-bio.GN], 2013). Based on the results obtained, the inverted and non-inverted mKate2 sequences were counted for each shRNA, and the probability of inversion of the mKate2 sequence of each shRNA was calculated. Next, the relative probability of each shRNA when the probability of shScramble was set to 1 was calculated. The results of the analysis showed that the inversion rate of the mKate2 sequence present in the same read segment as shRAD51 was high (Table 8). These results indicate that even if multiple plasmids containing different shRNAs are introduced into cells, the effects of the intracellular responses caused by each shRNA can be detected at once.

[0303] [Table 8]

[0304] Table 8 Analysis results of mKate2 sequences present in the same read segment as each shRNA

[0305]

[0306] Example 8 Exploration of shRNAs that induce intracellular responses using vector pools

[0307] Verify that the vector of the present invention can explore and determine the shRNA that activates the Wnt pathway. As a vector, the linear DNA 2 prepared in Example 1 was used. Linear DNA 2 is a collection of DNA fragments containing linear DNAs that inhibit genes related to the Wnt pathway (SETDB1, DHX29 or USP7, which activate the Wnt pathway through their inhibition) and linear DNAs with shScramble. HEK293 cells were seeded in 96-well plates at a density of 15,000 cells / well and cultured in EMEM (NEAA added) medium for 1 day. Using Lipofectamine 3000kit (ThermoFisher), a total of 25 ng / well of linear DNA 2 was introduced into the cells. The amounts of P3000 reagent and Lipofectamine 3000 reagent used in the introduction were both 0.2 μL / well.

[0308] 72 hours after liposome transfection, cells were isolated from the culture, and a DNA solution was obtained from the cells using the Template Prepper for DNA (Japan Gene) kit according to the manual. Using the DNA solution as a template, PCR using the primers in Table G was performed to amplify the region containing the marker sequence (sequence between Lox) and the shRNA coding sequence. Since the index sequence was attached to the end of the primer used, the obtained amplicon was given an index corresponding to each culture well. A ligation sequencing kit (Ligation Sequencing Kit, Nanopore, SQK-LSK110) was used to attach adapters to the obtained amplicon to prepare a Nanopore analysis library, and sequencing was performed using a Flongle Flow Cell (Nanopore). The obtained reads were identified and deleted based on the index of Minibar (github.com / calacademy-research / minibar). Next, a series of reference sequence data covering the combinations of marker sequences and shRNA sequences that can be produced in principle were prepared, and the reads were mapped to the reference sequence using BWA-MEM. According to the obtained results, the presence or absence of inversion of the marker sequence was counted for each shRNA, and the probability of inversion of each shRNA was calculated. As a result of the analysis, the probability of inversion of the marker sequence present on the same read segment as the shRNA targeting the gene involved in the Wnt pathway was higher than that of the marker sequence present on the same read segment as the Scramble shRNA (Figure 11). According to these results, it is shown that the shRNA that activates the Wnt pathway can be determined by the vector of the present invention, and even if a plurality of vectors containing different shRNAs are collected and introduced into cells, the effect of the response in the cell caused by each shRNA can be detected at one time.

[0309] In addition, the effect of gene perturbation on the intracellular response was investigated by summing the scores of marker sequences present in the same molecule as the shRNA for each target gene. Fig.11A The data were summarized for each target gene and the average value was calculated ( Fig. 11B ). As a result, the average inversion rate of the vectors that inhibited each target gene (especially USP7 and SETDB1) increased compared with the control. This suggests that these target genes contribute to inhibiting the activation of the Wnt / β-Catenin signaling pathway in cells. In summary, by summarizing the analysis results of each gene that is a target of a functional molecule, genes related to the response in the cell can be evaluated and ranked.

[0310] Example 9: Exploration of shRNAs that induce intracellular responses using vector pools with different detection systems

[0311] The linear DNA3 produced in the verification example 1 can explore and determine the shRNA that activates the Wnt pathway. Linear DNA3, like linear DNA2, is a collection of linear DNA fragments containing shRNA that inhibits genes related to the Wnt pathway and linear DNA with shScramble. Linear DNA3 has a sequence encoding sesRNA as a translational regulatory region, and the activation of the Wnt pathway is detected by increasing the expression of downstream genes (CRE) by the sesRNA expressed by linear DNA3 along with the mRNA expression of AXIN2 located downstream of the Wnt pathway. HEK293 cells were seeded in 96-well plates at a density of 15,000 cells / well and cultured in EMEM (NEAA added) medium for 1 day. Using Lipofectamine 3000kit (ThermoFisher), a total of 5 ng / well of linear DNA3 was introduced into the cells. The amount of P3000 reagent and Lipofectamine 3000 reagent used in the introduction was 0.2 μL / well.

