DNA hydrogel and application thereof in zinc ion detection

Abstract

The DNA hydrogel is prepared by adopting a hairpin structure of an H1 chain, a hairpin structure of an H2 chain and a trigger probe to perform a hybridization chain reaction, the DNA hydrogel is applied to zinc ion detection, specifically, a to-be-detected sample is added into the DNA hydrogel, after standing, liquid in the mixture is sucked by a capillary tube, and when the volume of the liquid in the capillary tube is obviously higher than that of the added to-be-detected sample, it is indicated that the to-be-detected sample contains zinc ions; the preparation method is simple, the detection method is visual, field operation is convenient, detection can be achieved without complex instruments, and the kit is low in cost, rapid, simple, convenient, economical, high in sensitivity and good in specificity; a powerful guarantee is provided for research and development of a heavy metal ion sensing technology.

Description

Technical Field

[0001] The present invention belongs to the field of heavy metal ion detection, and particularly relates to a DNA hydrogel and its application in rapid visual detection of zinc ions. Background Art

[0002] Heavy metal pollution is one of the major environmental problems faced globally, and it poses serious hazards to both the ecological environment and human health. Zinc ion (Zn 2+ ) is one of the essential trace elements in the human body and is also the second most important transition ion in the human body. It can participate in different biological processes such as gene expression, apoptosis, and immune system function. The lack of Zn 2+ in the human body can cause various diseases, such as immune system disorders, diarrhea, and epilepsy. When the concentration is too high, it will also pose a hazard to human health, such as kidney damage and Parkinson's disease. Therefore, maintaining the stability of Zn 2+ concentration is crucial for maintaining the health of the body. Currently, most methods for detecting harmful heavy metals rely on expensive instruments and equipment, making it difficult to achieve rapid on-site detection. Therefore, there is an urgent need to develop an accurate, portable, and sensitive heavy metal detection method.

[0003] Currently, heavy metal detection mainly relies on high-cost and complex instrumental analysis, such as Atomic Absorption Spectroscopy (AAS), Inductively Coupled Plasma Mass Spectrometry (ICP-MS), Flame Atomic Absorption Spectrophotometry (FAAS), X-ray Fluorescence Spectrometry (XFS), etc. These techniques have shown extremely high sensitivity, accuracy, and detection limits in heavy metal detection and can effectively identify and quantify ultra-trace heavy metals in various samples. However, these methods have significant limitations. First, the equipment is expensive, and the maintenance and operation costs are high. Second, the sample pretreatment process is cumbersome and usually requires complex chemical pretreatment or separation steps, which not only increases the detection time but also requires high technical skills for operators. In addition, these instruments are usually large in size and difficult to be portable, unable to meet the requirements of rapid and on-site real-time detection. Therefore, in practical applications, especially in cases where large-scale monitoring or emergency situations are required, they are not ideal. Therefore, developing a simple, economical, and efficient heavy metal detection method has become the focus of current research to make up for the deficiencies of existing technologies and meet the requirements of rapid and convenient on-site detection.

[0004] In recent years, functional nucleic acids have become ideal recognition elements in the field of sensing. Biosensors based on functional nucleic acids have achieved highly sensitive and specific detection of heavy metal ions through changes in electrochemical, fluorescence, and colorimetric signals. Among them, hybridization chain reaction (HCR) is an isothermal nucleic acid amplification technology. Based on the principle of HCR, the hydrogel-based clamped hybridization chain reaction (C-HCR) technology has been developed to synthesize DNA hydrogels. Hydrogels are materials with a three-dimensional network structure, having high water content and excellent biocompatibility, so they are often applied in the fields of biomedicine and sensing. In the C-HCR technology, the hydrogel realizes the detection of heavy metal ions through the visual sol-gel transition, such as in the detection of miRNAs and Hg 2+ and has been successfully applied. By adding the trigger strand, the hydrogel undergoes a sol-gel phase change, and its morphological changes can be used for the highly sensitive detection of heavy metal ions. Since the hydrogel can exhibit significant morphological changes during the detection process, which is convenient to observe with the naked eye or simple equipment, it has great potential in the rapid detection of heavy metals and other harmful substances in food. This not only improves the detection sensitivity and accuracy, but also simplifies the operation process, reduces the detection cost, is suitable for on-site and large-scale food safety monitoring, and helps to detect and prevent heavy metal pollution in food in a timely manner. Summary of the Invention

[0005] The present invention provides a DNA hydrogel and the application of the DNA hydrogel in the detection of zinc ions. The present invention realizes the efficient recognition and highly sensitive and rapid detection of zinc ions.

