Method for modifying immune cells and application thereof

Abstract

The invention discloses a method for modifying immune cells and application thereof. The invention provides a method for modifying immune cells, which comprises the following steps: loading immunomodulatory molecules on the surfaces of extracellular vesicles, and incubating the extracellular vesicles loaded with the immunomodulatory molecules with to-be-modified immune cells to obtain modified immune cells. The use of extracellular vesicles to deliver immunomodulatory molecules is safe, low in immunogenicity, and free of cytotoxicity and gene integration risk. In addition, the outer vesicles loaded with the immunomodulatory molecules on the surface can be directly used for delivering the immunomodulatory molecules to immune cells in vivo to form a somatic cell treatment product. The invention is of great significance to cellular immunotherapy.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a method for modifying immune cells and its application. Background Art

[0002] In recent years, tumor immunotherapy has developed rapidly and has become the fourth major tumor treatment option after surgery, radiotherapy, and chemotherapy. Tumor immunotherapy includes immune checkpoint inhibitors, therapeutic antibodies, cancer vaccines, and cell therapy, etc. As a representative of the immune checkpoint inhibitor treatment strategy, anti-PD-1 monoclonal antibody has been approved for multiple tumor indications and has continuously updated the standard treatment plan, while cell therapy has significant efficacy in hematological tumors. Currently, nearly ten cell immunotherapy products have been approved for marketing globally, establishing the position of cell therapy in the treatment of various hematological malignancies.

[0003] The treatment strategy of cell products is to genetically engineer human immune cells to load and modify them with CAR, and then reinfuse them into the patient's body. The immune cells expressing CAR can recognize and eliminate tumor cells expressing the corresponding antigen to achieve the goal of treating tumors. Currently, the commonly used genetic engineering method uses a viral CAR construct, and the viral CAR construct uses a virus such as AAV or lentivirus as a vector. However, due to its immunogenicity, cytotoxicity, and / or integration characteristics, the virus has safety risks.

[0004] Therefore, providing a safe immune cell modification strategy has become an urgent technical problem for those skilled in the art. Summary of the Invention

[0005] The object of the present invention is to provide a method for modifying immune cells.

[0006] In the first aspect, the present invention claims to protect a method for modifying immune cells.

[0007] The method for modifying immune cells claimed by the present invention may include the following steps: loading an immune regulatory molecule on the surface of extracellular vesicles, and then incubating the obtained extracellular vesicles loaded with the immune regulatory molecule with the immune cells to be modified to obtain modified immune cells.

[0008] Further, the extracellular vesicles may be exosomes or nanovesicles.

[0009] In a specific embodiment of the present invention, the immune regulatory molecule is CAR (i.e., chimeric antigen receptor), an antibody targeting a tumor antigen and / or an immune checkpoint, and / or an active fragment thereof.

[0010] Further, the antibody and / or its active fragment binds to, for example, CTLA-4, PD-1, or PD-L1.

[0011] Further, the immune cells to be modified can be selected from one or more of T cells, NK cells, NKT cells, mast cells, monocytes, macrophages, dendritic cells, CIK cells, and immune effector cells derived from stem cells.

[0012] Exemplarily, the immune cells to be modified are monocytes and / or macrophages, and the modified immune cells are macrophages.

[0013] Further, loading the immunomodulatory molecule on the surface of the extracellular vesicles can be achieved by a method including the following steps: modifying the producer cells with the immunomodulatory molecule (such as CAR), and preparing extracellular vesicles loaded with the immunomodulatory molecule (such as CAR) from the obtained modified producer cells.

[0014] In a second aspect, the present invention claims a method for preparing an anti-tumor drug.

[0015] The method for preparing the anti-tumor drug claimed by the present invention may include the following step (A1):

[0016] (A1) Loading an immunomodulatory molecule on the surface of extracellular vesicles, and the obtained extracellular vesicles loaded with the immunomodulatory molecule are the anti-tumor drug.

[0017] Further, the preparation method may further include the following step (A2):

[0018] (A2) Incubating the extracellular vesicles loaded with the immunomodulatory molecule obtained in (A1) with the immune cells to be modified to obtain modified immune cells; the modified immune cells are the anti-tumor drug.

[0019] Further, the extracellular vesicles can be exosomes or nanovesicles.

[0020] In a specific embodiment of the present invention, the immunomodulatory molecule is CAR (i.e., chimeric antigen receptor), an antibody targeting a tumor antigen and / or an immune checkpoint, and / or an active fragment thereof.

[0021] Further, the antibody and / or its active fragment binds to, for example, CTLA-4, PD-1, or PD-L1.

[0022] Further, the immune cells to be modified can be selected from one or more of T cells, NK cells, NKT cells, mast cells, monocytes, macrophages, dendritic cells, CIK cells, and immune effector cells derived from stem cells. Exemplarily, the immune cells to be modified are monocytes and / or macrophages.

[0023] Further, loading the immunomodulatory molecule on the surface of the extracellular vesicle can be achieved by a method comprising the following steps: modifying a producer cell with the immunomodulatory molecule (such as CAR), preparing extracellular vesicles loaded with the immunomodulatory molecule (such as CAR) from the obtained modified producer cell, and optionally isolating the obtained extracellular vesicles.

[0024] Wherein, the producer cell is any cell capable of isolating extracellular vesicles. In a specific embodiment of the present invention, the producer cell is a 293T cell.

[0025] In a third aspect, the present invention claims any one of the following applications:

[0026] (B1) The application of extracellular vesicles in the preparation of anti-tumor drugs; the surface of the extracellular vesicles is loaded with an immunomodulatory molecule.

[0027] (B2) The application of extracellular vesicles and / or modified immune cells in the preparation of anti-tumor drugs; the surface of the extracellular vesicles is loaded with an immunomodulatory molecule; the modified immune cells are obtained by incubating the extracellular vesicles loaded with the immunomodulatory molecule with the immune cells to be modified.

[0028] Further, the extracellular vesicles can be exosomes or nanovesicles.

[0029] In a specific embodiment of the present invention, the immunomodulatory molecule is CAR (i.e., chimeric antigen receptor), an antibody targeting a tumor antigen and / or an immune checkpoint, and / or an active fragment thereof.

[0030] Further, the antibody and / or its active fragment binds to, for example, CTLA-4, PD-1 or PD-L1.

[0031] Further, the immune cells to be modified can be selected from one or more of T cells, NK cells, NKT cells, mast cells, monocytes, macrophages, dendritic cells, CIK cells, and immune effector cells derived from stem cells; preferably, the immune cells are monocytes or macrophages.

[0032] Further, loading the immunomodulatory molecule on the surface of the extracellular vesicle can be achieved by a method comprising the following steps: modifying a producer cell with the immunomodulatory molecule (such as CAR), preparing extracellular vesicles loaded with the immunomodulatory molecule (such as CAR) from the obtained modified producer cell, and optionally isolating the obtained extracellular vesicles.

