Primer pair for identifying single female line of bemisia tabaci based on mtcoxi ii gene and method for identifying single female line of bemisia tabaci

Abstract

The application discloses a primer pair for identifying a single female line of Bemisia tabaci based on an mtCOXIII gene and a method for identifying the single female line of Bemisia tabaci, and belongs to the technical field of agricultural biological detection. The sequence of the primer pair for identifying the single female line of Bemisia tabaci based on the mtCOXIII gene is shown as SEQ ID NO. 1 and SEQ ID NO. 2. According to the difference base of the mitochondrial mtCOXIII gene in the mtDNA of C- and C+ strain Bemisia tabaci, the application develops a primer pair containing the difference base sequence, and further develops a method for identifying the single female line of Bemisia tabaci based on PCR-RFLP, so that different strains of Bemisia tabaci can be identified quickly, accurately and intuitively, and the method lays a foundation for identification of heat-resistant single female lines of Bemisia tabaci, population dynamic identification of Bemisia tabaci, biological research and research on an invasion mechanism.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural biological detection, and particularly relates to a primer pair for identifying Bemisia tabaci monogyne lines based on the mtCOXIII gene and a method for identifying Bemisia tabaci monogyne lines. Background Art

[0002] Heat tolerance refers to an insect or animal's ability to adapt to temperature or maintain normal physiological activities in high temperatures. Heat tolerance, also known as heat resistance, is a critical issue for the survival of some species as global temperatures continue to rise. Most insects are cold-blooded, so temperature fluctuations significantly impact their survival. During global warming heatwaves, many agricultural pests experience shortened life cycles. Sustained high temperatures disrupt the water balance of some larvae, preventing them from feeding properly. This leads to restricted growth and development, and ultimately death.

[0003] Bemisia tabaci (Gennadius), a member of the Aleyrodidae family of the order Hemiptera, is a highly destructive agricultural insect. It is considered a species complex consisting of at least 44 cryptic species, which differ in many biological characteristics. Among them, the MEAM1 and MED cryptic species have become globally invasive crop pests. One of the key factors behind the whitefly's rapid global spread and emergence as a significant pest is its strong resistance to temperature fluctuations.

[0004] Therefore, rapid and accurate identification of different strains of whitefly, especially heat-resistant strains, is of great significance for population dynamics monitoring, biological research and invasion mechanism research of whitefly. Summary of the Invention

[0005] In view of the problems existing in the prior art, the present invention aims to provide a primer pair for identifying Bemisia tabaci monogyne based on the mtCOXIII gene and a method for identifying Bemisia tabaci monogyne.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A primer pair for identifying the monogynous lineage of Bemisia tabaci based on the mtCOXIII gene, wherein the sequences of the primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0008] The primer pair is used to identify the monogynous lines of Bemisia tabaci based on the PCR-RFLP method for identifying the monogynous lines of C- and C+ strains of Bemisia tabaci.

[0009] A method for identifying monogynous lines of Bemisia tabaci comprises extracting genomic DNA from a to-be-tested Bemisia tabaci as a template, performing PCR amplification using the aforementioned primer pair, enzymatically digesting the PCR amplification product using a restriction endonuclease, and performing agarose gel electrophoresis on the product obtained by the enzymatic digestion to detect the length of the fragment and the number of bands; the restriction endonuclease is at least one of Pcil, MaeIII, AflIII, and HpyCH4V.

[0010] Based on the above protocol, the method was used to identify the monogynous lines of Bemisia tabaci of the C- and C+ strains.

[0011] Based on the above scheme, when the restriction endonuclease used was Pcil, the agarose gel electrophoresis pattern showed a band with a fragment length of 400 bp, indicating that the tested whitefly was a C+ strain; the agarose gel electrophoresis pattern showed two bands of 301 bp and 103 bp, indicating that the tested whitefly was a C- strain.

[0012] Based on the above scheme, when the restriction endonuclease used was HpyCH4V, the agarose gel electrophoresis pattern showed a band with a fragment length of 400 bp, indicating that the tested whitefly was a C- strain; the agarose gel electrophoresis pattern showed two bands of 297 bp and 103 bp, indicating that the tested whitefly was a C+ strain.

[0013] Based on the above scheme, the amplification system of the PCR amplification is: 2 μL of genomic DNA solution, 1 μL each of 10 μM forward and antisense primers, 12.5 μL of Premix Taq, and DEPC water to make up to 25 μL;

[0014] The reaction conditions of the PCR amplification were as follows: pre-denaturation at 95°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 60 seconds, for 35 cycles; and extension at 72°C for 2 minutes.