[0006] To achieve the above object, the technical solutions adopted by the present invention are as follows: 1. Preparation of the hairpin structure of H1 strand or the hairpin structure of H2 strand After dissolving the H1 strand or H2 strand in 1×TAE-Mg 2+ buffer solution, denature it at 95°C for 10 min, quickly cool it to -4°C and keep it for 1 h to obtain the hairpin structure of H1 strand or the hairpin structure of H2 strand; The nucleotide sequence of the H1 strand is GATCGCGATCCTCACTATrAGGAAGAGATGAGTAAGCCATCTC TTCTCCG; The nucleotide sequence of the H2 strand is CATCTCTTCTCCGAGCCGGTCGAAATAGTGAGTCGGAGAAGA GATGGCTTACT.

[0007] 2. Preparation of DNA Hydrogel Mix the hairpin structures of H1 strand with a concentration of 320 - 720 μmol / L, the hairpin structures of H2 strand with a concentration of 320 - 720 μmol / L, and 14.4 - 100 μmol / L trigger probe, and incubate at 37 °C for 12 h for hybridization chain reaction to obtain DNA hydrogel, where the addition amounts of the hairpin structures of H1 strand and H2 strand are equal; The nucleotide sequence of the trigger probe is CATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT; 3. Application of DNA Hydrogel in Zinc Ion Detection Add the sample to be detected into the DNA hydrogel. After standing for 50 - 70 min, suck the liquid in the mixture with a capillary. When the volume of the liquid in the capillary is significantly higher than the volume of the sample to be detected added, it indicates that the sample to be detected contains zinc ions. The zinc ions specifically cleave the hybridization chain reaction product, destroying the hydrogel network structure and forming a sol liquid.

[0008] Compared with the prior art, the present invention has the following beneficial effects: Based on the substrate strand and enzyme strand of zinc ion DNAzyme, the present invention designs H1 strand and H2 strand, prepares hairpin structures with H1 strand or H2 strand, synthesizes responsive DNA hydrogel through hybridization chain reaction (HCR), and applies the DNA hydrogel of the present invention in the detection of zinc ions. The experimental results show that the DNA hydrogel has strong recognition ability and selectivity for zinc ions, and can achieve specific detection of zinc ions; adopting the capillary detection method, the change in the volume of the sample to be detected can be visually seen, and thus it can be judged whether the sample to be detected contains zinc ions. The method of the present invention is simple to prepare, the detection method is intuitive and convenient for on-site operation, can be detected without complex instruments, and has low cost, providing a strong guarantee for the research and development of rapid, simple and economical heavy metal ion sensing technology. Brief Description of the Drawings

[0009] Figure 1 It is a schematic diagram of the morphological structure of the DNA hydrogel in Example 1; Figure 2 It is the fluorescence scanning result after the HCR product is cleaved by zinc ions; Figure 3 It is a schematic diagram of the morphological structure of the DNA hydrogel in Example 2; Figure 4 It is a schematic diagram of the morphological structure of the DNA hydrogel in Example 3; Figure 5 It is the specific detection result diagram of the present invention; Figure 6This is the sensitivity detection result graph of the present invention. Among them, graph a is the fluorescence detection graph, and graph b is the standard curve between fluorescence intensity and zinc ion concentration; Figure 7 This is the specificity graph of the visual detection system of DNA hydrogel combined with capillary. Among them, graph a is the column statistical graph, and graph b is the capillary observation result; Figure 8 This is the sensitivity graph of the visual detection system of DNA hydrogel combined with capillary; Figure 9 This is the schematic diagram of the result of detecting zinc ions in actual samples by DNA hydrogel combined with capillary. In the figure, the upper scale is blank, the middle scale is tea extract, and the lower scale is wine. Specific embodiments

[0010] The content of the present invention will be further illustrated by the following examples. However, these examples do not limit the protection scope of the present invention. The methods in the examples are all conventional methods without special instructions. The reagents used are all conventional commercially available reagents or reagents prepared according to conventional methods without special instructions; Example 1: Preparation of DNA hydrogel 1. Refer to the literature and design the H1 strand, H2 strand, and trigger probe according to the DNAzyme sequence of Zn 2+ . They were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the sequences are as follows: H1 strand: GATCGCGATCCTCACTATrAGGAAGAGATGAGTAAGCCATCTCTTCTCCG (SEQ ID NO:1); H2 strand: CATCTCTTCTCCGAGCCGGTCGAAATAGTGAGTCGGAGAAGAGATGGCTTACT (SEQ ID NO:2); Trigger probe: CATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT (SEQ ID NO:3); 2. Preparation of DNA hydrogel The synthesized H1 strand, H2 strand, and trigger probe were attached to the centrifuge tube wall in a very light dry film state. Centrifuge at 1000 r / min for 5 min to prevent loss. According to the DNA synthesis report form, dissolve the H1 strand and H2 strand with 1×TAE-Mg 2+ buffer solution to prepare an H1 strand solution and an H2 strand solution with a concentration of 720 μmol / L; denature the H1 strand solution and H2 strand solution at 95 °C for 10 min, and quickly cool to -4 °C and keep for 1 h to prepare a hairpin structure of H1 strand or H2 strand with a concentration of 720 μmol / L.

