Adipose-derived mesenchymal stem cell as well as preparation method and application thereof

Abstract

The invention discloses adipose-derived mesenchymal stem cells (ADSCs) as well as a preparation method and application thereof. The ADSCs modified by the novel annular RNA-circAars gene have obviously enhanced osteogenic ability, and are suitable for the field of bone tissue engineering. The preparation method comprises the following steps: firstly, extracting adipose tissues from the groin of an SD (Sprague Dawley) rat, and digesting with collagenase to obtain ADSCs; then, circAars overexpression plasmids are synthesized, and circAars genes are transfected into the ADSCs by utilizing a lentivirus packaging system; and finally, screening and purifying the successfully transfected ADSCs through purinase. The ADSCs modified by the circAars gene show relatively strong osteogenic ability, are suitable for treatment of craniomaxillofacial bone defects, and also provide a new treatment strategy for repair of other bone defects. The method has great industrialization potential, and an efficient and safe treatment scheme is provided for bone defect repair.

Description

Technical Field

[0001] The present invention relates to the field of stem cell technology, and in particular to adipose-derived mesenchymal stem cells and a preparation method and application thereof. Background Art

[0002] In recent years, adipose-derived mesenchymal stem cells (ADSCs), a promising stem cell type, have been widely used in tissue regeneration, including bone and cartilage repair. They have shown promising potential in repairing bone defects and promoting bone tissue regeneration. Existing research indicates that ADSCs possess robust self-renewal capacity and multidirectional differentiation potential, capable of differentiating into osteoblasts, chondrocytes, and adipocytes, and exhibit significant immunomodulatory effects.

[0003] However, despite the potential of ADSCs in clinical applications, enhancing their osteogenic capacity remains a key challenge in bone defect repair. Recent research on circRNAs (circular RNAs) has demonstrated their unique advantages in regulating gene expression, particularly in promoting cell migration and osteogenesis. Therefore, enhancing the osteogenic capacity of adipose-derived mesenchymal stem cells through genetic modification of circRNAs has become a pressing technical challenge in this field. Summary of the Invention

[0004] The purpose of the present invention is to provide adipose-derived mesenchymal stem cells, a preparation method and application thereof, which can enhance the osteogenic ability of ADSCs through circAars gene modification and solve the problem of insufficient osteogenic ability of ADSCs in bone defect repair in the prior art.

[0005] To achieve the above objectives, the present invention provides the following technical solution: adipose-derived mesenchymal stem cells, wherein the ADSCs are stem cells modified by the circAars gene.

[0006] A method for preparing adipose-derived mesenchymal stem cells comprises the following steps: S1, extracting ADSCs; S2, synthesizing a circAars overexpression plasmid; S3, extracting a viral fluid of the circAars overexpression plasmid; and S4, constructing circAars-modified ADSCs.

[0007] Preferably, the S1 further includes the following steps: S11, extracting adipose tissue from the inguinal fat pad of SD rats; S12, using 0.1% collagenase I to digest the adipose tissue at 37°C, shaking once every 10 minutes, and the digestion time is 30 to 90 minutes, and collecting the cells after filtration; S13, inoculating the cells in a culture medium containing DMEM / F12 medium, 10% fetal bovine serum and 1% double antibody, and culturing until the cells reach 90% confluence; S14, detecting the ADSCs markers CD29, CD44, CD45 and CD34 by flow cytometry, and confirming that the cells are adipose-derived mesenchymal stem cells by inducing multidirectional differentiation ability of osteogenic and adipogenic differentiation.

[0008] Preferably, the S2 further comprises the following steps: S21, extracting total RNA: collect tissue from adipose tissue by centrifugation, grind with liquid nitrogen, add 1 ml of Trizol solution to fully lyse the tissue, and let it stand for 5 minutes; add 200 μl of chloroform, shake vigorously to mix, let it stand for 15 minutes, collect the RNA aqueous phase after centrifugation; add 0.5 ml of isopropanol to precipitate RNA, let it stand for 10 minutes, wash the RNA precipitate after centrifugation, and dissolve it in DEPC water. S22, detecting the purity and integrity of total RNA: using ultraviolet spectrophotometry to detect the OD260 / OD280 ratio to ensure that the RNA purity is greater than 1.8; detecting the integrity of the 28s, 18s, and 5s bands of RNA by agarose gel electrophoresis. S23. Perform reverse transcription: Prepare a reaction system containing total RNA, oligo(dT), random primers, dNTPs, RNase inhibitor, buffer, and M-MLV reverse transcriptase; incubate at 30°C for 10 minutes, 42°C for 60 minutes, and 72°C for 10 minutes to obtain cDNA. S24. Amplify the circAars gene by PCR: Prepare a PCR system containing 2 mM dNTPs, 10× KOD buffer, 25 mM MgSO₄, primers, and KOD DNA polymerase; set the amplification conditions as follows: pre-denaturation at 94°C for 1 minute, followed by 30 cycles of 98°C for 15 seconds, 58°C for 15 seconds, and 68°C for 1 minute; after amplification, detect and recover the target fragment by agarose gel electrophoresis. S25. Ligate the circAars gene fragment to the vector: Use EcoRI and BamHI to double-digest the vector and the amplified product, and perform a ligation reaction; transform the ligation product into competent cells, select positive clones and identify them by enzyme digestion, and finally construct a circAars overexpression plasmid.