[0015] Based on the above scheme, the restriction endonuclease digestion conditions are: 37° C., 60 minutes.

[0016] Advantages of the technical solution of the present invention

[0017] The invention develops a primer pair for amplifying the differential base sequence of the mitochondrial mtCOXIII gene in the mtDNA of the C- and C+ strains of Bemisia tabaci based on the differential bases. The genomic DNA of the to-be-tested Bemisia tabaci is used as a template, PCR amplification is performed using the primer pair, the amplified product is digested with a restriction endonuclease, and the length of the digested fragment and the number of bands are detected by agarose gel electrophoresis. Thus, the purpose of distinguishing the monogynous lines of the C- and C+ strains of Bemisia tabaci is achieved.

[0018] The PCR-RFLP-based method for identifying monogynous strains of Bemisia tabaci can quickly, accurately and intuitively identify different strains of Bemisia tabaci, laying a foundation for the identification of heat-resistant monogynous strains of Bemisia tabaci, the identification of population dynamics of Bemisia tabaci, and the study of biology and invasion mechanisms. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 : is an agarose gel electrophoresis diagram of the PCR product in Example 2 before enzyme digestion and after digestion with HpyCH4V and Pcil respectively (wherein, M: Marker 2000, from top to bottom are 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp);

[0020] Figure 2 3 is an agarose gel electrophoresis diagram of the PCR product in Example 3 after HpyCH4V digestion (wherein wells 1 to 5 are for Bemisia tabaci C- strain in Shouguang area of ​​Shandong Province, and wells 6 to 10 are for Bemisia tabaci C+ strain in Shouguang area of ​​Shandong Province);

[0021] Figure 3 4 is an agarose gel electrophoresis diagram of the PCR product in Example 4 after HpyCH4V digestion (wherein wells 1 to 5 are for Bemisia tabaci C- strain in Lingshui area of ​​Hainan Province, and wells 6 to 10 are for Bemisia tabaci C+ strain in Lingshui area of ​​Hainan Province);

[0022] Figure 4 : is an agarose gel electrophoresis image of the PCR product after Pcil digestion in Example 5 (wherein wells 1 to 5 are for Bemisia tabaci C- strain in Shouguang area of ​​Shandong Province, and wells 6 to 10 are for Bemisia tabaci C+ strain in Shouguang area of ​​Shandong Province);

[0023] Figure 5 This is an agarose gel electrophoresis diagram of the PCR product in Example 6 after Pcil digestion (wells 1 to 5 are for the C- strain of Bemisia tabaci from Lingshui, Hainan Province, and wells 6 to 10 are for the C+ strain of Bemisia tabaci from Lingshui, Hainan Province). DETAILED DESCRIPTION

[0024] The terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art. Below, in conjunction with specific examples, the present invention will be further described in detail with reference to data. The following examples are merely for illustration of the present invention and are not intended to limit the scope of the present invention in any way.

[0025] The experimental methods in the following examples, unless otherwise specified, are all conventional methods and are performed according to the techniques or conditions described in the literature in this field or according to the product instructions. The experimental materials, reagents, and drugs used in the following examples, unless otherwise specified, can all be purchased through general channels.

[0026] In the following examples, the HpyCH4V and Pcil endonuclease (PciI, also known as PscI or BspLU11I) were purchased from NEB Biotechnology, Premix Taq (Ex Taq) was purchased from Takara, autoclaved STE (TNE) buffer (pH 8.0) was purchased from Solarbio, Proteinase K was purchased from Aikerui Biotechnology, and other reagents and consumables were all commercially available products.

[0027] The whitefly in the following examples is the Q-type whitefly (MED cryptic species).

[0028] Example 1

[0029] Obtaining differential loci of the mtCOXIII gene in different strains (C- and C+) of Bemisia tabaci

[0030] (1) Bemisia tabaci were collected from Shouguang, Shandong (SG) and Lingshui, Hainan (LS) respectively. The results were as follows [Li H, Wei X, Ding T, Chu D. Genome-Wide Profiling of Cardinium-Responsive MicroRNAs in the Exotic Whitefly, Bemisia tabaci (Gennadius) Biotype Q. Front Physiol. 2018 Nov 12;9:1580.doi:10.3389 / fphys.2018.01580.PMID:30483149;PMCID:PMC6241202.] The above-mentioned whiteflies were tested separately according to the method described in [1]. They were divided into whitefly C- strain and C+ strain. According to the method described in [12;9:1580.doi:10.3389 / fphys.2018.01580.PMID:30483149;PMCID:PMC6241202.], and the monogyne lines C+ and C- with the same genetic background were constructed for whiteflies collected from Shouguang, Shandong Province (SG) and Lingshui, Hainan Province (LS), respectively. These two lines had significant differences in biological characteristics, such as high temperature resistance.