[0033] Wherein, the producer cell is any cell capable of isolating extracellular vesicles. In a specific embodiment of the present invention, the producer cell is a 293T cell.

[0034] Fourth aspect, the present invention claims protection for any of the following methods:

[0035] (C1) A method for inducing the differentiation of monocytes into macrophages, which may include the following steps: loading CAR on the surface of extracellular vesicles, and then incubating the obtained extracellular vesicles loaded with CAR with monocytes to obtain macrophages.

[0036] (C2) A method for preparing CAR - macrophages, which may include the following steps: loading CAR on the surface of extracellular vesicles, and then incubating the obtained extracellular vesicles loaded with CAR with monocytes and / or macrophages, and the obtained CAR - positive macrophages are CAR - macrophages.

[0037] (C3) A method for preparing an in - vivo CAR - macrophage drug, which may include the following steps: loading CAR on the surface of extracellular vesicles, and the obtained extracellular vesicles loaded with CAR will deliver CAR to monocytes and / or macrophages in vivo, and the obtained CAR - positive macrophages are the in - vivo CAR - macrophage drug.

[0038] Further, in (C1), the macrophages contain (or are mainly) M1 - type macrophages.

[0039] Macrophages are the first responders of the human body to viral infections and are considered a potential direction for cell therapy. Tumor - associated macrophages (TAMs) are generally divided into pro - inflammatory M1 - type macrophages or anti - inflammatory M2 - type macrophages. M1 - type macrophages are induced by Toll - like receptor ligands or Th1 cytokines, have high antigen - presenting ability, and are associated with bactericidal and pro - inflammatory activities. Therefore, they are called "fighting" macrophages and are associated with a good prognosis for cancer. For cancer, M1 - type macrophages can target tumors and phagocytose cancer cells.

[0040] In the above - mentioned methods, the extracellular vesicles can be exosomes or nanovesicles.

[0041] Further, loading CAR on the surface of the extracellular vesicles can be achieved by the following method including the following steps: modifying producer cells with CAR, and preparing extracellular vesicles loaded with CAR using the obtained modified producer cells as the source.

[0042] Among them, the producer cells are any cells capable of isolating extracellular vesicles. In the specific embodiments of the present invention, the producer cells are 293T cells.

[0043] In the above aspects, the CAR specifically used in the specific embodiments of the present invention is the third-generation CAR, targeting GPC3. The CAR sequentially includes the following parts: CD8α signal peptide, GPC3 scFv, CD8α hinge region, CD8α transmembrane region, CD28 co-stimulatory domain, 4-1BB co-stimulatory domain, and CD3ζ intracellular domain.

[0044] Specifically, the amino acid sequence of the CAR is SEQ ID No.2. The coding sequence corresponding to SEQ ID No.2 is SEQ ID No.1, which sequentially includes the following parts: CD8α signal peptide coding sequence (SEQ ID No.3), GPC3 scFv (YP7) coding sequence (SEQ ID No.4), CD8α hinge region coding sequence (SEQ ID No.5), CD8α transmembrane region coding sequence (SEQ ID No.6), CD28 co-stimulatory domain coding sequence (SEQ ID No.7), 4-1BB co-stimulatory domain coding sequence (SEQ ID No.8), and CD3ζ intracellular domain coding sequence (SEQ ID No.9).

[0045] In a fifth aspect, the present invention claims to protect a modified immune cell.

[0046] The modified immune cell claimed by the present invention is prepared by the method described in the first aspect above.

[0047] In a sixth aspect, the present invention claims to protect an anti-tumor drug.

[0048] The anti-tumor drug claimed by the present invention is prepared by the method described in the second aspect or the (C3) in the fourth aspect above.

[0049] The present invention loads an immunomodulatory molecule on the surface of extracellular vesicles, and then incubates the obtained extracellular vesicles loaded with the immunomodulatory molecule with the immune cells to be modified to obtain modified immune cells. Using extracellular vesicles to deliver immunomodulatory molecules is safe, has low immunogenicity, and has no risk of cytotoxicity and gene integration. Moreover, extracellular vesicles with immunomodulatory molecules loaded on the surface can be directly used for in vivo delivery of immunomodulatory molecules to immune cells to form in vivo cell therapy products. The present invention is of great significance for cell immunotherapy.

[0050] In the present invention, cells are subjected to plasmid transfection, virus transfection, etc. to make the cells express CAR, and then extracellular vesicles are prepared. CAR is loaded on the surface of the extracellular vesicles, and then the extracellular vesicles are incubated with immune cells to form modified immune cells. The delivery of CAR using extracellular vesicles is safe, has low immunogenicity, and has no risk of cytotoxicity and gene integration. Moreover, extracellular vesicles with CAR loaded on the surface can be directly used for in vivo delivery of CAR to immune cells, forming an in vivo cell therapy product, which solves the problem that the in vitro preparation cycle of cell therapy products is relatively long and difficult to meet the acute needs of patients. The efficiency of delivering CAR to monocytes / macrophages by extracellular vesicles is higher than that of delivering to other immune cells, and can activate monocytes / macrophages to transform into M1 macrophages, which has a good killing effect on tumor cells and can inhibit tumor growth in a mouse in vivo model. Description of the Drawings

[0051] Figure 1 It is a graph of the CAR positive rate of cells in each group of Example 3, **P < 0.01 vs CAR-lentivirus-THP-1 group, #P < 0.05 vs CAR-NV-T group, @P < 0.05 vs CAR-EV-T group.

[0052] Figure 2 It is a graph of the killing rate of tumor cells by cells in each group of Example 4, **P < 0.01 vs CAR-lentivirus-THP-1 group.

[0053] Figure 3 It is a graph of the relative expression level of CD14 mRNA in cells in each group of Example 6, **P < 0.01 vs THP-1 group, ##P < 0.01 vs CAR-GPC3 THP-1 group.

[0054] Figure 4 It is a graph of the relative expression level of CD11b mRNA in cells in each group of Example 6, **P < 0.01 vs THP-1 group.

[0055] Figure 5 It is a graph of the relative expression level of CD86 mRNA in cells in each group of Example 6, **P < 0.01 vs THP-1 group, ##P < 0.01 vs CAR-GPC3 THP-1 group.