[0009] Preferably, S3 further comprises the following steps: transfecting the circAars overexpression plasmid into 293T cells using a Lenti-PacHIV lentiviral packaging kit; culturing at 37° C. for 24 hours, collecting the viral fluid and filtering it through a filter membrane to remove impurities.

[0010] Preferably, S4 further includes the following steps: S41, transfecting the collected virus solution into ADSCs cells to ensure that the infection rate reaches more than 70%; S42, replacing the culture medium after culturing for 24 hours, and adding puromycin for resistance screening until purified circAars-modified ADSCs are obtained.

[0011] An application of adipose-derived mesenchymal stem cells, including ADSCs prepared using a method for preparing adipose-derived mesenchymal stem cells, wherein the ADSCs are used for bone tissue engineering.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] 1. The present invention improves the osteogenic capacity of ADSCs through circAars gene modification, solving the problem of insufficient osteogenic capacity of existing ADSCs in bone defect repair.

[0014] 2. Through the improved gene modification method, the ADSCs of the present invention show better repair effects in the treatment of craniomaxillofacial bone defect diseases and have significant clinical application potential.

[0015] 3. The preparation method of the present invention is simple and efficient, capable of large-scale culture and modification of ADSCs, and has strong industrial application value.

[0016] 4. The ADSCs modification method provided by the present invention can be widely used in bone tissue regeneration medicine and clinical treatment, providing a new strategy for the repair of clinical bone tissue defects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Graph showing the results of phenotypic identification and differentiation potential detection of adipose-derived mesenchymal stem cells of the present invention;

[0018] Figure 2 This is the imaging result diagram of the UVP gel imaging system of the present invention;

[0019] Figure 3 Blast comparison results of the sequencing results of the present invention are shown in the figure;

[0020] Figure 4 This is a flow chart of the method for preparing adipose-derived mesenchymal stem cells of the present invention;

[0021] Figure 5 Detection diagram of the overexpression efficiency of circAars in ADSCs of the present invention

[0022] Figure 6 Schematic diagram of the osteogenic ability test results of ADSCs engineered by CircAars of the present invention;

[0023] Figure 7 This is a diagram of the critical-size bone defect model of the rat skull and the evaluation of the treatment effect of the present invention. DETAILED DESCRIPTION

[0024] The following will provide a clear and complete description of the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0025] See also Figures 1 to 7 The present invention provides a technical solution: adipose-derived mesenchymal stem cells (ADSCs), a type of multipotent stem cell isolated from adipose tissue, possess strong self-renewal capacity and multidirectional differentiation potential. Under normal physiological conditions, these stem cells can differentiate into various cell types, such as osteoblasts (bone cells), chondrocytes (articular cartilage cells), adipocytes, and muscle cells. Therefore, ADSCs have a wide range of applications in bone tissue repair, regenerative medicine, and stem cell therapy.

[0026] In the present invention, we genetically modified ADSCs, specifically by introducing the circAars gene, so that these cells significantly enhance their osteogenic ability, thereby improving their application effect in bone tissue regeneration engineering.

[0027] circAars are circular RNAs that, compared to traditional linear RNAs, possess unique stability and long-lasting effects. Studies have shown that circAars can effectively regulate various biological processes within cells, especially playing an important role in multidirectional cell differentiation.

[0028] The present invention significantly enhances the activity of ADSCs during osteogenesis by introducing the circAars gene into them. Specifically, circAars activates osteogenesis-related gene expression by affecting intracellular signaling pathways, thereby promoting bone tissue formation.

[0029] Effects of Gene Modification: ADSCs modified with the circAars gene exhibit significant advantages in bone formation. When inoculated into bone defects, these genetically modified stem cells can accelerate bone regeneration and form healthier, more structurally intact bone tissue. Compared to unmodified ADSCs (OE-circAars-NC), these modified cells (OE-circAars) differentiate into osteoblasts more rapidly and demonstrate enhanced bone formation in both in vitro and in vivo experiments.

[0030] Advantages of the genetic modification process:

[0031] Stability and long-term effect: The circAars gene is stably expressed in cells through a circular structure, thereby achieving long-term and lasting biological effects and avoiding short-term fluctuations in gene expression. Efficient modification: Through modern gene transfection technology (such as the lentiviral vector system), the circAars gene can be efficiently and stably introduced into ADSCs, ensuring the efficiency and reliability of the modification process; through circAars gene modification, the osteogenic ability of ADSCs is significantly improved, giving it better clinical effects in the treatment of bone defects, fracture healing, etc. Although the main function of circAars is to enhance osteogenic ability, the modified ADSCs still retain their original multidirectional differentiation potential, can play a role in different tissue repair needs, and have strong application flexibility. ADSCs modified with this circAars gene can be widely used in many fields such as bone tissue engineering and maxillofacial repair, especially in bone defect repair and bone regenerative medicine, and have great potential.

