Armillaria mellea, bacterial agent containing Armillaria mellea and application thereof

Abstract

The present invention discloses Armillaria mellea, a fungal agent containing Armillaria mellea, and its application, and relates to the field of microorganisms. The present invention provides any of the following Armillaria mellea strains, all of which are deposited in the General Microbiology Center of the China Culture Collection Administration of Microorganisms: a) Armillaria mellea Armillaria sp. , the deposit number is CGMCC No.41696; b) Armillaria mellea Armillaria sp. , the deposit number is CGMCC No.41697; c) Armillaria mellea Armillaria sp. The three Armillaria mellea strains provided by the present invention can establish a good symbiotic relationship with Gastrodia elata. The use of the Armillaria mellea strains in accompanying sowing or planting of Gastrodia elata can improve the yield and quality of Gastrodia elata and increase the content of polysaccharides, gastrodin and p-hydroxybenzyl alcohol in Gastrodia elata.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, in particular to Armillaria mellea, a bacterial agent containing Armillaria mellea and applications thereof. Background Art

[0002] Gastrodia elata is a traditional and precious Chinese medicinal herb with a history of over 2,000 years of medicinal use. The 2020 edition of the Chinese Pharmacopoeia states that it is "sweet in taste, neutral in nature, and enters the liver meridian, with the effects of calming wind and relieving spasms, calming liver yang, and dispelling wind and unblocking the meridians." In recent years, the use of Gastrodia elata has increased significantly. The slow growth of wild Gastrodia elata, coupled with long-term harvesting, has led to a gradual decline in Gastrodia elata resources. Wild Gastrodia elata has been listed in the List of Rare and Endangered Plants in China and the List of National Key Protected Wild Plants. Therefore, cultivated Gastrodia elata has gradually become the primary source of commercial Gastrodia elata. Ensuring the yield and quality of cultivated Gastrodia elata is crucial for alleviating the imbalance between supply and demand for Gastrodia elata resources.

[0003] Armillaria melleaf is a symbiotic fungus of Gastrodia elata, a plant of the orchid family. Gastrodia elata requires this symbiotic relationship for normal growth and development. Gastrodia elata is a rootless and leafless heterotrophic plant that relies on Armillaria melleaf for nutrition. Therefore, Armillaria melleaf plays a crucial role in Gastrodia elata's nutrient supply and growth regulation. Studies have shown that Armillaria melleaf is closely linked to Gastrodia elata's yield and quality, directly influencing the growth of Gastrodia elata's protocorms and later tubers, as well as the yield and quality of Gastrodia elata medicinal materials. Therefore, the selection and application of high-quality Armillaria melleaf symbiotic with Gastrodia elata is crucial for improving the yield and quality of Gastrodia elata medicinal materials. Summary of the Invention

[0004] In view of this, the object of the present invention is to provide Armillaria mellea, a fungal agent containing Armillaria mellea and its application, so as to overcome the problems of low yield and poor quality of artificially cultivated Gastrodia elata in the prior art and to improve the yield and quality of Gastrodia elata.

[0005] In a first aspect, the present invention provides a new strain of the genus Armillaria, which is any one of the following Armillaria strains:

[0006] a) The Armillaria mellea is Armillaria sp. , deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms, with the deposit number CGMCC No.41696.

[0007] b) The Armillaria mellea is Armillaria sp. , deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms, with the deposit number CGMCC No.41697.

[0008] c) the Armillaria mellea is Armillaria sp. , deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms, with the deposit number CGMCC No.41698.

[0009] The deposit number is CGMCC No.41696 Armillaria sp., Its ITS sequence is shown in SEQ ID NO. 3.

[0010] The deposit number is CGMCC No.41697 Armillaria sp. , and its ITS sequence is shown in SEQ ID NO.4.

[0011] The deposit number is CGMCC No.41698 Armillaria sp. , and its ITS sequence is shown in SEQ ID NO.5.

[0012] In a second aspect, the present invention provides a bacterial agent comprising at least one strain of the above-mentioned Armillaria mellea.

[0013] Furthermore, the fungal agent is used for companion sowing or planting of Gastrodia elata.

[0014] In a third aspect, the present invention provides the use of the above-mentioned Armillaria mellea or bacterial agent in any of the following:

[0015] (1) Used for accompanying sowing or planting of Gastrodia elata.

[0016] (2) Used for preparing Gastrodia elata companion sowing products or Gastrodia elata companion planting products.

[0017] Furthermore, the above-mentioned Armillaria mellea or bacterial agent is used to improve the quality and / or yield of Gastrodia elata.