[0056] Figure 6 It is a graph of the relative expression level of CD206 mRNA in cells in each group of Example 6, **P < 0.01 vs THP-1 group, ##P < 0.01 vs THP-1@CAR NVs group. Detailed Embodiments

[0057] Definition:

[0058] As used herein, the term "extracellular vesicle" refers to vesicles of cellular origin that contain a membrane enclosing an internal space. Extracellular vesicles include all membrane-bound vesicles that are smaller in diameter than the cells from which they are derived. Typically, extracellular vesicles have a diameter ranging from 20 nm to 1000 nm and can include within their internal space, display on their outer surface, and / or span the membrane various cargoes. The cargoes can include nucleic acids, proteins, carbohydrates, lipids, small molecules, and / or combinations thereof. By way of example and not limitation, extracellular vesicles include apoptotic bodies, cell debris, vesicles derived from cells by direct or indirect manipulation (e.g., by successive extrusion or treatment with an alkaline solution), vesicularized organelles, and vesicles produced by living cells (e.g., by direct plasma membrane budding or fusion of late endosomes with the plasma membrane). Extracellular vesicles can be derived from living or dead organisms, explanted tissues or organs, and / or cultured cells.

[0059] As used herein, the term "exosome" refers to small vesicles of cellular origin (having a diameter between 20 - 300 nm, more preferably between 40 - 200 nm) that contain a membrane enclosing an internal space and are produced from cells by direct plasma membrane budding or fusion of late endosomes with the plasma membrane. Exosomes are a type of extracellular vesicle. Exosomes contain lipids or fatty acids and polypeptides and can also contain a payload (e.g., a therapeutic agent), a targeting moiety, polynucleotides (e.g., nucleic acids, RNA, or DNA), sugars (e.g., simple sugars, polysaccharides, or glycans), or other molecules. Exosomes can be derived from producer cells and isolated from the producer cells based on their size, density, biochemical parameters, or combinations thereof.

[0060] As used herein, the term "nanovesicle" refers to small vesicles of cellular origin (having a diameter between 20 - 250 nm, more preferably between 30 - 150 nm) that contain a membrane enclosing an internal space and are produced from cells by direct or indirect manipulation such that the nanovesicles would not be produced by the producer cells without the manipulation. Suitable manipulations of the producer cells include, but are not limited to, successive extrusion, treatment with an alkaline solution, sonication, or combinations thereof. In some cases, the production of nanovesicles can result in the disruption of the producer cells. Preferably, the population of nanovesicles is substantially free of vesicles derived from the producer cells by direct plasma membrane budding or fusion of late endosomes with the plasma membrane. Nanovesicles are a type of extracellular vesicle. Nanovesicles contain lipids or fatty acids and polypeptides and optionally contain a payload (e.g., a therapeutic agent), a targeting moiety, polynucleotides (e.g., nucleic acids, RNA, or DNA), sugars (e.g., simple sugars, polysaccharides, or glycans), or other molecules. Once nanovesicles are derived from producer cells according to the manipulation, the nanovesicles can be isolated from the producer cells based on their size, density, biochemical parameters, or combinations thereof.

[0061] As used herein, the term "immune cell" refers to cells of the immune system, which can be classified as lymphocytes (e.g., T cells, B cells, and NK cells), neutrophils, monocytes / macrophages. In some embodiments, the immune cell is a T cell. In some embodiments, the immune cell is an NK cell. In some embodiments, the immune cell is a monocyte / macrophage. In some embodiments, the immune cell is an engineered immune cell, meaning the immune cell has been genetically modified to express a non-naturally occurring protein or contain exogenous nucleic acid; and / or, the immune cell has been modified to lack the expression of certain endogenous gene-encoded proteins.

[0062] As used herein, the term "producing cell" refers to any cell from which extracellular vesicles can be isolated. A producing cell is a cell that serves as a source of extracellular vesicles. Producing cells can share protein, lipid, sugar, or nucleic acid components with extracellular vesicles.

[0063] In some embodiments, the producing cell is a modified or synthetic cell.

[0064] In some embodiments, the producing cell is a cultured or isolated cell.

[0065] In certain embodiments, the producing cell is a cell line, which can be a mammalian cell line, a plant cell line, an insect cell line, a fungal cell line, or a prokaryotic cell line. In certain embodiments, the producing cell is a mammalian cell line. Mammalian cell lines include, but are not limited to, human embryonic kidney (HEK) cell line, Chinese hamster ovary (CHO) cell line, HT-1080 cell line, HeLa cell line, PERC-6 cell line, CEVEC cell line, fibroblast cell line, amniotic cell line, epithelial cell line, and mesenchymal stem cell (MSC) cell line. In some preferred embodiments, the mammalian cell line can be HEK-293 cells, BJ human foreskin fibroblasts, fHDF fibroblasts, neuronal progenitor cells, amniotic cells, adipose mesenchymal stem cells, or RPTEC / TERT1 cells.

[0066] In certain other embodiments, the producing cell is a primary cell, which can be a primary mammalian cell, a primary plant cell, a primary insect cell, a primary fungal cell, or a primary prokaryotic cell.

[0067] In some specific embodiments, the producing cell is an immune cell, such as a dendritic cell, a T cell, a B cell, a natural killer cell (NK cell), an antigen-presenting cell, a monocyte / macrophage, a T helper cell, or a regulatory T cell (Treg cell).

[0068] As used herein, the term "CAR" (i.e., chimeric antigen receptor) includes an extracellular targeting domain, a transmembrane domain, and an intracellular targeting domain.

[0069] Wherein, the targeting extracellular domain comprises: an antibody, an antigen-binding fragment, or a natural ligand of the corresponding antigen, or a combination thereof; and / or

[0070] The transmembrane domain comprises transmembrane domains selected from the transmembrane domains of the following proteins: the α, β, or ζ chain of the T cell receptor, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, KIRDS2, OX40, CD2, CD27, LFA-1 (CD11a, CD18), ICOS (CD278), 4-1BB (CD137), GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD160, CD19, IL2Rβ, IL2Rγ, IL7Rα, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, and NKG2C; and / or

[0071] The targeting intracellular domain includes: a primary signal transduction domain and / or a co-stimulatory signal transduction domain, wherein:

[0072] (1) The primary signal transduction domain comprises a functional signal transduction domain of a protein selected from: CD3ζ, CD3γ, CD3δ, CD3ε, common FcRγ (FCER1G), FcRβ (FcεR1b), CD79a, CD79b, FcγRIIa, DAP10, or DAP12, or a combination thereof;

[0073] (2) The co-stimulatory signaling domain comprises a functional signaling domain of a protein selected from: CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds CD83, CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD160, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, TRANCE / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG / Cbp, NKp44, NKp30, NKp46 or NKG2D, or a combination thereof.