[0312] 72 hours after liposome transfection, cells were separated from the culture, and a DNA solution was obtained from the cells using the Template Prepperfor DNA (Japan Gene) kit according to the manual. Using the DNA solution as a template, PCR was performed using the primers in Table G to amplify the region containing the marker sequence (sequence between Lox) and the shRNA sequence. Since the index sequence was attached to the end of the primer used, the obtained amplicon was attached with an index corresponding to the experimental conditions. A ligation sequencing kit (Ligation Sequencing Kit, Nanopore, SQK-LSK110) was used to attach adapters to the obtained amplicon, and a library for Nanopore analysis was prepared, which was sequenced using the Flongle Flow Cell (Nanopore). The obtained reads were identified and deleted based on the Minibar index. Next, a series of reference sequence data covering the combinations of marker sequences and shRNA sequences that can be produced in principle was prepared, and the reads were mapped to the reference sequence using BWA-MEM. Based on the obtained results, the presence or absence of inversion of the marker sequence was counted for each shRNA, and the probability of inversion of the region sandwiched by the Lox sequence and the probability of deletion of the sequence sandwiched by the Rox sequence of each shRNA were calculated. The results of the analysis showed that the marker sequence present in the same read segment as the shRNA targeting genes involved in the Wnt pathway (DHX29_1 to DHX29_4) had a higher probability of inversion and deletion than the marker sequence present in the same read segment as the Scramble shRNA ( Fig.12 ). According to these results, it is shown that the vector pool used in this example can be used to explore shRNA sequences that can activate the Wnt pathway in cells or genes related to the Wnt pathway. In addition, according to Examples 7 to 8, it is shown that the vector pool of the present invention can use a variety of transcriptional regulatory sequences and reporter gene systems to detect the effects of the intracellular response caused by shRNA.

[0313] Example 10: Improving detection capabilities by importing UMI sequences

[0314] 1) Preparation of linear DNA4

[0315] The reporter gene system contained in the vector is identified by a barcode (Unique Molecular Identifier; UMI) sequence. A linear DNA 4 ( Fig.13 ). As UMI sequences, FASMAC Co., Ltd. was commissioned to prepare a pool of random single-stranded oligo DNAs.

[0316] Integrated DNA Technologies, Inc. was commissioned to prepare a pool of single-stranded DNA fragments containing sequences encoding shRNAs (Table B) targeting genes involved in the Wnt pathway. PCR was performed using the primers shown in Table H1 using the above plasmid 4 as a template, and the resulting PCR products were purified using Wizard TM SV Gel and PCR Clean-Up System (Promega) was used to purify and generate DNA fragments. These DNA fragments were designed to overlap with each other. These DNA fragments and the DNA fragment containing the UMI were separated into Fig.14A The combination shown in Table H2 and B was mixed and combined using NEBuilder (New England Biolabs Japan Co., Ltd.) to obtain linear DNA 4A containing shScramble and linear DNA 4B containing shRNA targeting Wnt-related genes. PCR was performed using the primers in Table H2 with linear DNA 4A and 4B as templates, and the PCR products were cloned using Wizard TM Purification was performed using SV Gel and PCR Clean-Up System (Promega). Linear DNA 4 was obtained by mixing the solution of linear DNA 4A and the solution of linear DNA 4B. Linear DNA 4 has a functional molecular region including a sequence encoding shRNA targeting the Wnt pathway or shScramble, a transcriptional regulatory sequence and a reporter gene system similar to plasmid 4, and a sequence for making these sequences function in cells. The functional molecular region is a collection of heterologous DNA fragments. Each DNA fragment in linear DNA 4 contains a UMI sequence that identifies each fragment.

[0317] 2) Preparation of Plasmid 6

[0318] like Fig.15 The hyPBase (hyperactive piggyback transposase) expression plasmid was designed as shown and produced by Vector Builder Japan Co., Ltd. The obtained plasmid was designated as Plasmid 6.