[0032] A method for preparing adipose-derived mesenchymal stem cells comprises the following steps:

[0033] S1. Extracting ADSCs: ADSCs are stem cells isolated and cultured from adipose tissue and have excellent self-renewal and multidirectional differentiation capabilities. The present invention first extracts adipose-derived mesenchymal stem cells through the following steps.

[0034] S1 further comprises the following steps:

[0035] S11. Extract adipose tissue from the inguinal fat pad of SD rats: Adipose tissue is extracted from the inguinal fat pad of SD rats. The inguinal region is typically selected because it is abundant and easily accessible. Adipose tissue is the primary source of ADSCs, and extracting adipose tissue from this region ensures a sufficient cell source. S12. Digest adipose tissue with 0.1% collagenase I at 37°C, shaking every 10 minutes for 30 to 90 minutes. Filter and collect cells: The extracted adipose tissue is digested with 0.1% collagenase I. This process aims to break down the extracellular matrix in the adipose tissue, allowing the mesenchymal stem cells in the adipose tissue to enter the solution. Collagenase I is a commonly used digestive enzyme that effectively breaks down collagen and reduces intercellular adhesion. Digestion is performed at 37°C, shaking every 10 minutes to ensure uniform distribution of the collagenase throughout the adipose tissue. The digestion time ranges from 30 to 90 minutes to ensure adequate digestion of the adipose tissue while avoiding cell damage caused by prolonged digestion. The digested cell suspension was filtered through a 100 μm filter to remove incompletely digested tissue debris and obtain a pure adipose stem cell suspension.

[0036] S13. Cells are plated in a medium containing DMEM / F12 medium, 10% fetal bovine serum, and 1% anti-antibiotics until they reach 90% confluency. After separation, the cells are plated in a medium containing DMEM / F12 medium (a commonly used cell culture medium), 10% fetal bovine serum (to provide growth factors), and 1% anti-antibiotics. Fetal bovine serum is a key component in cell culture, providing essential nutrients for the cells, while anti-antibiotics (penicillin / streptomycin) prevent bacterial contamination.

[0037] The cells need to reach 90% confluence during the culture process, which means that the cells have fully grown and entered the logarithmic growth phase and are suitable for the next step.

[0038] S14. Flow cytometry was used to detect ADSC markers CD29, CD44, CD45, and CD34, as well as the ability to induce multidirectional differentiation into osteoblasts and adipocytes, confirming that the cells were adipose-derived mesenchymal stem cells:

[0039] The isolated cells were tested for markers using flow cytometry to confirm that they were adipose-derived mesenchymal stem cells (ADSCs). Flow cytometry is an efficient and precise cell analysis technique that can confirm cell types by labeling with specific antibodies (such as CD29, CD44, CD45, and CD34). CD29 and CD44 are hallmark surface markers of mesenchymal stem cells; CD45 and CD34 are commonly used to distinguish mesenchymal stem cells from other types of cells. By detecting these markers, it can be ensured that the extracted cells are adipose-derived mesenchymal stem cells and provide a higher purity cell source for subsequent gene modification.

[0040] S2. Synthesis of a circAars overexpression plasmid: The key technical aspect of this invention is the modification of ADSCs with the circAars gene. The circAars gene is a circular RNA with the unique biological function of significantly enhancing the osteoblastic capacity of ADSCs. To achieve this goal, a circAars overexpression plasmid was first synthesized.

[0041] S2 further includes the following steps: S21, extracting total RNA:

[0042] Tissue was collected from adipose tissue by centrifugation, ground with liquid nitrogen, and 1 ml of Trizol solution was added to fully lyse the tissue, and allowed to stand for 5 minutes; 200 μl of chloroform was added, vigorously shaken to mix, and allowed to stand for 15 minutes. After centrifugation, the RNA aqueous phase was collected; 0.5 ml of isopropanol was added to precipitate RNA, and the mixture was allowed to stand for 10 minutes. After centrifugation, the RNA precipitate was washed and dissolved in DEPC water.

[0043] S22. Check the purity and integrity of total RNA: Use UV spectrophotometry to measure the OD260 / OD280 ratio to ensure RNA purity is greater than 1.8; use agarose gel electrophoresis to check the integrity of the 28s, 18s, and 5s bands of RNA.

[0044] S23. Perform reverse transcription reaction: prepare a reaction system containing total RNA, oligo (dT), random primers, dNTPs, RNase inhibitor, buffer and M-MLV reverse transcriptase; incubate at 30°C for 10 minutes, 42°C for 60 minutes, and 72°C for 10 minutes to obtain cDNA.

[0045] S24. Amplify the circAars gene by PCR: prepare a PCR system including 2 mM dNTPs, 10× KOD buffer, 25 mM MgSO4, primers, and KOD DNA polymerase; set the amplification conditions as follows: pre-denaturation at 94°C for 1 min; 30 cycles of 98°C for 15 s, 58°C for 15 s, and 68°C for 1 min; after amplification, detect and recover the target fragment by agarose gel electrophoresis.