[0074] The term "antigen-binding fragment" refers to a fragment of a complete immunoglobulin, as well as any part of a polypeptide, including an antigen-binding region having the ability to specifically bind to an antigen. Exemplarily, the "antigen-binding fragment" herein includes, but is not limited to, Fab, F(ab')2, Fab', Fab'-SH, Fd, Fv, scFv, diabody, and single-domain antibody. The terms "single-domain antibody (sdAb)", "VHH domain", and "nanobody" herein have the same meaning and are interchangeable, and refer to the variable region of a cloned heavy-chain antibody, constructing a single-domain antibody consisting only of a heavy-chain variable region, which is the smallest antigen-binding fragment with complete function. Generally, after obtaining a heavy-chain antibody that is naturally lacking the light chain and the first constant region (CH1) of the heavy chain, the variable region of the heavy chain of the antibody is cloned, and a single-domain antibody consisting only of a heavy-chain variable region is constructed. It should be noted that nanobodies can be used to form other forms of antibodies. For example, an antibody can contain VH-CH2-CH3 or VH-CH1-CH2-CH3 from the N-terminus to the C-terminus; it can form a homodimer, such as a heavy-chain dimer antibody without a light chain.

[0075] Further, the chimeric antigen receptor is selected from one or more of the following:

[0076] (i) The extracellular targeting domain is selected from an antibody or its fragment that specifically binds to a tumor antigen, the transmembrane domain is selected from the transmembrane domain of CD28 or CD8, and the intracellular targeting domain is selected from the co-stimulatory signal domain of CD28 and the CD3ζ chain;

[0077] (ii) The extracellular targeting domain is selected from an antibody or its fragment that specifically binds to a tumor antigen, the transmembrane domain is selected from the transmembrane domain of CD28 or CD8, and the intracellular targeting domain is selected from the co-stimulatory signal domain of CD137 and the CD3ζ chain;

[0078] (iii) The extracellular targeting domain is selected from an antibody or its fragment that specifically binds to a tumor antigen, the transmembrane domain is selected from the transmembrane domain of CD28 or CD8, and the intracellular targeting domain is selected from the co-stimulatory signal domain of CD28, the co-stimulatory signal domain of CD137, and the CD3ζ chain.

[0079] It can be understood that when the above intracellular targeting domain is selected from multiple domains or protein chains, it can be designed and linked in a conventional manner in the art according to its functional characteristics.

[0080] In some of these embodiments, the tumor antigen is selected from one or more of the following:

[0081] TSHR, CD19, CD123, CD22, CD30, CD171, CS-1, CLL-1, CD33, EGFRvIII, GD2, GD3, BCMA, Tn Ag, PSMA, ROR1, FLT3, FAP, TAG72, CD38, CD44v6, CEA, EPCAM, B7H3, KIT, IL-13Ra2, Mesothelin, IL-11Ra, PSCA, PRSS21, VEGFR2, LewisY, CD24, PDGFR-β, SSEA-4, CD20, folate receptor alpha, ERBB2 (Her2 / neu), MUC1, EGFR, NCAM, prostase, PAP, ELF2M, Ephrin B2, IGF-I receptor, CAIX, LMP2, gp100, bcr-abl, tyrosinase, EphA2, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1 / CD248, TEM7R, CLDN6, GPRC5D, CXORF61, CD97, CD179a, ALK, polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-1a, MAGE-A1, legumain, HPV E6, E7, MAGE A1, ETV6-AML, sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, prostein, survivin and telomerase, PCTA-1 / Galectin 8, MelanA / MART 1, Ras mutant, hTERT, sarcoma translocation breakpoint, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, Cyclin B1, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxylesterase, mut hsp70-2, CD79a, CD79b, CD72, LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, GPC3, FCRL5 and IGLL1.

[0082] In some embodiments, the tumor antigen is a solid tumor antigen.

[0083] In some of these embodiments, the solid tumor antigen is selected from B7, CAIX, CD123, CD133, CD171, CD171 / L1-CAM, CEA, Claudin 18.2, cMet, CS1, CSPG4, Dectin1, EGFR, EGFRvIII, EphA2, ERBB receptor, ErbBT4, ERBB2, FAP, folate receptor 1, FITC, FSH, GD2, GPC3, HA-1H / HLA-A2, HER2, IL-11Ra, IL13 receptor a2, IL13R, IL13Rα2 (zetakine), Kappa, LewisY, mesothelin, MUC1, NKG2D, NY-ESO-1, PSMA, ROR-1, TRAIL-receptor 1 or VEGFR2; more preferably, the solid tumor antigen is GPC3.

[0084] In some of these embodiments, the solid tumor is selected from one or more of colon cancer, rectal cancer, renal cell carcinoma, liver cancer, lung cancer, small intestine cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, anal region cancer, gastric cancer, testicular cancer, uterine cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, bladder cancer, kidney or ureteral cancer, renal pelvic cancer, central nervous system tumor, spinal cord tumor, brainstem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid carcinoma and squamous cell carcinoma; more preferably, the solid tumor is selected from liver cancer, lung cancer, renal cancer and / or squamous cell carcinoma.

[0085] The CAR can be introduced into the transgenic or mRNA of the production cell for expression by transfection, viral transduction, electroporation, extrusion, sonication, cell fusion or other methods known to those skilled in the art.

[0086] In certain embodiments, the CAR is introduced into the production cells by transfection. In some embodiments, synthetic macromolecules such as cationic lipids and polymers can be used to introduce the CAR into suitable production cells (Papapetrou et al., Gene Therapy 12:S118 - S130 (2005)). In some embodiments, the cationic lipid forms a complex with the CAR through charge interaction. In some of these embodiments, the positively charged complex binds to the negatively charged cell surface and is taken up by the cell via endocytosis. In some other embodiments, cationic polymers can be used for transfecting the production cells. In some of these embodiments, the cationic polymer is polyethyleneimine (PEI). In certain embodiments, chemicals such as calcium phosphate, cyclodextrin, or polybrene can be used to introduce the CAR into the production cells. Physical methods such as particle-mediated transfection, “gene gun”, biolistic or particle bombardment techniques can also be used to introduce the CAR into the production cells (Papapetrou et al., Gene Therapy 12:S118 - S130 (2005)). Reporter genes such as, for example, β-galactosidase, chloramphenicol acetyltransferase, luciferase, or green fluorescent protein can be used to evaluate the transfection efficiency of the production cells.

[0087] In certain embodiments, the CAR is introduced into the production cells by viral transduction. Many viruses can be used as gene transfer vectors, including Moloney murine leukemia virus (MMLV), adenovirus, adeno-associated virus (AAV), herpes simplex virus (HSV), lentivirus, and foamy virus. Viral-mediated gene transfer vectors include vectors based on DNA viruses (such as adenovirus, adeno-associated virus, and herpesvirus), and vectors based on retroviruses.

[0088] In certain embodiments, the CAR is introduced into the production cells by electroporation. Electroporation creates transient pores in the cell membrane, thus allowing the introduction of the CAR into the cell. In some embodiments, the CAR DNA and CAR mRNA can be introduced into the production cells by electroporation.