[0018] Furthermore, the above-mentioned Armillaria mellea or bacterial agent is used to increase the polysaccharide content in Gastrodia elata.

[0019] Furthermore, the above-mentioned Armillaria mellea or bacterial agent is used to increase the content of gastrodin in Gastrodia elata.

[0020] Furthermore, the above-mentioned Armillaria mellea or bacterial agent is used to increase the content of p-hydroxybenzyl alcohol in Gastrodia elata.

[0021] Beneficial effects:

[0022] The present invention obtains three Armillaria strains through isolation, identification, comparison, and screening. Compared with existing technologies, the three Armillaria strains provided by the present invention have the characteristics of rapid growth, high total terpene and total sugar content, and strong extracellular enzyme activity. When sown or planted with Gastrodia elata, they can increase the yield of Gastrodia elata and the content of polysaccharides, gastrodin, and p-hydroxybenzyl alcohol.

[0023] Preservation Instructions 1:

[0024] Category naming: Armillaria sp. .

[0025] The biological material used in this study: Qiangmi 56.

[0026] Depository: General Microbiology Center of China Culture Collection Administration.

[0027] Abbreviation of the preservation agency: CGMCC.

[0028] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0029] Date of preservation: December 13, 2024.

[0030] The registration number of the preservation center is: CGMCC No.41696.

[0031] Preservation Instructions 2:

[0032] Category naming: Armillaria sp. .

[0033] The biological material used in the study: Qiangmi 41.

[0034] Depository: General Microbiology Center of China Culture Collection Administration.

[0035] Abbreviation of the preservation agency: CGMCC.

[0036] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0037] Date of preservation: December 13, 2024.

[0038] The registration number of the preservation center is: CGMCC No.41697.

[0039] Preservation Instructions 3:

[0040] Category naming: Armillaria sp. .

[0041] The biological material used in this study: Qiangmi 47.

[0042] Depository: General Microbiology Center of China Culture Collection Administration.

[0043] Abbreviation of the preservation agency: CGMCC.

[0044] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0045] Date of preservation: December 13, 2024.

[0046] The registration number of the preservation center is: CGMCC No.41698. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 This is the growth state of the Armillaria mycelium in Example 2.

[0048] Figure 2 is the biomass of Armillaria mellea in Example 2.

[0049] Figure 3 This is the ursolic acid standard curve in Example 3.

[0050] Figure 4 This is the glucose standard curve in Example 4.

[0051] Figure 5 This is the glucose standard curve in Example 7. DETAILED DESCRIPTION

[0052] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0053] In order to better illustrate the technical solution of the present invention, the present invention also provides the following specific examples. It should be understood that the raw materials used in the following examples are all commercially available raw materials unless otherwise specified. Example 1

[0054] Isolation and identification of Armillaria strains

[0055] Source of strains: The inventors collected samples from the Gastrodia elata distribution area in Hanzhong City, Shaanxi Province, and obtained three Armillaria strains through isolation and screening, which were numbered JQ1, JQ2 and JQ3.

[0056] The above three strains of Armillaria were identified by the following method:

[0057] (1) The three Armillaria strains were inoculated on PDA semi-solid culture medium respectively, cultured at 24°C for 20 days, and samples were taken for DNA extraction.

[0058] (2) Using the DNA extracted in step (1) as a template, the universal primers ITS1 and ITS4 were used to amplify the ITS fragment to obtain a PCR product.

[0059] ITS1:TCCGTAGGTGAACCTGCGG (SEQ ID NO. 1).

[0060] ITS4:TCCTCCGCTTATTGATATGC (SEQ ID NO. 2).

[0061] (3) The obtained PCR products were sequenced, and the ITS sequences of JQ1, JQ2, and JQ3 were shown as SEQ ID NO. 3, SEQ ID NO. 4, and SEQ ID NO. 5, respectively. Comparison with the rDNA-ITS sequences of published Armillaria species showed that these three strains were Armillaria. Example 2

[0062] Determination of Growth Indexes of Armillaria Strains

[0063] A section of mature cord was selected from each of the three Armillaria strains JQ1, JQ2 and JQ3 and inoculated into cylindrical PDA semi-solid culture medium, with 30 repetitions for each, and cultured in the dark at 24℃.

[0064] Observe and record the time of rhizal germination and growth, and the growth status. Observe and record morphological indicators such as rhizal length and number of branches 15 days after inoculation. Calculate the average rhizal growth rate (unit: mm / d, average rhizal growth rate = longest rhizal length / (culture time - rhizal germination time) and biomass (unit: g, strains were taken out of the culture for 15 days, dried, and weighed). All three Armillaria strains germinated 5 days after inoculation, grew rapidly, and had biomasses above 0.1 g. JQ2 had the largest biomass (see Figure 1 、 Figure 2 ).