[0046] S25. Ligate the circAars gene fragment to the vector: Use EcoRI and BamHI to double-digest the vector and the amplified product, and perform a ligation reaction; transform the ligation product into competent cells, select positive clones and identify them by enzyme digestion, and finally construct a circAars overexpression plasmid.

[0047] S3. Virus solution encapsulating circAars overexpression plasmid: by using Lenti-Pac TM An HIV lentiviral packaging kit was used to transfect the circAars overexpression plasmid into 293T cells and package the resulting viral fluid. Lentivirus, as a highly efficient gene delivery tool, can stably introduce the circAars gene into ADSCs. S3 further includes the following steps: transfecting the constructed circAars overexpression plasmid into 293T cells, culturing them for 24 hours, collecting the viral fluid, and filtering it through a membrane to remove impurities.

[0048] S4. Construction of circAars-modified ADSCs: Finally, gene modification was completed by transfecting the viral solution containing the circAars overexpression plasmid into ADSCs.

[0049] S4 further includes the following steps: S41. Transfecting the collected viral fluid into ADSCs to ensure an infection rate of over 70%; S42. Changing the culture medium after 24 hours of culture and adding puromycin for resistance screening until purified circAars-modified ADSCs are obtained. The above steps describe in detail the entire process from ADSC extraction to the successful construction of circAars-modified ADSCs. This technology significantly enhances the osteogenic capacity of ADSCs, providing strong technical support for their application in bone defect repair and regenerative medicine. This process is efficient, reliable, and has strong clinical application prospects.

[0050] The present invention provides ADSCs modified with the circAars gene and their use in tissue engineering and regenerative medicine. ADSCs are a type of stem cell isolated from adipose tissue that possesses strong self-renewal capacity and multidirectional differentiation potential, capable of differentiating into various cell types, including osteoblasts, chondrocytes, and adipocytes. These cells have broad application prospects in tissue repair and regenerative medicine. Through the genetic modification methods of the present invention, particularly the introduction of the circAars gene, the osteogenic capacity of adipose-derived mesenchymal stem cells is significantly enhanced, making their application in bone tissue engineering, tissue repair, and regenerative medicine even more effective.

[0051] In tissue engineering, the application of ADSCs is mainly concentrated in bone repair, cartilage repair and skin regeneration. Through the technology of the present invention, ADSCs can quickly differentiate in damaged tissues and form new tissues, thereby accelerating the repair of damaged areas. Especially in the repair of bone defects, ADSCs modified with the circAars gene exhibit excellent osteogenesis, which can effectively promote the formation of bone matrix and accelerate the bone healing process. In the field of regenerative medicine, ADSCs are widely used in regenerative therapy, especially for various clinical diseases such as bone injury, articular cartilage injury, heart disease, and nervous system injury. ADSCs can help repair defective bone tissue by injection or implantation.

[0052] Experimental Verification and Application Effects: To verify the improvement in the osteogenic capacity of ADSCs modified with circAars genes, a series of experiments were designed and conducted in this Example. The main purpose of the experiment was to evaluate the effect of circAars gene modification on ADSCs, especially its application in bone defect repair. We verified the feasibility and effectiveness of the circAars gene modification method through the following experimental steps, and comprehensively evaluated the osteogenic capacity of the modified ADSCs under different conditions through methods such as ALP activity, Alizarin Red staining, qRT-PCR, and Western blot.

[0053] Example 1: Construction of circAars gene overexpression vector.

[0054] 1. circAars sequence:

[0055] Ggaatctgatggtgttctgaaacctctccccaagaaaagcattgacacagggatgggcctggagagattggtgtctgt

[0056] gctgcagaacaagatgtccaactatgacactgaccttttcgttccttacttcgaagccattcagaagggtacaggcgccc

[0057] ggccgtatactgggaaggttggtgctgaggacactgatggaattgacatggcctacagggttctggctgaccacgccc

[0058] ggaccatcactgtggcgctggctgatggcgggcgacctgacaacacaggtcgggggtatgtgctgagacggatcctt

[0059] cgccgagctgttcgctattcccacgagaaactgaacgccagcaggggtttcttcgccacattagttgatgttgtcgttca

[0060] atccctggggagacgcctttcctgagctgaagaaggacccagatatggtgaaggacatcattaatgaagaagaggtaca

[0061] gtttctcaagactctcagcagagggcggcgcatcctggaccggaaaattcagagcttaggagactgccaaaccatcccag.