[0089] In certain embodiments, the CAR is introduced into the production cells by microinjection. In some embodiments, a glass micropipette can be used to inject the CAR into the production cells at the microscopic level.

[0090] In certain embodiments, the CAR is introduced into the production cells by extrusion.

[0091] In certain embodiments, the CAR is introduced into the production cells by sonication. In some embodiments, the production cells are exposed to high-intensity sound waves, causing transient disruption of the cell membrane, thus allowing the loading of the CAR.

[0092] In certain embodiments, the CAR is introduced into the production cells by cell fusion. In some embodiments, the CAR is introduced by electrocell fusion. In some other embodiments, polyethylene glycol (PEG) is used to fuse the production cells. In some other embodiments, Sendai virus is used to fuse the production cells.

[0093] In some embodiments, the CAR is introduced into the production cells by hypotonic lysis. In some of these embodiments, the production cells are exposed to a buffer of low ionic strength, causing them to rupture, thereby allowing the loading of the CAR. In some alternative embodiments, controlled dialysis against a hypotonic solution is used to swell the production cells and create pores in the production cell membrane. Subsequently, the production cells are exposed to conditions that allow the membrane to reseal.

[0094] In some embodiments, the CAR is introduced into the production cells by detergent treatment. In certain embodiments, the production cells are treated with a mild detergent that temporarily disrupts the production cell membrane by creating pores, thereby allowing the loading of the CAR. After the production cells are loaded, the detergent is washed away, thereby resealing the membrane.

[0095] In some embodiments, the CAR is introduced into the production cells by receptor-mediated endocytosis. In certain embodiments, the production cells have surface receptors that induce the internalization of the receptor and the CAR upon binding of the CAR.

[0096] In some embodiments, the CAR is introduced into the production cells by filtration. In certain embodiments, the production cells and the CAR can be forced through a filter with a pore size smaller than the production cells, thereby causing transient disruption of the production cell membrane and allowing the CAR to enter the production cells.

[0097] In some embodiments, the production cells are subjected to several freeze-thaw cycles, resulting in rupture of the cell membrane, thereby allowing the loading of the CAR.

[0098] The method of modifying extracellular vesicles with immunomodulatory molecules can be as follows:

[0099] In various alternative embodiments, the CAR is directly introduced into the extracellular vesicles after isolation of the extracellular vesicles.

[0100] In certain embodiments, the CAR is introduced into the extracellular vesicles by transfection. In some embodiments, synthetic macromolecules such as cationic lipids and polymers can be used to introduce the CAR into the extracellular vesicles (Papapetrou et al., Gene Therapy 12:S118 - S130 (2005)). In certain embodiments, chemicals such as calcium phosphate, cyclodextrin, or polybrene can be used to introduce the CAR into the extracellular vesicles.

[0101] In certain embodiments, the CAR is introduced into extracellular vesicles by electroporation. In some embodiments, the extracellular vesicles are exposed to an electric field that creates transient pores in the extracellular vesicle membrane, thereby allowing loading of the CAR.

[0102] In certain embodiments, the CAR is introduced into extracellular vesicles by microinjection. In some embodiments, a glass micropipette can be used to directly inject the CAR into the extracellular vesicles at the microscopic level.

[0103] In certain embodiments, the CAR is introduced into extracellular vesicles by extrusion.

[0104] In certain embodiments, the CAR is introduced into extracellular vesicles by sonication. In some embodiments, the extracellular vesicles are exposed to high-intensity sound waves that cause transient disruption of the extracellular vesicle membrane, thereby allowing loading of the CAR.

[0105] In some embodiments, the CAR is introduced into extracellular vesicles by hypotonic lysis. In some of these embodiments, the extracellular vesicles are exposed to a buffer of low ionic strength, causing them to rupture, thereby allowing loading of the CAR. In some alternative embodiments, controlled dialysis against a hypotonic solution is used to swell the extracellular vesicles and create pores in the extracellular vesicle membrane. The extracellular vesicles are then exposed to conditions that allow resealing of the membrane.

[0106] In some embodiments, the CAR is introduced into extracellular vesicles by detergent treatment. In certain embodiments, the extracellular vesicles are treated with a mild detergent that temporarily disrupts the extracellular vesicle membrane by creating pores, thereby allowing loading of the CAR. After loading of the CAR, the detergent is washed away, thereby resealing the membrane.

[0107] In some embodiments, the CAR is introduced into extracellular vesicles by receptor-mediated endocytosis. In certain embodiments, the extracellular vesicles have surface receptors that induce internalization of the receptor and the associated CAR upon binding of the CAR.

[0108] In some embodiments, the CAR is introduced into extracellular vesicles by mechanical impulsion. In certain embodiments, the extracellular vesicles can be bombarded with the CAR attached to heavy or charged particles such as gold microcarriers. In some of these embodiments, the particles can be accelerated mechanically or electrically such that they traverse the extracellular vesicle membrane.

[0109] In some embodiments, the CAR is introduced into extracellular vesicles by filtration. In certain embodiments, the extracellular vesicles and the CAR can be forced through a filter with a pore size smaller than the extracellular vesicles, thereby causing transient disruption of the extracellular vesicle membrane and allowing the CAR to be loaded into the extracellular vesicles.

[0110] In some embodiments, extracellular vesicles are subjected to several freeze - thaw cycles, which results in the rupture of the extracellular vesicle membrane, thus allowing for the loading of CAR.

[0111] The method of separating extracellular vesicles can be separating extracellular vesicles from producer cells.

[0112] In certain embodiments, extracellular vesicles are released by producer cells into the cell culture medium. All known methods of separating extracellular vesicles are contemplated to be suitable for use in this application. For example, the physical properties of extracellular vesicles can be utilized to separate them from the medium or other source materials, including separation based on charge (e.g., electrophoretic separation), size (e.g., filtration, molecular sieving, etc.), density (e.g., conventional or gradient centrifugation), Svedberg constant (e.g., sedimentation with or without an external force, etc.). Alternatively or additionally, separation can be based on one or more biological properties and includes methods that can employ surface markers (e.g., for precipitation, reversible binding to a solid phase, FACS separation, specific ligand binding, non - specific ligand binding, affinity purification, etc.).

[0113] Separation and enrichment can be carried out in a general and non - selective manner, typically including sequential centrifugation. Alternatively, separation and enrichment can be carried out in a more specific and selective manner, such as using extracellular vesicle - or producer cell - specific surface markers. For example, specific surface markers can be used for immunoprecipitation, FACS sorting, affinity purification, and magnetic separation with ligand - conjugated beads.