[0031] (2) Based on the above method, the mitochondrial genomes of two strains (C- and C+) of whitefly were constructed and analyzed using the molecular software SnapGene. 5.2 Comparison of the mitochondrial genome sequences of the two strains revealed only a single base difference in the mtCOXIII gene sequences of the two strains. This differential base in the C- strain is the recognition site for the restriction endonuclease Pcil (enzyme cutter site 5'-A^CATGT-3', "^" indicates the enzyme cutter site). This site is also recognized by two enzymes: MaeIII (enzyme cutter site 5'-^GTNAC-3'; "^" indicates the enzyme cutter site; N represents any nucleotide, A, T, C, or G) and AflIII (enzyme cutter site 5'-A^CRYGT-3'; "^" indicates the enzyme cutter site; R represents a purine, A or G; Y represents a pyrimidine, C or T). The differential base in the C+ strain is the recognition site for the restriction endonuclease HpyCH4V (enzyme cutter site 5'-TG^CA-3', "^" indicates the enzyme cutter site).

[0032] Example 2

[0033] The method for identifying monogynous lines of Bemisia tabaci based on PCR-RFLP is as follows:

[0034] (1) Extraction of whitefly genomic DNA

[0035] A single female whitefly was placed in a 0.2 mL centrifuge tube containing 30 μL of alkaline lysis solution, which was autoclaved STE (TNE) buffer (pH 8.0): Proteinase K = 35:2 (volume ratio). After being thoroughly ground and homogenized with a sealed pipette tip, the tube was placed in a PCR instrument at 65°C for 15 minutes and 95°C for 10 minutes to obtain the whitefly genomic DNA solution.

[0036] (2) PCR amplification of a partial fragment of the mtCOXIII gene of Bemisia tabaci

[0037] PCR amplification products were obtained by using genomic DNA solutions of Bemisia tabaci from Hainan Lingshui C- strain (LSC-), Shandong Shouguang C- strain (SGC-), Hainan Lingshui C+ strain (LSC+), and Shandong Shouguang C+ strain (SGC+) as templates.

[0038] Sense primer: 5′-CCAGACATAGAAACGGGATCCAT-3′ (SEQ ID NO. 1);

[0039] Antisense primer: 5'-ATCAGATAGAGTATTCAAACCCGT-3' (SEQ ID NO. 2).

[0040] The PCR amplification system was as follows: 2 μL of genomic DNA solution, 1 μL each of 10 μM forward and antisense primers, 12.5 μL of Premix Taq (Ex Taq), and DEPC water was added to 25 μL.

[0041] PCR amplification conditions: pre-denaturation at 95°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 60 seconds, for 35 cycles; extension at 72°C for 2 minutes; 4°C, ∞.

[0042] (3) Detect the PCR amplification product obtained in step (2) by agarose gel electrophoresis (e.g. Figure 1 shown in lanes 1-4).

[0043] The PCR amplification products were sequenced to obtain the PCR amplification product sequences of the Hainan Lingshui C- strain and the Shandong Shouguang C- strain as shown in SEQ ID NO.3, and the PCR amplification product sequences of the Hainan Lingshui C+ strain and the Shandong Shouguang C+ strain as shown in SEQ ID NO.4.

[0044] SEQ ID NO.3(5'→3')

[0045] CCAGACATAGAAACGGGATCCATTTGACCCCCCTTCAAAGTTACTCAGATAAGGTTTATAGACATTCCTTTATTAAACACTATAGTTTTACTAATATCGGGATTTTTCATTACCTGGGCTCATTACGATTTAACTATAAACAGATTTAAAAATTCAAGAATTAGCTTAGTAATTTCTATTCTATTAGGAATTTATTTTTT AATAATTCAAGGATATGAGTATGTAAATTCAAGAATTAGATTTAATGATAGTGTATTTGGGAACTCGTTTTTTATTTTAACTGGATTCCATGGGTTACATGTAATAATTGGTCTGATCTTTTTAATTGTAATGATAGTTCAATTGATTGAAAAGAAATTTAGATTGATAAATCTAAACGGTTTTGAATACTCTATCTGAT

[0046] SEQ ID NO.4 (5'→3')