[0062] 2. Amplification primer sequence:

[0063] circAars-F:

[0064] 5'-ATTTCTCTTTCGAATTCTGGAATCTGATGGTGTTCTGAAAC-3'

[0065] circAars-R5'-GTTGTTAGCTAGGATCCCTGGGATGGTTTGGCAGTCTCCTAA-3'

[0066] 3. PCR to obtain genes: 1> Template cDNA preparation

[0067] 3.1. Total RNA Extraction 1) Collect rat tissue by centrifugation, grind in liquid nitrogen, add 1 ml of Trizol solution (Invitrogen), transfer to an RNase-free EP tube, allow the tissue to fully lyse, and let it stand for 5 min. 2) Add 200 μl of chloroform, shake vigorously for 30 s to allow the aqueous and organic phases to fully contact, and let it stand at room temperature for 15 min. 3) Centrifuge at 10,000 g for 15 min at 4°C. Three layers will be visible, with RNA in the upper aqueous phase. Transfer to a new RNase-free EP tube. 4) Precipitate RNA: Add 0.5 ml of isopropanol, mix gently and thoroughly, and let it stand at room temperature for 10 min. 5) Centrifuge at 10,000 g for 10 min at 4°C, collect the RNA precipitate, and discard the supernatant. 6) Wash twice with 75% ethanol and air dry in a clean hood. 7) Dissolve the precipitate in 15-50 μl of DEPC water.

[0068] 3.2. Total RNA purity and integrity test: 1) Purity test: 1 μl RNA sample was diluted 50 times and analyzed by Beckman Coulter Measure the OD value on a 520 UV / Vis spectrophotometer. A ratio of OD260 / OD280 greater than 1.8 indicates that the prepared RNA is relatively pure and free of protein contamination. 2) Total RNA integrity test: 1 μl of RNA sample is subjected to electrophoresis on a 1% agarose gel at 80 V for 20 minutes. After staining with EB for 10 minutes, use a gel imaging system to visualize the 5s rRNA, 18s rRNA, and 28s rRNA bands in the total RNA. The presence of all three bands confirms that the total RNA extraction is relatively complete.

[0069] 3.3. PCR amplification and detection after reverse transcription

[0070] 1) Prepare the following solutions in an RNase-free PCR tube:

[0071]

[0072] 2) Pipette the solution evenly and incubate at 65°C for 5 minutes to denature the RNA. Immediately chill on ice to prevent RNA renaturation.

[0073] 3) Add the following reagents (Promega) to the PCR tube:

[0074]

[0075] 4) Incubate the above 20 μl reaction solution at 30°C for 10 min; at 42°C for 60 min; at 72°C for 10 min; and finally store at -20°C.

[0076] 5) PCR reaction system: Prepare the following system in a 0.2 mL EP tube. Dilute the template stock solution 20-fold and take 0.5 μL to amplify circAars:

[0077]

[0078] Note: KOD Plus Neo DNA Polymerase was purchased from Toyobo Co., Ltd., product number: KOD 401;

[0079] 6) Amplification conditions: After mixing, place the mixture in a GeneAmp PCR System 2400 PCR amplifier for amplification. Amplification conditions for the circAars gene:

[0080]

[0081] 7) PCR product recovery (DNA gel recovery kit)

[0082] After electrophoresis of the PCR product on a 1% gel, excise the gel band containing the target gene fragment under UV light with a scalpel and transfer it to a clean 1.5 mL EP tube. After weighing, add Solution BD to the centrifuge tube at a ratio of 100 mg of gel to 100 μL of Solution BD. Incubate in a 60°C water bath for 10 minutes until the gel is completely dissolved, vortexing three times during the incubation period. Transfer the solution to a DNA purification column, let it stand for 2 minutes, and centrifuge at 12,000 rpm for 1 minute at room temperature. Discard the filtrate. Add 500 μL of Solution PE to the column, centrifuge at 12,000 rpm for 1 minute at room temperature, and discard the filtrate. Repeat this process once. Centrifuge the empty column at 12,000 rpm for 1 minute at room temperature to completely remove any residual liquid from the purification column. Place the column in a new 1.5 mL EP tube, add 30 μL of sterile water preheated at 60°C to the center of the column, and centrifuge at 13,400 g for 1 minute to elute the DNA.

[0083] 8) Analysis of results: The circAars PCR amplification product (551 bp) was amplified using the template, and the size of the circAars gene was consistent with the prediction (the amplified band was approximately 500 bp from the marker), confirming that the circAars target gene was amplified.

[0084] 4. Double enzyme digestion of vector: In a sterile 0.2 mL EP reaction tube, take 15 μL of PLC5-CIR vector and double digest with EcoRI / BamHI respectively. The enzyme digestion system is as follows:

[0085] Product (PLC5-CIR) 15 μL EcoRI 1.5 μL BamHI 1.5 μL 10×buffer 5μL ddH2O 27 μL Total 50μL

[0086] After mixing, react at 37°C for about 3 hours.