[0319] 3) Verification of the effect of UMI sequence

[0320] HEK293 cells were seeded in 96-well plates at a density of 15,000 cells / well and cultured in EMEM (supplemented with NEAA) medium for 1 day. A total of 5 ng / well of linear DNA 4 and 95 ng / well of plasmid 6 were simultaneously introduced into the cells using Lipofectamine 3000 kit (ThermoFisher). The linear DNA straight chain 4 has an ITR sequence ( Fig.13 ), which is integrated into the genome through the activity of hyPBase expressed by plasmid 6. Linear DNA 4 is a DNA fragment that combines linear DNAs of shRNA and Scramble shRNA that inhibit genes related to Wnt. The amount of P3000 reagent and Lipofectamine 3000 reagent used in the introduction was 0.2 μL / well.

[0321] 72 hours after liposome transfection, cells were isolated from the culture, and a DNA solution was obtained from the cells using the Template Prepper for DNA (Japan Gene) kit according to the manual. Using the DNA solution as a template, the primers in Table G were used to amplify the region containing the marker sequence (inter-Lox sequence), UMI, and shRNA sequence. Since the index sequence was attached to the end of the primer used, the obtained amplicon was attached with an index corresponding to the experimental conditions. A ligation sequencing kit (Ligation Sequencing Kit, Nanopore, SQK-LSK110) was used to attach adapters to the obtained amplicon, and a library for Nanopore analysis was prepared, which was sequenced using a Flongle Flow Cell (Nanopore). The obtained reads were identified and deleted based on the Minibar index. Next, a series of reference sequence data covering the combinations of marker sequences and shRNA sequences that can be produced in principle was prepared, and the reads were mapped to the reference sequence using BWA-MEM. In addition, the UMI region is determined based on the information of the SAM file and read segment obtained by mapping, and the UMI sequence is clustered by CD-HIT to determine whether the obtained UMI is unique. The analysis is divided into the case where the UMI sequence is not used for filtering and the case where only the read segments with unique UMI sequences are used for analysis. The presence or absence of inversion of the marker sequence is counted for each read segment, and the inversion probability of each shRNA (shScramble, DHX29_1~DHX29_4) is calculated. The results of the analysis showed that the marker sequence existing on the same read segment as the shRNA targeting Wnt-related genes (DHX29_1~DHX29_4) has a higher inversion probability than the marker sequence existing on the same read segment as the Scramble shRNA, and this trend is more obvious when only the read segments with unique UMIs are analyzed ( Fig.16 ). Based on these results, it is believed that by introducing UMI into the reporter gene system, it is possible to avoid the deviation of sequence amplification during analysis and improve the detection ability of the target shRNA based on the vector of the present invention.

[0322] Example 11 Activity Evaluation of Transcription Regulatory Sequences

[0323] 1) Preparation of Plasmid 7

[0324] PCR was performed using the template and primer combination shown in Table I. Otherwise, a plasmid vector (plasmid 7) was prepared according to the same steps as plasmid 1, and the molecular weight was confirmed. The minP variant sequence prepared as a template is a pool of 94 minP variant sequences containing the original sequence. This plasmid has shScramble in the region of the functional molecule, p53RE as a transcriptional regulatory sequence, and a CRE-loxP-like sequence as a reporter gene system. The CRE-loxP-like sequence has a CRE gene sequence and two Lox2722-LoxP sequences arranged in opposite directions to each other, and an mKate2 sequence arranged therebetween. When the transcriptional regulatory sequence is activated, the mKate2 sequence is inverted under the action of CRE and transcribed and expressed (refer to Figure 1B ). Plasmid 7 has a minimal promoter (minP variant) sequence with various properties located between p53RE and CRE, and is a pool of vectors having a total of 94 types of minP variant sequences.

[0325] 2) Activity evaluation of transcriptional regulatory sequences

[0326] Plasmid 7 was used to evaluate the activity of transcriptional regulatory sequences for intracellular responses, and such an evaluation system was studied. HEK293 cells were seeded in a 96-well plate at a density of 25,000 cells / well and cultured in EMEM (supplemented with NEAA) medium for 1 day. A total of 25 ng / well of plasmid 7 was introduced into the cells using Lipofectamine 3000 kit (ThermoFisher). The amount of P3000reagent and Lipofectamine 3000reagent used in the introduction was 0.2 μL / well. Doxorubicin (Sigma-Aldrich), which has a DNA damaging effect, was added at a final concentration of 5 μM and 0 μM (DMSO) 4 days after transfection.