[0114] In some embodiments, size - exclusion chromatography can be used to separate extracellular vesicles. Size - exclusion chromatography techniques are known in the art. This application provides exemplary non - limiting techniques. In some embodiments, the void volume fraction is separated and contains the extracellular vesicles of interest. Additionally, in some embodiments, as is generally known in the art, after chromatographic separation, extracellular vesicles can be further separated by centrifugation techniques of the (one or more chromatographic fractions). In some embodiments, for example, density gradient centrifugation can be utilized to further separate extracellular vesicles. In certain embodiments, it may be desirable to further separate extracellular vesicles of producer cell origin from extracellular vesicles of other origins. For example, extracellular vesicles of producer cell origin can be separated from extracellular vesicles of non - producer cell origin by immunosorbent capture using an antigen - antibody specific for the producer cell.

[0115] In some embodiments, the separation of extracellular vesicles can involve a combination of methods, including but not limited to differential centrifugation, size - based membrane filtration, immunoprecipitation, FACS sorting, and magnetic separation.

[0116] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way.

[0117] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0118] Example 1

[0119] In this example, the preparation of CAR-NV (CAR-nanovesicles) is carried out, including the following steps:

[0120] I. Lentivirus packaging and cell infection

[0121] 1. Construct the CAR plasmid. In this example, the third-generation CAR is used, targeting GPC3. The CAR coding sequence is SEQ ID No.1, and the amino acid sequence is SEQ ID No.2. CAR sequentially includes the following parts: CD8α signal peptide (coding sequence SEQ ID No.3), GPC3 scFv (YP7, coding sequence SEQ ID No.4), CD8α hinge region (coding sequence SEQ ID No.5), CD8α transmembrane region (coding sequence SEQ ID No.6), CD28 co-stimulatory domain (coding sequence SEQ ID No.7), 4-1BB co-stimulatory domain (coding sequence SEQ ID No.8), and CD3ζ intracellular domain (coding sequence SEQ ID No.9). The above CAR coding sequence (SEQ ID No.1) is cloned between the Nhe I and Cla I restriction sites of the pHAGE-EF1αL-eGFP-W vector (Addgene, catalog number 126686) to obtain the CAR plasmid. The specific sequences are shown in Table 1.

[0122] 2. Construct the CAR lentiviral vector. In this example, the second-generation lentivirus packaging system is used. Mix psPAX2 (Addgene, catalog number 12260), pMD2.G (Addgene, catalog number 12259) and the CAR plasmid, and then drop the mixture into a 293T cell culture dish. Collect the virus at 48h and 72h respectively, and obtain the concentrated virus solution by ultrafiltration centrifugation, that is, the CAR lentiviral vector is obtained.

[0123] 3. Cell infection. Infect 293T cells in the logarithmic growth phase with the CAR lentiviral vector collected in step 2. Collect the cells 96 h later, and then sort the CAR-GPC3 positive cells. Specifically, add GPC3-biotin protein (product name: Biotinylated Human GPC3 / Glypican 3 Protein, catalog number: GPC-HM431B, Kaikai Biotech Co., Ltd.) at room temperature for 25 min; wash twice with PBS, add APC-streptavidin (catalog number: 405207, BioLegend) at room temperature for 20 min; then sort the CAR-GPC3 positive cells by flow cytometry.

[0124] Table 1. Related sequences involved in constructing the CAR plasmid

[0125]

[0126]

[0127] II. Preparation of CAR-NV by membrane extrusion

[0128] 1. After the CAR-GPC3 positive cells are amplified and cultured, take 1×10 7 cells and add 1 mL of membrane extraction reagent solution (product name: Cell Membrane Protein and Cytoplasmic Protein Extraction Kit, catalog number: P0033, Beyotime Biotechnology Co., Ltd.) and 10 μL of phenylmethanesulfonyl fluoride (PMSF) solution. Freeze-thaw 4 cycles repeatedly, centrifuge at 700×g for 10 min, remove the cell precipitate, and obtain the supernatant.

[0129] 2. Transfer the supernatant from step 1 to a clean EP tube, centrifuge at 14000×g at 4 °C for 30 min, resuspend the precipitate with PBS, extrude through a 1 μm filter membrane and a 400 nm filter membrane successively using an Avanti Polar Lipids extruder, then centrifuge at 14000×g at 4 °C for 30 min, resuspend the precipitate with PBS to obtain CAR-NV, and store it at -80 °C for later use.

[0130] Example 2

[0131] This experimental example is for the preparation of CAR-EV (CAR-exosomes), including the following steps:

[0132] 1. Follow the steps of step 1 in Example 1 to obtain CAR-GPC3 positive cells.

[0133] 2. After the CAR-GPC3 positive cells obtained in step 1 are amplified and cultured, collect the supernatant.

[0134] 3. The supernatant obtained in step 2 was ultracentrifuged at 100,000×g for 70 min for two consecutive rounds to obtain a precipitate, and the precipitate was resuspended with PBS to obtain CAR-EV, which was stored at -80°C for later use.

[0135] Example 3

[0136] In this experimental example, THP-1 or T cells were modified with the CAR lentiviral vector of Example 1, the CAR-NV obtained in Example 1, or the CAR-EV obtained in Example 2. The experiment was divided into 5 groups: CAR-lentivirus-THP-1 group, CAR-NV-THP-1 group, CAR-EV-THP-1 group, CAR-NV-T group, and CAR-EV-T group. The proportion of target cells in each group was detected by flow cytometry, that is, the CAR positive rate (%) of each group of cells.

[0137] 1. The operation of the CAR-lentivirus-THP-1 group was as follows:

[0138] Adjust the THP-1 cells to a density of 1×10 6 cells / well, and use the CAR lentiviral vector obtained in step 2 of Example 1 for lentiviral infection for 96 h at 100 μL CAR lentiviral vector / well, and collect the cells.

[0139] 2. The operation of the CAR-NV-THP-1 group was as follows:

[0140] Adjust the THP-1 cells to a density of 1×10 6 cells / well, and then use the CAR-NV obtained in Example 1 at 1×10 10 particle number / well for 48 h, and collect the cells.

[0141] 3. The operation of the CAR-EV-THP-1 group was as follows:

[0142] Adjust the THP-1 cells to a density of 1×10 6 cells / well, and then use the CAR-EV obtained in Example 2 at 1×10 10 particle number / well for 48 h, and collect the cells.

[0143] 4. The operation of the CAR-NV-T group was as follows:

[0144] Adjust the T cells to a density of 1×10 6 cells / well, and use the CAR-NV obtained in Example 1 at 1×10 10 particle number / well for 48 h, and collect the cells.

[0145] 5. The operation of the CAR-EV-T group was as follows:

[0146] Adjust the T cells to a density of 1×10 6cells / well, and the CAR-NV obtained in Example 2 was used at 1×10 10 particle number / well for 48 h, and the cells were collected.