[0087] 5. Recovery of enzyme digestion products (DNA gel recovery kit): 1) After 1% gel electrophoresis of the enzyme digestion products, use a scalpel to cut out the gel bands containing the target fragment and the vector respectively under UV light and place them into a clean 1.5 mL EP tube. Add solution BD to the centrifuge tube at a ratio of 100 mg gel to 100 μL solution BD. 2) Incubate in a 60°C water bath for 10 minutes until the gel is completely dissolved. Oscillate and mix three times during the water bath. 3) Transfer the solution to a DNA purification column, let it stand for 2 minutes, centrifuge at 12,000 rpm at room temperature for 1 minute, and discard the filtrate. 4) Add 500 μL solution PE to the column, centrifuge at 12,000 rpm at room temperature for 1 minute, and discard the filtrate. 5) Repeat the previous operation once. 6) Centrifuge the empty column at 12,000 rpm for 1 minute to completely remove the residual liquid in the purification column. 7) Place the column in a new 1.5 mL EP tube, add 30 μL of sterile water preheated at 60°C to the center of the column, and centrifuge at 13,400 g for 1 min to elute the DNA.

[0088] 6. Ligation of target fragment and vector: Add the following reagents to a 0.2 mL EP tube (homologous recombination enzyme purchased from Novozymes, catalog number: C113-01)

[0089] Recovered PCR products (circAars) 4μL Vector (PLC5-CIR) recovered by enzyme digestion 3μL 5×CE MultiS Buffer 4μL Exnase MultiS 2μL ddH2O XμL Total 20 μL

[0090] Incubate at 37°C for 30 min; then cool to 4°C or immediately place on ice.

[0091] 7. Transformation of Ligation Product: 1) Add 10 μL of ligation product to 50 μL of DH5α competent cells on ice. Gently swirl to mix, and incubate on ice for 30 minutes. 2) Heat shock in a 42°C water bath for 90 seconds. 3) Quickly transfer the tube to an ice bath and incubate on ice for 2 minutes. 4) Add 200 μL of LB medium to each tube, mix, and incubate at 37°C, 200 rpm, with shaking, for 1 hour. 5) In a laminar flow hood, spread the bacterial solution evenly onto an LB plate containing ampicillin (100 μg / mL) and allow to stand at room temperature until the liquid is absorbed. 6) Invert the plate and transfer to a 37°C biochemical incubator for overnight incubation.

[0092] 8. Identification of positive clones by plasmid enzyme digestion:

[0093] 1> Pick several single clones from the plate and culture them in a 3 mL LB tube on a shaker overnight;

[0094] 2>Plasmid extraction, (high-purity plasmid small-scale extraction kit, G-SHUN)

[0095] 1) Collect 3 μL of bacterial suspension in a 1.5 mL EP tube, centrifuge at 12,000 rpm for 1 minute, and discard the supernatant. 2) Add 250 μL of Solution I / RNase A mixture to resuspend the cells. Add 250 μL of Solution II, gently invert and mix six times, and let stand at room temperature for 2 minutes. 3) Add 350 μL of Solution III, gently invert and mix six times. Centrifuge at 12,000 rpm for 10 minutes, carefully aspirate the supernatant, transfer it to a DNA purification column, and let it stand for 2 minutes. 4) Centrifuge at 12,000 rpm for 1 minute, and discard the filtrate. Add 500 μL of Solution PB to the column, centrifuge at 12,000 rpm for 1 minute, and discard the filtrate. 5) Add 500 μL of Solution W to the column, centrifuge at 12,000 rpm for 1 minute, and discard the filtrate. Repeat this process once. Centrifuge the empty column at 12,000 rpm for 3 minutes. 6) Remove the column and place it in a new 1.5 mL EP tube. Add 50 μL of sterile water (preheated at 60°C), let it stand for 2 minutes, and centrifuge at 13,400 rpm for 1 minute to elute the plasmid.

[0096] 3> Enzyme digestion identification of the extracted plasmid, the enzyme digestion reaction system is as follows:

[0097] Extracted plasmid circAars 3μL BamHI 0.5μL 10×buffer 1 μL ddH2O 5.5 μL Total 10 μL

[0098] The digested products were separated by electrophoresis on 1% agarose gel containing ethidium bromide (EB) and imaged with UVP gel imaging system. Figure 2 The results are as follows: Fig. 2: Lane M1: DL2000 DNA Marker; Lane 1: Products of CIRCAARS-1 plasmid digestion; Lane 2: Products of CIRCAARS-2 plasmid digestion; Lane 3: Products of CIRCAARS-3 plasmid digestion; Lane M2: 1kb DNA Marker; Analysis of digestion results: CIRCAARS (551bp) was digested with BamHI alone, and a band of about 250bp was cut out at the corresponding position (indicated by the red arrow), indicating that it was a positive clone screened out, and the CIRCAARS positive plasmid was sent for sequencing.

[0099] 9. Blast comparison of sequencing results: Figure 3

[0100] BLAST analysis of sequencing results: The circAars gene was successfully cloned into the PLC5-CIR vector and was 100% consistent with the known sequences in NCBI by BLAST analysis. Therefore, it can be used for subsequent experiments.