[0327] After 24 hours of doxorubicin treatment, cells were isolated from the culture, and a DNA solution was obtained from the cells using the Template Prepper for DNA (Japan Gene) kit according to the manual. Using the DNA solution as a template, the fragment containing the minP variant sequence and the mKate2 sequence was amplified by PCR using the primers in Table J. The linker was attached to the obtained amplicon using the Ligation Sequencing Kit (Nanopore, SQK-LSK110), and after preparing a library for Nanopore analysis, sequencing was performed using the Flongle Flow Cell (Nanopore). A series of reference sequence data covering the combination of mKate2 sequences and minP variant sequences that can be produced in principle was prepared, and the reads were mapped to the reference sequence using BWA-MEM. Based on the results obtained, the inverted and non-inverted mKate2 sequences were counted for each minP variant sequence, and the probability of inversion of the mKate2 sequence in each minP variant sequence was calculated. As a result of the analysis, a minP variant sequence ( Fig.17 ). These results indicate that a vector system can be constructed for evaluating the activity of vector components such as transcriptional regulatory sequences in response to intracellular responses.

Claims

1. A vector or vector group for analyzing the function of a functional molecule, The invention comprises: a polynucleotide encoding an expression system of a candidate molecule of a functional molecule, a polynucleotide encoding a transcriptional regulatory sequence or a translational regulatory sequence activated by a predetermined intracellular response, and a polynucleotide encoding a reporter gene system operably linked to the transcriptional regulatory sequence or the translational regulatory sequence.

2. The vector or vector set according to claim 1, wherein The functional molecule is RNA or peptide.

3. The vector or vector set according to claim 2, wherein: The RNA is shRNA or guide RNA.

4. The vector or vector set according to claim 1, wherein The transcriptional regulatory sequence or translational regulatory sequence activated by a given intracellular response is a p53 binding sequence, an antioxidant response sequence, a nuclear factor κB binding sequence, a transcription activator factor 6 response sequence, a metal regulatory element, a heat shock element, a hypoxia response element, an exogenous substance response element, an activated T cell nuclear factor binding sequence, a TCF / LEF type DNA binding protein binding sequence, a sesRNA, and a toehold RNA.

5. The vector or vector set according to claim 4, wherein: The transcriptional regulatory sequence activates a promoter disposed downstream thereof.

6. The vector or vector set according to claim 5, wherein: The reporter gene system comprises the promoter.

7. The vector or vector set according to claim 1, wherein: The reporter gene system is expressed following activation of the transcriptional regulatory sequence or translational regulatory sequence.

8. The vector or vector set according to claim 1, wherein: The reporter gene system is a luminescent or fluorescent protein reporter gene system, or an enzyme reporter gene system.

9. The vector or vector set according to claim 8, wherein: The enzyme reporter gene system comprises a combination of a protein having the function of changing a target nucleotide sequence and its target sequence.

10. The vector or vector set according to claim 8, wherein The enzyme reporter gene system expresses DNA nuclease, DNA recombinase, transposase, or integrase.

11. The vector or vector set according to claim 8, wherein: The enzyme reporter gene system comprises a combination of an artificial nuclease and its recognition sequence, and a combination of a restriction enzyme and its corresponding restriction enzyme recognition sequence.

12. The vector or vector set according to claim 8, wherein: The enzyme reporter gene system includes: a combination of a Cas family, a guide RNA, and a Cas recognition sequence, a combination of a TALEN and its recognition sequence, a combination of a ZFN and its recognition sequence, or a combination of a base editor or a lead editor and its recognition sequence.

13. The vector or vector set according to claim 11, wherein The restriction enzyme is I-CeuI, I-SceI, PI-PspI or PI-SceI.

14. The vector or vector set according to claim 8, wherein: The enzyme reporter gene system includes: a CRE-LoxP system, a system having a LoxP variant sequence instead of a LoxP sequence or in addition to a LoxP sequence in the CRE-LoxP system, a Vika-Vox system, a Dre-rox system, or a Flp-FRT system.

15. The vector or vector set according to claim 1, wherein: The vector is a plasmid vector, a linear DNA sequence, a transposon vector, or a viral vector.