[0147] 6. Detect the proportion of target cells in each group, that is, the proportion of CAR positive rate of cells in each group. The method is as follows: Add GPC3-biotin protein (product name: Biotinylated Human GPC3 / Glypican 3 Protein, catalog number: GPC-HM431B, Kaikai Biotech Co., Ltd.) to each group and incubate at room temperature for 25 min; Wash twice with PBS, add APC-streptavidin (catalog number: 405207, BioLegend), and incubate at room temperature for 20 min; Then, CAR-GPC3 positive cells were sorted by flow cytometry.

[0148] The results are as Figure 1 shown. The CAR positive rate of cells in the CAR-NV-THP-1 group and the CAR-EV-THP-1 group was more than 60%, while the CAR positive rate of cells in the CAR-lentivirus-THP-1 group was only about 20%. The CAR positive rate of cells in the CAR-NV-T group and the CAR-EV-T group was about 50%. After one-way ANOVA analysis, compared with the CAR-lentivirus-THP-1 group, the CAR-NV-THP-1 group, the CAR-EV-THP-1 group, the CAR-NV-T group and the CAR-EV-T group all had statistical differences, P < 0.01; Compared with the CAR-NV-T group, the CAR-NV-THP-1 group had statistical differences, P < 0.05; Compared with the CAR-EV-T group, the CAR-EV-THP-1 group had statistical differences, P < 0.05; It indicates that the efficiency of delivering CAR to THP-1 by NV / EV is significantly higher.

[0149] Example 4

[0150] In this example, the in vitro killing effect of CAR positive cells in the CAR-NV-THP-1 group and the CAR-EV-THP-1 group in Example 3 on tumor cells was detected.

[0151] Adjust the THP-1 cells to a density of 1×10 6 cells / well, and use the CAR lentiviral vector obtained in Step 1 of Example 1 at 100 μL virus solution / well for 96 h of lentiviral infection. Sort CAR positive cells by the same sorting method as in Example 1. The cells in this group were designated as the CAR-lentivirus-THP-1 group as a control.

[0152] The CAR-positive cells obtained by sorting the CAR-NV-THP-1 group, CAR-EV-THP-1 group, and CAR-lentivirus-THP-1 group in Example 3 were subjected to an in vitro killing experiment with tumor cells (detection of tumor cell killing by luciferase activity). The steps were as follows:

[0153] The above three types of CAR-positive cells were inoculated into 96-well plates at 4×10 4 cells / well; Hep-G2 cells expressing Luciferase were inoculated at an inoculation amount of 1×10 4 cells / well and co-incubated with the CAR-positive cells in the above 96-well plates. After 24 h, luciferase substrate was added, and readings were taken using a microplate reader to detect the in vitro killing activity. Hep-G2 cells expressing Luciferase and the group without inoculating CAR-positive cells were used as the negative control group. The average value of the negative control group was denoted as a, and the value of the experimental well was b. The killing percentage of the experimental well (killing%) = (1 - b / a) × 100%.

[0154] The results are shown in Figure 2 . Compared with the CAR-positive cells in the CAR-lentivirus-THP-1 group, the in vitro tumor killing efficiency of the CAR-positive cells in the CAR-NV-THP-1 group and CAR-EV-THP-1 group obtained by EV / NV delivery of CAR was significantly higher. After one-way ANOVA analysis, compared with the CAR-lentivirus-THP-1 group, the CAR-NV-THP-1 group and CAR-EV-THP-1 group had statistical differences, P < 0.01; there was no statistical difference between the CAR-NV-THP-1 group and the CAR-EV-THP-1 group.

[0155] Example 5

[0156] The in vivo tumor killing effect of the CAR-positive cells in the CAR-NV-THP-1 group and CAR-EV-THP-1 group in Example 3 was detected, with the CAR-positive cells in the CAR-lentivirus-THP-1 group prepared by the same method as in Example 4 as the control.

[0157] First, a subcutaneous tumor model was constructed, that is, 1×10 7 Hep-G2 cells expressing Luciferase were inoculated subcutaneously in mice. When the tumor grew to 100 - 200 mm 3 , the tumor mass was removed and cut into small pieces for subsequent orthotopic inoculation in mice. An orthotopic liver cancer mouse model was established, that is, 5 mm 3The tumor mass was subjected to in vivo imaging on the third day after inoculation to show the tumor mass size. The successfully modeled mice were randomly divided into 4 groups, with 4 mice in each group, namely the PBS group, the CAR-lentivirus-THP-1 group, the CAR-NV-THP-1 group, and the CAR-EV-THP-1 group. The CAR-positive cells in the CAR-lentivirus-THP-1 group, the CAR-NV-THP-1 group, and the CAR-EV-THP-1 group prepared in Example 3 were digested and counted, and resuspended in 100 μL of PBS at 6×10 6 cells. The CAR-lentivirus-THP-1 group, the CAR-NV-THP-1 group, and the CAR-EV-THP-1 group were intravenously administered 100 μL of the corresponding CAR-positive cells resuspended in PBS. The day of administration was recorded as Day 0, and the drug was administered twice a week for two weeks. After two weeks, in vivo imaging was performed to detect the tumor size.

[0158] Results: The tumors of the mice in the PBS group and the CAR-lentivirus-THP-1 group were not inhibited. The tumors of the mice in the CAR-NV-THP-1 group and the CAR-EV-THP-1 group were inhibited. The anti-tumor effect in vivo of the CAR-positive cells obtained by EV / NV delivery of CAR was better than that of the CAR-positive cells obtained by lentivirus delivery of CAR.

[0159] Example 6

[0160] In this example, the CAR-NV or lentiviral vector prepared in Example 1 was incubated with THP-1 cells, and the obtained cells were detected for relevant markers.

[0161] The THP-1 cells were divided into 3 groups: The THP-1 group was not treated with anything; The CAR-GPC3 THP-1 group was infected with the lentiviral vector obtained in Step 1-2 of Example 1 at 100 μL of virus solution per well for 1×10 6 cells per well for 72 h; The THP-1@CAR NVs group was treated with the CAR-NV obtained in Example 1 (1×10 10 particle number) for 1×10 6THP-1 cells per well for 48 h. Cells in each group with or without any treatment were collected, and surface markers CD14, CD11b, CD86 and CD206 were detected by Q-PCR. Primer information for CD14 detection: F: CTGGAACAGGTGCCTAAAGGAC, R: CTGGAACAGGTGCCTAAAGGAC; Primer information for CD11b detection: F: GCCTTGACCTTATGTCATGGG, R: CCTGTGCTGTAGTCGCACT; Primer information for CD86 detection: F: TGCTCATCTATACACGGTTACC, R: TGCATAACACCATCATACTCGA; Primer information for CD206 detection: F: AGCCAACACCAGCTCCTCAAGA, R: CAAAACGCTCGCGCATTGTCCA.