[0101] Example 2: A method for synthesizing circAars-engineered ADSCs, comprising the following steps:

[0102] S1. Extraction of ADSCs: The adipose tissue of the inguinal fat pad of SD rats was cut into small pieces, digested with 0.1% collagenase I at 37°C, shaken every 10 minutes, filtered with a 100μm filter, and the separated cells were cultured with complete growth medium containing (DMEM / F12), 10% fetal bovine serum and 1% double antibody. The culture medium was replaced every 2-3 days until the cells reached 90% confluence. The characteristics of ADSCs were determined as we described before. In short, when the cells reached 90% confluence, they were induced to differentiate in multiple directions using osteogenic medium (OM) or adipogenic medium. Flow cytometry was used to detect the CD29, CD44, CD45 and CD34 markers of ADSCs. The identification results of ADSCs refer to Figure 1 .

[0103] S2. Synthesize circAars overexpression plasmid according to the method of Example 1 above:

[0104] S3. Virus solution coated with circAars overexpression plasmid: Lenti-Pac TMTransfect 293T cells using an HIV lentiviral packaging kit, and collect the viral fluid by centrifugation 24 hours later. S4. Construct circAars-modified ADSCs: ADSCs were seeded in a 6-well plate and transfected with the viral fluid collected in step S3. The medium was changed, and the transfected ADSCs were purified using puromycin. S5. Verify the osteogenic capacity of circAars-modified ADSCs: The stably transfected ADSCs cell line constructed in step S4 was tested for osteogenic capacity using ALP, Alizarin Red, qRT-PCR, and Western blot.

[0105] Test Example 1: qPCR was performed on the cells obtained in Example 2 to detect the efficiency of circAars overexpression in ADSCs. Control group: The extraction protocol of Example 2 was adopted, wherein the control group was a circAars overexpression plasmid blank group; the results are shown in Table 1 below:

[0106]

[0107] Table 1

[0108] Also refer to Figure 5 ,from Figure 5 The test data in the study show that the expression of circAars in ADSCs engineered with the circAars method was enhanced by 12-fold. When circAars were silenced using small molecules (si-circAars), the expression of circAars in the cells was significantly suppressed, with si-circAars-1 being the most prominent.

[0109] Test Example 2: Detection of the Osteogenic Ability of CircAars-engineered ADSCs

[0110] Objective: To investigate the effects of circAars-modified ADSCs on osteogenic capacity and to assess the regulatory effects of circAars modification on osteogenic differentiation, mineralization, and the expression of related genes and proteins. Experimental Design: This study compared circAars-modified ADSCs with unmodified ADSCs (control group). The experiment was divided into two groups: a circAars-modified group and a circAars-overexpressing ADSCs group. The control group consisted of unmodified ADSCs.

[0111] Experimental steps, ALP activity detection: ALP kit (Nanjing Jiancheng Biology) was used according to the manufacturer's instructions to determine the ALP activity in the cell culture medium. The results were expressed as ALP activity (unit: U / mg protein), and the data were statistically analyzed by repeating the experiment three times. Mineralization capacity assessment: After the cells were cultured in osteogenic induction medium for 28 days, the mineralized crystals were stained using the Alizarin red staining method, and semi-quantitative analysis was performed using hexadecylpyridinium chloride. Gene expression analysis: Total RNA of the cells was extracted, and the expression of osteogenesis-related genes (such as Runx2, ALP, OCN, etc.) was detected using qRT-PCR. Use 2 -ΔΔCT The data were analyzed by Western blot and the relative changes of gene expression between the circAars modified group and the control group were calculated. Protein expression analysis: The expression levels of osteoblast-related proteins (such as Runx2, OCN, ALP, etc.) were analyzed by Western blot. Figure 6 It can be seen that the ALP activity of ADSCs increased after circAars modification ( Figure 6 AB), enhanced mineralization capacity ( Figure 6 CD), osteogenesis-related genes BMP-2, RUNX2, OPN, SMAD5 and OCN ( Figure 6 E) and the expression of osteoblast-related proteins ALP, β-catenin, RUNX2, OCN and SMAD5 were upregulated ( Figure 6 FG), however, knockdown of circAars in ADSCs (si-circAars) had the opposite result, indicating that circAars was positively correlated with the osteogenic effect in ADSCs, and the osteogenic ability of ADSCs modified by overexpression of circAars was significantly enhanced.

[0112] To verify the therapeutic effect of circAars-engineered ADSCs in repairing maxillofacial bone defects, we established a critical-size skull defect model in rats and implanted circAars-overexpressing ADSCs into the skull defect model in SD rats using Gelma hydrogel as a carrier. We measured various indicators ( Figure 7 A). Hydrogels loaded with simple ADSCs are designated the Gel group; hydrogels loaded with blank circAars-modified ADSCs are designated the NC / Gel group; and hydrogels loaded with overexpressed circAars-modified ADSCs are designated the OE-circAars / Gel group. Micro-CT reconstruction and analysis of new bone regeneration revealed a significant increase in new bone formation in the OE-circAars / gel group ( Figure 7B). Quantitative analysis showed that the BV / TV of Gel was 0.098±4.30%, that of NC / Gel sample was 0.044±2.00%, and that of OE-circAars / Gel sample (0.653±11.90%) was significantly increased (p<0.05) ( Figure 7 C). The BMD of the Gel group was 750.16±28.36, the BMD of the NC / Gel group was 751.25±21.48, and the BMD of the OE-circAars / Gel group was higher (848.51±4.29) (p<0.05) ( Figure 7 D). Th parameter analysis also showed consistent results ( Figure 7 E). HE staining showed that compared with the NC / Gel group, OE-circAars / Gel significantly promoted new bone volume and had a denser bone structure ( Figure 7 F). Figure 7 As shown in the Masson staining results of G, OE-circAars / Gel significantly promoted the formation of collagen fibers in ADSCs compared with the NC / Gel group. Figure 7 As shown in HI, the results of immunofluorescence staining showed that compared with the NC / Gel group, the positive expression rate of Runx2, an osteogenesis-related marker, in the new bone area of ​​ADSCs in OE-circAars / Gel was significantly increased.