[0065] JQ1 has been deposited in the General Microbiology Center of China Culture Collection Administration on December 13, 2024, with the deposit number CGMCC No.41696 and the classification name Armillaria sp. .

[0066] JQ2 has been deposited in the General Microbiology Center of China Culture Collection Administration on December 13, 2024, with the deposit number CGMCC No.41697 and the classification name Armillaria sp. .

[0067] JQ3 has been deposited in the General Microbiology Center of China Culture Collection Administration on December 13, 2024, with the deposit number CGMCC No.41698 and the classification name Armillaria sp. . Example 3

[0068] Determination of total terpene content in Armillaria strains

[0069] (1) Commercial Armillaria mellea commonly used in the Tianma production area of ​​Hanzhong City, Shaanxi Province was used as the control (CK). Mycelial powder of JQ1, JQ2, JQ3, and CK was sieved, and 0.5 g of each was placed in a centrifuge tube. Ethyl acetate was added, ultrasonically extracted, and centrifuged. The supernatants were combined and shaken to obtain the test solution.

[0070] (2) Weigh 5.0 mg of ursolic acid standard, dissolve it in ethyl acetate and dilute to 50 mL in a volumetric flask. Shake well to obtain the ursolic acid reference solution.

[0071] (3) Preparation of ursolic acid standard curve

[0072] 1 mL, 1.5 mL, 2 mL, 3 mL, 3.5 mL, and 4 mL of ursolic acid reference solution were respectively taken and placed in test tubes. 1.0 mL of 5% vanillin-glacial acetic acid solution and 2 mL of concentrated sulfuric acid were added. After shaking, the solution was heated in a 60°C water bath for 15 min. Immediately cooled in an ice bath, 5 mL of glacial acetic acid was added, the solution was shaken, and the solution was allowed to stand at room temperature. The solution without ursolic acid reference solution was used as a blank control. The absorbance was measured at 543 nm. A standard curve was drawn with the concentration of ursolic acid reference solution as the horizontal axis and the absorbance as the vertical axis (see Figure 3 The concentration of ursolic acid showed a good linear relationship with the absorbance in the range of 0.0199~0.0531mg / mL, and the regression equation was: y=88.207x-0.4603, R 2 =0.9946 (n=6).

[0073] (4) Determination of total terpene content

[0074] 3.0 mL of the test solution prepared in (1) was placed in a test tube. 1.0 mL of 5% vanillin-glacial acetic acid solution and 2 mL of concentrated sulfuric acid were added. After shaking, the solution was heated in a 60°C water bath for 15 min. The solution was immediately cooled in an ice bath. 5 mL of glacial acetic acid was added. The solution was shaken and allowed to stand at room temperature. The absorbance of each solution was measured at 543 nm, and the total terpene content was calculated. The results are shown in Table 1, where % is the mass percentage.

[0075] Table 1 Total terpene content of different Armillaria strains

[0076] serial number Total terpenes (%) JQ1 0.743±0.024 JQ2 0.700±0.017 JQ3 0.330±0.010 CK 0.253±0.012

[0077] As shown in Table 1 , the total terpene contents of the main chemical components in Armillaria strains JQ1, JQ2 and JQ3 were all higher than those in the control, among which the total terpene contents of JQ1 and JQ2 were higher. Example 4

[0078] Determination of total sugar content in Armillaria strains

[0079] (1) Commercial Armillaria mellea commonly used in the Gastrodia elata production area of ​​Hanzhong City, Shaanxi Province was used as a control (CK). The mycelial powder of JQ1, JQ2, JQ3 and CK was sieved, and 0.3 g of each was placed in a centrifuge tube. 12 mL of distilled water was added and the mixture was in a water bath at 70°C for 3.5 h. Ultrasonic extraction was performed for 25 min, and the mixture was filtered. The filtrate was concentrated to 10 mL, and 80% ethanol was added. The mixture was precipitated for 16 h and centrifuged for 10 min. The supernatant was removed and the crude polysaccharide was precipitated.

[0080] (2) Take the crude polysaccharide and dilute it to 10 mL with distilled water to obtain the crude polysaccharide mother solution. Take 2.0 mL of the mother solution and dilute it to 50 mL to obtain the test solution.