[0162] The relative mRNA expression level of the THP-1 group was set as 1, and the results were as Figures 3 to 6As shown, it was found that compared with the THP-1 group, after treatment, the expression of CD14 and CD11b in the CAR-GPC3 THP-1 group and the THP-1@CAR NVs group was significantly higher. After one-way ANOVA analysis, compared with the THP-1 group, there were statistically significant differences in the mRNA expression of CD14 and CD11b in the THP-1@CAR NVs group, with P < 0.01. CD14 and CD11b are markers of M0 macrophages, indicating that after treatment, the cells in the CAR-GPC3 THP-1 group and the THP-1@CAR NVs group transformed from THP-1 into macrophages. Compared with the THP-1 group, after treatment, the expression of CD86 and CD206 in the CAR-GPC3 THP-1 group and the THP-1@CAR NVs group was upregulated. After one-way ANOVA analysis, compared with the THP-1 group, there was a statistically significant difference in the mRNA expression of CD86 in the THP-1@CAR NVs group, with P < 0.01, while there was no statistically significant difference in the CAR-GPC3 THP-1 group; moreover, compared with the CAR-GPC3 THP-1 group, there was a statistically significant difference in the mRNA expression of CD86 in the THP-1@CAR NVs group, with P < 0.01. Compared with the THP-1 group, there was a statistically significant difference in the mRNA expression of CD206 in the CAR-GPC3 THP-1 group, with P < 0.01, while there was no statistically significant difference in the THP-1@CAR NVs group; moreover, compared with the THP-1@CAR NVs group, there was a statistically significant difference in the mRNA expression of CD86 in the CAR-GPC3 THP-1 group, with P < 0.01. CD86 is a marker of M1 macrophages, and CD206 is a marker of M2 macrophages, indicating that after treatment, the cells in the CAR-GPC3 THP-1 group and the THP-1@CAR NVs group transformed from THP-1 into M1 macrophages and M2 macrophages; more importantly, compared with the cells in the CAR-GPC3 THP-1 group, after treatment, the expression of CD86 in the THP-1@CAR NVs group was significantly higher, and the expression of CD206 was significantly lower, indicating that the use of NVs for CAR delivery can transform THP-1 cells into macrophages, and the proportion of transformation into M1 macrophages is higher, which can better exert the anti-tumor effect.

[0163] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modifications, uses or improvements of the present invention, including those that depart from the scope disclosed in this application and are made with conventional techniques known in the art.

Claims

1. A method for modifying immune cells, characterized in that: the method comprises the following steps: loading an immune regulatory molecule on the surface of extracellular vesicles, and then incubating the obtained extracellular vesicles loaded with the immune regulatory molecule with the immune cells to be modified to obtain modified immune cells.

2. The method according to claim 1, characterized in that: the extracellular vesicles are exosomes or nanovesicles; and / or the immune regulatory molecule is a CAR, an antibody targeting a tumor antigen and / or an immune checkpoint and / or an active fragment thereof; and / or the immune cells to be modified are selected from one or more of T cells, NK cells, NKT cells, mast cells, monocytes, macrophages, dendritic cells, CIK cells, and immune effector cells derived from stem cells; furthermore, the immune cells to be modified are monocytes and / or macrophages; the modified immune cells are macrophages; and / or loading the immune regulatory molecule on the surface of the extracellular vesicles is achieved by the following method comprising the following steps: modifying producer cells with the immune regulatory molecule, and preparing extracellular vesicles loaded with the immune regulatory molecule using the obtained modified producer cells as a source.

3. A method for preparing an anti-tumor drug, characterized in that: the preparation method comprises the following step (A1): (A1) Loading an immune regulatory molecule on the surface of extracellular vesicles, and the obtained extracellular vesicles loaded with the immune regulatory molecule are the anti-tumor drug; furthermore, the preparation method further comprises the following step (A2): (A2) Incubating the extracellular vesicles loaded with the immune regulatory molecule obtained in (A1) with the immune cells to be modified to obtain modified immune cells; the modified immune cells are the anti-tumor drug.

4. Any of the following applications: (B1) The application of extracellular vesicles in the preparation of anti-tumor drugs; the surface of the extracellular vesicles is loaded with an immune regulatory molecule; (B2) The application of extracellular vesicles and / or modified immune cells in the preparation of anti-tumor drugs; the surface of the extracellular vesicles is loaded with an immune regulatory molecule, and the modified immune cells are obtained by incubating the extracellular vesicles loaded with the immune regulatory molecule with the immune cells to be modified.

5. The method according to claim 3 or the application according to claim 4, characterized in that: the extracellular vesicles are exosomes or nanovesicles; and / or the immune regulatory molecule is a CAR, an antibody targeting a tumor antigen and / or an immune checkpoint and / or an active fragment thereof; and / or the immune cells to be modified are selected from one or more of T cells, NK cells, NKT cells, mast cells, monocytes, macrophages, dendritic cells, CIK cells, and immune effector cells derived from stem cells; furthermore, the immune cells to be modified are monocytes and / or macrophages; the modified immune cells are macrophages; and / or loading the immune regulatory molecule on the surface of the extracellular vesicles is achieved by the following method comprising the following steps: modifying producer cells with the immune regulatory molecule, and preparing extracellular vesicles loaded with the immune regulatory molecule using the obtained modified producer cells as a source.

6. Any of the following methods: (C1) A method for inducing the differentiation of monocytes into macrophages, characterized in that: the method comprises the following steps: loading CAR on the surface of extracellular vesicles, and then incubating the obtained extracellular vesicles loaded with CAR with monocytes to obtain macrophages; (C2) A method for preparing CAR - macrophages, characterized in that: the method comprises the following steps: loading CAR on the surface of extracellular vesicles, and then incubating the obtained extracellular vesicles loaded with CAR with monocytes and / or macrophages to obtain CAR - positive macrophages, which are CAR - macrophages; (C3) A method for preparing an in - vivo CAR - macrophage drug, characterized in that: the method comprises the following steps: loading CAR on the surface of extracellular vesicles, and the obtained extracellular vesicles loaded with CAR will deliver CAR to monocytes and / or macrophages in vivo, and the obtained CAR - positive macrophages are the in - vivo CAR - macrophage drug.

7. The method according to claim 6, characterized in that: in (C1), the macrophages contain M1 - type macrophages.

8. The method according to claim 6 or 7, characterized in that: the extracellular vesicles are exosomes or nanovesicles; and / or loading CAR on the surface of the extracellular vesicles is achieved by the following method: modifying producer cells with CAR, and preparing extracellular vesicles loaded with CAR from the obtained modified producer cells.

9. A modified immune cell, characterized in that: the modified immune cell is prepared by the method according to claim 1 or 2.

10. An anti - tumor drug, characterized in that: the anti - tumor drug is prepared by the method according to claim 3 or 5 or 6 or 7 or 8.

Images