[0047] CCAGACATAGAAACGGGATCCATTTGACCCCCCTTCAAAGTTACTCAGATAAGGTTTATAGACATTCCTTTATTAAACACTATAGTTTTACTAATATCGGGATTTTTCATTACCTGGGCTCATTACGATTTAACTATAAACAGATTTAAAAATTCAAGAATTAGCTTAGTAATTTCTATTCTATTAGGAATTTATTTTTT AATAATTCAAGGATATGAGTATGTAAATTCAAGAATTAGATTTAATGATAGTGTATTTGGGAACTCGTTTTTTATTTTAACTGGATTCCATGGGTTGCATGTAATAATTGGTCTGATCTTTTTAATTGTAATGATAGTTCAATTGATTGAAAAGAAATTTAGATTGATAAATCTAAACGGTTTTGAATACTCTATCTGAT

[0048] (4) digesting the PCR amplification product obtained in step (3) with restriction endonucleases HpyCH4V and PciI, respectively, to obtain digestion products;

[0049] Enzyme digestion system: rCutSmart Buffer (HpyCH4V enzyme) or r 3.1 (PciI enzyme) 2 μL, PCR amplification product 5 μL, HpyCH4V or PciI endonuclease 1 μL, DEPC water to 20 μL.

[0050] Reaction conditions: Place in PCR instrument at 37°C for 60 minutes.

[0051] (5) Separate the enzyme-digested products obtained in step (4) by agarose gel electrophoresis, image them on a UV gel imager, and observe their polymorphism.

[0052] The results showed that the restriction endonuclease HpyCH4V digestion results showed that the Hainan Lingshui C- strain (LSC-) and Shandong Shouguang C- strain (SGC-) had a fragment length of 400 bp on the imaging film, and the Hainan Lingshui C+ strain (LSC+) and Shandong Shouguang C+ strain (SGC+) electrophoresis patterns showed that the tested samples had two bands of 297 bp and 103 bp (such as Figure 1The results of restriction endonuclease PciI digestion showed a 400 bp band on the imaging film of Hainan Lingshui C+ strain (LSC+) and Shandong Shouguang C+ strain (SGC+), and the electrophoresis patterns of Hainan Lingshui C- strain (LSC-) and Shandong Shouguang C- strain (SGC-) showed two bands of 301 bp and 103 bp (including sticky terminal bases) in the tested samples (as shown in lanes 6-9). Figure 1 shown in lanes 11-14).

[0053] Example 3

[0054] The method for identifying monogynous lines of Bemisia tabaci based on PCR-RFLP is as follows:

[0055] (1) Extraction of whitefly genomic DNA

[0056] Five female whiteflies were randomly selected from two monogynous lines (C- and C+) in Shouguang, Shandong Province, established in the laboratory. They were placed in 0.2 mL centrifuge tubes containing 30 μL of alkaline lysis solution, which consisted of autoclaved STE (TNE) buffer (pH 8.0): Proteinase K = 35:2 (volume ratio). The slurry was thoroughly ground with a sealed pipette tip and placed in a PCR instrument at 65°C for 15 min and 95°C for 10 min to obtain the whitefly genomic DNA solution.

[0057] (2) PCR amplification of a partial fragment of the mtCOXIII gene of Bemisia tabaci

[0058] PCR amplification was performed using the genomic DNA solutions of Bemisia tabaci from Shandong Shouguang C- strain (SGC-) and Shandong Shouguang C+ strain (SGC+) as templates to obtain PCR amplification products.

[0059] Sense primer: 5′-CCAGACATAGAAACGGGATCCAT-3′ (SEQ ID NO. 1);

[0060] Antisense primer: 5'-ATCAGATAGAGTATTCAAACCCGT-3' (SEQ ID NO. 2).

[0061] The PCR amplification system was as follows: 2 μL of genomic DNA solution, 1 μL each of 10 μM forward and antisense primers, 12.5 μL of Premix Taq (Ex Taq), and DEPC water was added to 25 μL.

[0062] PCR amplification conditions: pre-denaturation at 95°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 60 seconds, for 35 cycles; extension at 72°C for 2 minutes; 4°C, ∞.

[0063] (3) digesting the PCR amplification product obtained in step (2) with restriction endonuclease HpyCH4V to obtain a digestion product;

[0064] Enzyme digestion system: rCutSmart Buffer 2μL, PCR amplification product 5μL, HpyCH4V endonuclease 1μL, DEPC water to 20μL.

[0065] Reaction conditions: Place in PCR instrument at 37°C for 60 minutes.

[0066] (4) Separate the enzyme-digested products obtained in step (3) by agarose gel electrophoresis, image them on a UV gel imager, and observe their polymorphism.

[0067] The results showed that the imaging film of the Shandong Shouguang C- strain had a band of 400 bp in length on the spotting wells 1 to 5; the electrophoresis pattern of the Shandong Shouguang C+ strain showed that the tested sample had two bands of 297 bp and 103 bp (such as Figure 2 ).