[0081] (3) Weigh 10.0 mg of anhydrous glucose, place it in a 100 mL volumetric flask, and add distilled water to prepare a 0.1 mg / mL glucose reference solution.

[0082] (4) Preparation of glucose standard curve

[0083] Pipette 0.2 mL, 0.4 mL, 0.6 mL, 0.8 mL, 1.0 mL, and 1.2 mL of glucose reference solution into test tubes, add distilled water to make up to 2.0 mL, and pipette 2.0 mL of distilled water as a blank control. Add 1.0 mL of 5% phenol solution to each tube, shake well, and quickly add 5 mL of concentrated sulfuric acid. Shake well immediately, let it stand for 30 minutes, and then measure the absorbance at a wavelength of 490 nm. Draw a standard curve with the concentration of the glucose dilution as the horizontal axis and the absorbance as the vertical axis (see Figure 4 ). Glucose concentration showed a good linear relationship with absorbance in the range of 0.0101~0.0606 mg / mL, and the regression equation was: y=16.203x+0.0576, R 2 =0.9982 (n=6).

[0084] (5) Determination of total sugar content

[0085] Pipette 2.0 mL of the test solution into a test tube and 2.0 mL of distilled water as a blank control. Add 1.0 mL of 5% phenol solution to each tube, shake well, and quickly add 5 mL of concentrated sulfuric acid. Shake well immediately. After standing for 30 minutes, measure the absorbance of each solution at 490 nm and calculate the total sugar content. The results are shown in Table 2, where % represents the mass percentage.

[0086] Table 2 Total sugar content of different Armillaria strains

[0087] serial number Total sugar (%) JQ1 1.581±0.038 JQ2 2.704±0.058 JQ3 2.334±0.050 CK 0.963±0.028

[0088] As shown in Table 2, the total sugar contents of the main chemical components in the three Armillaria strains were higher than that in the control, among which the total sugar content of strain JQ2 was the highest. Example 5

[0089] Detection of extracellular enzyme activity of Armillaria strains

[0090] (1) Commercial Armillaria mellea commonly used in the Gastrodia elata production area of ​​Hanzhong City, Shaanxi Province was used as the control (CK). A 0.5 cm long mature cord of each of JQ1, JQ2, JQ3 and CK was inoculated in a culture dish containing PDA semi-solid culture medium and cultured in the dark at 24°C. Starting from the 4th day after inoculation, samples were taken every 4 days to measure the activities of the three extracellular enzymes until the 32nd day after inoculation. A total of 8 measurements were made, and each measurement was repeated 3 times.

[0091] (2) Laccase activity of each strain was determined using a laccase activity kit (BC1635, Solaibao Biotechnology Co., Ltd.); xylanase activity of each strain was determined using a xylanase detection kit (GEL-W-TDX059, Jin Enlai Biotechnology Co., Ltd.); and cellulase activity of each strain was determined using a cellulase activity kit (GEL-W-TDX036, Jin Enlai Biotechnology Co., Ltd.). The maximum value of the three extracellular enzyme activities of each strain was entered into Table 3.

[0092] Table 3 Comparison of three extracellular enzyme activities of different Armillaria strains

[0093] serial number Extracellular laccase activity (U / mL) Extracellular xylanase activity (nmol / min / mL) Extracellular cellulase activity (μg / h / mL) JQ1 831.693±8.988 452.340±0.909 585.625±51.850 JQ2 1254.847±13.771 911.059±1.591 332.081±1.336 JQ3 726.401±1.902 744.561±6.356 356.650±2.805 CK 929.920±13.646 395.378±0.263 232.078±1.336

[0094] As shown in Table 3, the extracellular xylanase activity and extracellular cellulase activity of JQ1, JQ2 and JQ3 were higher than those of the control, while the extracellular laccase activity and extracellular xylanase activity of JQ2 were the highest, and the extracellular cellulase activity of JQ1 was the highest. Example 6

[0095] Yield of Gastrodia elata sown with Armillaria mellea strains

[0096] Gastrodia elata was sown with Armillaria mellea strains JQ1, JQ2, JQ3 and CK respectively. After Gastrodia elata matured, 1×1m 2 The sample was dug up three times, and the yield of Gastrodia elata was measured after cleaning, see Table 4.