[0113] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. Adipose-derived mesenchymal stem cells, characterized in that: The ADSCs are stem cells modified by circAars gene.

2. A method for preparing adipose-derived mesenchymal stem cells, applied to the adipose-derived mesenchymal stem cells according to claim 1, characterized in that: The following steps are involved: S1. Extract ADSCs; S2. Synthesize circAars overexpression plasmid; S3. Extract viral fluid of circAars overexpression plasmid; S4. Construct circAars-modified ADSCs.

3. The method for preparing adipose-derived mesenchymal stem cells according to claim 2, characterized in that: S1 further comprises the following steps: S11, extract adipose tissue from the inguinal fat pad of SD rats; S12, digest the adipose tissue using 0.1% collagenase I at 37°C, shaking every 10 minutes, the digestion time is 30 to 90 minutes, and collect the cells after filtration; S13, inoculating the cells in a medium containing DMEM / F12 medium, 10% fetal bovine serum and 1% double antibody and culturing until the cells reach 90% confluence; S14. Flow cytometry was used to detect ADSCs markers CD29, CD44, CD45 and CD34, as well as osteogenic and adipogenic multidirectional differentiation induction to confirm that the extracted cells were adipose-derived mesenchymal stem cells.

4. The method for preparing adipose-derived mesenchymal stem cells according to claim 2, characterized in that: The S2 further comprises the following steps: S21. Extract total RNA: collect tissue from adipose tissue by centrifugation, grind with liquid nitrogen, add 1 ml Trizol solution to fully lyse the tissue, and let it stand for 5 minutes; add 200 μl chloroform, shake vigorously to mix, let it stand for 15 minutes, and collect RNA aqueous phase after centrifugation; add 0.5 ml isopropanol to precipitate RNA, let it stand for 10 minutes, wash the RNA precipitate after centrifugation, and dissolve it in DEPC water. S22. Detect the purity and integrity of total RNA: Use UV spectrophotometry to detect the OD260 / OD280 ratio to ensure that the RNA purity is greater than 1.8; use agarose gel electrophoresis to detect the integrity of the 28s, 18s, and 5s bands of RNA. S23. Perform reverse transcription reaction: prepare a reaction system containing total RNA, oligo(dT), random primers, dNTP, RNase inhibitor, buffer and M-MLV reverse transcriptase; incubate at 30°C for 10 minutes, 42°C for 60 minutes and 72°C for 10 minutes to obtain cDNA. S24. Amplify the circAars gene using PCR: prepare the PCR system, including 2 mM dNTP, 10× KOD buffer, 25 mM MgSO4, primers and KOD DNA polymerase; set the amplification conditions as follows: pre-denaturation at 94°C for 1 min; 98°C for 15 s, 58°C for 15 s, 68°C for 1 min, for a total of 30 cycles; after amplification, detect and recover the target fragment by agarose gel electrophoresis. S25. Connect the circAars gene fragment to the vector: Use EcoRI and BamHI to double-digest the vector and the amplified product, and perform a ligation reaction; transform the ligation product into competent cells, select positive clones and identify them through enzyme digestion, and finally construct a circAars overexpression plasmid.

5. The method for preparing adipose-derived mesenchymal stem cells according to claim 2, characterized in that: The S3 further includes the following steps: using the Lenti-PacHIV lentiviral packaging kit to transfect the circAars overexpression plasmid into 293T cells; after culturing at 37° C. for 24 hours, collecting the virus solution and filtering it through a filter membrane to remove impurities.

6. The method for preparing adipose-derived mesenchymal stem cells according to claim 2, characterized in that: The S4 further includes the following steps: S41, transfecting the collected virus solution into ADSCs cells to ensure that the infection rate reaches more than 70%; S42, replacing the culture medium after culturing for 24 hours, and adding puromycin for resistance screening until purified circAars-modified ADSCs are obtained.

7. An application of adipose-derived mesenchymal stem cells, comprising adipose-derived mesenchymal stem cells prepared by the method for preparing adipose-derived mesenchymal stem cells according to claims 2-6, characterized in that: The adipose-derived mesenchymal stem cells are used for bone tissue engineering.

Images