[0068] Example 4

[0069] The method for identifying monogynous lines of Bemisia tabaci based on PCR-RFLP is as follows:

[0070] The two monogyne lines C- and C+ from Lingshui, Hainan Province, established in the laboratory were used as test samples, and their genomic DNA was extracted; the detection method was the same as that in Example 3.

[0071] The results of agarose gel electrophoresis were imaged on a UV gel imager. The results showed that the imaging film of wells 1 to 5, which were the C- strain of Lingshui, Hainan, had a band of 400 bp in length. The electrophoresis pattern of wells 6 to 10, which were the C+ strain of Lingshui, Hainan, showed that the tested sample had two bands of 297 bp and 103 bp (as shown in Figure 2). Figure 3 ).

[0072] Example 5

[0073] The method for identifying monogynous lines of Bemisia tabaci based on PCR-RFLP is as follows:

[0074] Two monogynous lines C- and C+ from Shouguang, Shandong Province, established in the laboratory, were used as test samples to extract their genomic DNA. The remaining steps were the same as in Example 3, except that the restriction endonuclease used in step (3) was PciI and its corresponding 10xBuffer was r3.1.

[0075] The results of agarose gel electrophoresis were imaged on a UV gel imager. The imaging film of the C- strain of Shandong Shouguang showed two bands with fragment lengths of 301 bp and 103 bp (including sticky terminal bases) on the wells 1 to 5. The electrophoresis pattern of the C+ strain of Shandong Shouguang showed that the tested sample had a band with a length of 400 bp (such as Figure 4 ).

[0076] Example 6

[0077] The method for identifying monogynous lines of Bemisia tabaci based on PCR-RFLP is as follows:

[0078] Two monogyne lines C- and C+ from Lingshui, Hainan Province, established in the laboratory, were used as test samples to extract their genomic DNA. The remaining steps were the same as in Example 3, except that the restriction endonuclease used in step (3) was PciI and its corresponding 10xBuffer was r3.1.

[0079] The results of agarose gel electrophoresis were imaged on a UV gel imager. The imaging film of wells 1 to 5, which were the C- strain of Lingshui, Hainan, showed two bands with fragment lengths of 301 bp and 103 bp (including the sticky terminal bases). The electrophoresis pattern of wells 6 to 10, which were the C+ strain of Lingshui, Hainan, showed that the tested sample had only one band with a length of 400 bp (such as Figure 5 ).

[0080] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other manner. Any person skilled in the art may utilize the above-disclosed technical content to modify or modify the present invention into equivalent embodiments. However, any simple modifications, equivalent variations, and modifications to the above embodiments that do not depart from the technical content of the present invention and are based on the technical essence of the present invention remain within the scope of protection of the present invention.

Claims

1. A method for distinguishing C- and C+ strains of Bemisia tabaci monogyne, characterized in that: Extracting genomic DNA from the whitefly to be tested as a template, performing PCR amplification using a primer pair, digesting the PCR amplification product using a restriction endonuclease, and performing agarose gel electrophoresis on the product obtained by enzyme digestion to detect the length of the fragment and the number of bands; the restriction endonuclease is at least one of Pcil, MaeIII, AflIII and HpyCH4V; The primer pair sequences are shown in SEQ ID NO.1 and SEQ ID NO.2; When the restriction endonuclease used was Pcil, the agarose gel electrophoresis pattern showed a band with a fragment length of 400 bp, indicating that the tested whitefly was a C+ strain; the agarose gel electrophoresis pattern showed two bands of 301 bp and 103 bp, indicating that the tested whitefly was a C- strain; When the restriction endonuclease used was HpyCH4V, the agarose gel electrophoresis pattern showed a band with a fragment length of 400 bp, indicating that the tested whitefly was a C- strain; the agarose gel electrophoresis pattern showed two bands of 297 bp and 103 bp, indicating that the tested whitefly was a C+ strain; The whitefly is a Q-type whitefly.

2. The method for distinguishing C- and C+ strains of Bemisia tabaci monogyne according to claim 1, characterized in that: The PCR amplification system is as follows: 2 µL of genomic DNA solution, 1 µL each of 10 µM forward and antisense primers, 12.5 µL of Premix Taq, and DEPC water is added to 25 µL. The reaction conditions of the PCR amplification were as follows: pre-denaturation at 95°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 60 seconds, for 35 cycles; and extension at 72°C for 2 minutes.

3. The method for distinguishing C- and C+ strains of Bemisia tabaci monogyne according to claim 2, characterized in that: The restriction endonuclease digestion conditions are: 37° C., 60 minutes.

Images