[0097] Table 4 Comparison of yield of Gastrodia elata sown with different Armillaria strains

[0098] serial number Comparison of the yield of Gastrodia elata with CK JQ1 <![CDATA[3.57 kg / m higher than the yield of Gastrodia elata Blume accompanied by CK 2 > JQ2 <![CDATA[2.25 kg / m higher than the yield of Gastrodia elata accompanied by CK 2 <!-- 5 -->]]> JQ3 <![CDATA[The yield of Gastrodia elata accompanied by CK is 0.46 kg / m higher 2 >

[0099] As shown in Table 4, the yield of Gastrodia elata after sowing with JQ1, JQ2 and JQ3 strains was higher than that of the control, among which the yield of Gastrodia elata sown with JQ1 was the highest. Example 7

[0100] Determination of the contents of extracts, polysaccharides, gastrodin and p-hydroxybenzyl alcohol in Gastrodia elata sown with Armillaria mellea strains

[0101] (1) Steam the purified Gastrodia elata until there is no white core, cool it to room temperature, dry it at 55°C, crush it, sieve it and set aside.

[0102] (2) The determination of extract content was carried out in accordance with the method for determination of alcohol-soluble extract in General Chapter 2201 of the 2020 edition of the Chinese Pharmacopoeia. The determination of gastrodin and p-hydroxybenzyl alcohol content was carried out in accordance with the method for determination of gastrodin and p-hydroxybenzyl alcohol content under the item of Gastrodia elata in the 2020 edition of the Chinese Pharmacopoeia.

[0103] (3) The polysaccharide content was determined using the phenol-concentrated sulfuric acid method. Glucose was used as the standard substance to prepare glucose standard solutions of different concentrations. The absorbance was measured at a wavelength of 490 nm. The glucose standard curve was drawn with the concentration of the glucose standard solution as the horizontal axis and the absorbance as the vertical axis (see Figure 5 ), the linear range of Gastrodia elata polysaccharide was 0.00648 ~ 0.324 mg / mL, and the formula was Y =9.9123 X - 0.0208, R 2 = 0.9994, with good linearity within this range. Pipette the sample solution into a test tube, add 5% phenol solution, mix well, then add 5 mL of concentrated H2SO4 solution, let it stand for 10 minutes, heat in a boiling water bath for 15 minutes, take it out and quickly cool it to room temperature, and measure the absorbance at a wavelength of 490 nm. Calculate the polysaccharide content according to the formula *100%. Where C is the mass concentration of the polysaccharide obtained from the standard curve, mg / mL; V is the fixed volume, mL; N is the dilution factor; and W is the sample mass, g.

[0104] The results are shown in Tables 5 and 6.

[0105] Table 5 Comparison of extracts and polysaccharide contents of different Armillaria strains sown with Gastrodia elata

[0106]

[0107] Table 6 Comparison of gastrodin and p-hydroxybenzyl alcohol contents in Gastrodia elata sown with different Armillaria strains

[0108]

[0109] As shown in Tables 5 and 6, after Gastrodia elata was sown with Armillaria mellea JQ1, JQ2 and JQ3, the contents of extracts, polysaccharides, gastrodin and p-hydroxybenzyl alcohol in the harvested Gastrodia elata were higher.

[0110] From the test results of Examples 6 and 7 above, it can be seen that by sowing Gastrodia elata with Armillaria mellea JQ1, JQ2 and JQ3, high yield and high quality Gastrodia elata can be obtained.

[0111] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein with equivalents. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. Any one of the following Armillaria mellea, characterized in that: a) The honey fungus is Armillaria sp., which is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration with a deposit number of CGMCC No. 41696; b) The honey fungus is Armillaria sp., which is deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with a deposit number of CGMCC No.41697.

2. A bacterial agent, characterized in that The bacterial agent contains at least one strain of the Armillaria mellea described in claim 1.

3. The microbial agent according to claim 2, characterized in that The microbial agent is used for accompanying sowing or planting of Gastrodia elata.

4. Use of the Armillaria mellea described in claim 1 or the bacterial agent described in claim 2 or 3 in any of the following: (1) Used for accompanying sowing or planting of Gastrodia elata; (2) Used for preparing Gastrodia elata companion sowing products or Gastrodia elata companion planting products.

5. Use of the Armillaria mellea described in claim 1 or the microbial agent described in claim 2 or 3 in improving the quality and / or yield of Gastrodia elata.

6. Use of the Armillaria mellea described in claim 1 or the bacterial agent described in claim 2 or 3 in increasing the polysaccharide content in Gastrodia elata.

7. Use of the Armillaria mellea described in claim 1 or the bacterial agent described in claim 2 or 3 in increasing the content of gastrodin in Gastrodia elata.

8. Use of the Armillaria mellea described in claim 1 or the bacterial agent described in claim 2 or 3 in increasing the content of p-hydroxybenzyl alcohol in Gastrodia elata.

Images