16. The vector or vector set according to claim 15, wherein: The viral vector is a lentiviral vector, an adeno-associated viral vector, a baculoviral vector, an MMLV retroviral vector, or an MSCV retroviral vector.

17. The vector or vector set according to claim 1, wherein: Further having an inherent molecular barcode sequence.

18. A method for exploring functional molecules that induce responses in cells, comprising the following steps: The vector or vector group according to any one of claims 1 to 17 is introduced into a cell, and The expression of the reporter gene system contained in the vector or vector set in the cell is determined.

19. The method according to claim 18, wherein: The expression of the reporter gene system is quantified by luminescence or fluorescence measurement, protein quantification, quantitative RT-PCR, quantitative PCR, or sequencing.

20. The method according to claim 18, wherein: The method comprises the steps of: adding two or more vectors or vector groups to a cell population and introducing each vector into any cell in the cell population; The two or more vectors or vector sets each contain a polynucleotide encoding a different functional molecule.

21. The method according to claim 18, wherein: The cells are cells collected from humans or non-human animals, cells collected from samples of patients or experimental animals, primary cultured cells, organoids, cell spheroids, immortalized cultured cells, or cells in vivo of individual experimental animals.

22. A method for exploring genes involved in a response in a cell, comprising the following steps: A plurality of vectors or vector groups are introduced into a cell population, wherein: The multiple vectors or vector groups each encode: an RNA interfering with a test subject gene, a transcriptional regulatory sequence or a translational regulatory sequence activated by a predetermined intracellular response, and a reporter gene system operably linked to the transcriptional regulatory sequence or the translational regulatory sequence, but the RNAs encoded by the multiple vectors or vector groups are different from each other; Determining the expression of the reporter gene system encoded by each of the plurality of vectors or vector groups in the cell population; and Whether the test subject gene is a gene involved in the predetermined intracellular response is determined based on the expression of the reporter gene system contained in each of the plurality of vectors or vector groups.

23. The method according to claim 22, wherein: Whether the test subject gene is a gene involved in the predetermined intracellular response is determined based on the statistical value of the expression of the reporter gene system contained in each of the plurality of vectors or vector groups.

24. The method according to claim 22, wherein: The RNA interfering with the gene of the subject is shRNA or gRNA.

25. A kit comprising the vector or vector set according to any one of claims 1 to 17. The kit according to claim 25 , which is a diagnostic drug or a companion diagnostic drug for a disease.

27. A method for diagnosing a disease, comprising the step of: carrying out the method for searching for functional molecules that induce a response in a cell according to any one of claims 18 to 21.

28. A companion diagnostic method, comprising the following step: implementing the method for searching for functional molecules that induce intracellular responses according to any one of claims 18 to 21.

29. A method for analyzing the activity of a transcriptional regulatory sequence or a translational regulatory sequence in response to an intracellular response, comprising the steps of: A cell into which a vector is introduced is prepared, wherein The vector comprises: a polynucleotide encoding a transcriptional regulatory sequence or a translational regulatory sequence, a polynucleotide encoding a reporter gene system operably connected to the transcriptional regulatory sequence or the translational regulatory sequence, and a marker sequence for identifying the transcriptional regulatory sequence or the translational regulatory sequence. The reporter gene system comprises a protein having the function of changing a target nucleotide sequence and a target sequence thereof, and the recognition sequence is changed by the expression of the reporter gene system; elicits a defined intracellular response in that cell; After inducing the response, the region of the vector containing the target sequence and the marker sequence is analyzed to quantify the change in the target sequence; Associating the target sequence with the transcriptional regulatory sequence or the translational regulatory sequence based on the marker sequence; Based on the amount of change in the target sequence, the activity of the transcriptional regulatory sequence or translational regulatory sequence associated with the target sequence with respect to the response in the predetermined cell is evaluated.

30. The method of claim 29, wherein: The vector comprises: a polynucleotide encoding a transcriptional regulatory sequence and a marker sequence for identifying the transcriptional regulatory sequence.

31. The method of claim 29, wherein: The region containing the target sequence and the marker sequence is analyzed by sequencing.

32. The method of claim 29, wherein: The method comprises the following steps: introducing a plurality of vectors into a cell population, The multiple vectors contain polynucleotides encoding different transcriptional regulatory sequences or translational regulatory sequences.

Images