[0011] Mix 35 μL of the hairpin structure of H1 chain with a concentration of 720 μmol / L, 35 μL of the hairpin structure of H2 chain with a concentration of 720 μmol / L, and 7 μL of a 14.4 μmol / L trigger probe (prepared with 1×TAE-Mg 2+ buffer) according to a volume ratio of 5:5:1, incubate at 37 °C for 12 h to carry out a hybridization chain reaction to obtain a DNA hydrogel. Determine whether the hydrogel is formed based on the water stain on the filter paper. Place the DNA gel and water on the filter paper respectively. It can be seen from Figure 1 this that the DNA hydrogel will not leave a water stain on the filter paper, while water will form a water stain on the filter paper.

[0012] 3. Verification experiment that the DNA hydrogel (HCR product) can be specifically cleaved by zinc ions (1) Design H3 chain and H4 chain according to the enzyme chain and substrate chain of the DNAzyme of Zn 2+ ; Substrate chain: CTCACTATrAGGAAGAGATG; Enzyme chain (I): CATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT; H3 chain: CTCACTATrAGGAAGAGATGAGTAAGCCATCTCTTCTCCG; H4 chain: FAM-CATCTCTTCTCCGAGCCGGTCGAAATAGTGAGTCGGAGAAGAGATGGCTTACT-BHQ1; The synthesized H3 chain, H4 and enzyme chain adhere to the centrifuge tube wall in a very light dry film state. Centrifuge at 1000 r / min for 5 min to prevent loss. According to the DNA synthesis report form, dissolve the H3 chain, H4 chain and enzyme chain with 1×TAE-Mg 2+ buffer to prepare an H3 chain solution and an H4 chain solution with a concentration of 300 μmol / L and an enzyme chain solution with a concentration of 150 μmol / L; Mix 400 μL of the 300 μmol / L H3 chain solution, 400 μL of the H4 chain solution, and 80 μL of the 150 μmol / L enzyme chain solution, denature at 95 °C for 10 min to carry out an HCR reaction. After the reaction is completed, slowly cool to room temperature and stand for 2 h to obtain an HCR product; 40 μL of a zinc ion solution with a concentration of 100 μmol / L was added to the HCR product. At the same time, 40 μL of distilled water was added to the HCR product as a negative control, and the HCR product without adding any substances was used as a blank control. After standing for 60 min, the fluorescence of the three samples was scanned at a wavelength of 521 nm to detect the fluorescence signal intensity. The results are as Figure 2 shown. It can be seen from the figure that the fluorescence intensities of the experimental group with added zinc ions and the negative control group are higher than those of the blank control group. When zinc ions are present, the HCR product is cleaved, the fluorescence energy resonance transfer disappears, and the fluorescent group is exposed in the solution to emit a fluorescence signal, resulting in a higher fluorescence intensity in the experimental group than in the negative control group, indicating that the HCR product can be specifically cleaved by zinc ions.

[0013] Example 2: Preparation of DNA hydrogel The synthesized H1 or H2 strand adhered to the centrifuge tube wall as a very light dry film. Centrifuge at 1000 r / min for 5 min to prevent loss. According to the DNA synthesis report, use 1×TAE-Mg 2+ buffer to prepare an H1 strand solution, an H2 strand solution with a concentration of 320 μmol / L, and a trigger probe with a concentration of 50 μmol / L; denature the H1 strand solution and the H2 strand solution at 95 °C for 10 min, and quickly cool to -4 °C and keep for 1 h to obtain a hairpin structure of the H1 strand or the H2 strand with a concentration of 320 μmol / L. Mix 55 μL of the hairpin structure of the H1 strand with a concentration of 320 μmol / L, 35 μL of the hairpin structure of the H2 strand with a concentration of 320 μmol / L, and 7 μL of the trigger probe with a concentration of 150 μmol / L according to a volume ratio of 5:5:1, and incubate at 37 °C for 12 h for a hybridization chain reaction to obtain a DNA hydrogel. The results are shown in Figure 3 , and it can be seen from the figure that the DNA hydrogel does not produce water stains on the filter paper, indicating that the method of this example can form a hydrogel.

[0014] Example 3: Preparation of DNA hydrogel The synthesized H1 or H2 strand adhered to the centrifuge tube wall as a very light dry film. Centrifuge at 1000 r / min for 5 min to prevent loss. Dissolve with 1×TAE-Mg 2+ buffer to prepare an H1 strand solution, an H2 strand solution with a concentration of 640 μmol / L, and a trigger probe with a concentration of 100 μmol / L; denature the H1 strand solution and the H2 strand solution at 95 °C for 10 min, and quickly cool to -4 °C and keep for 1 h to obtain a hairpin structure of the H1 strand or the H2 strand with a concentration of 640 μmol / L.

[0015] Mix 35 μL of the hairpin structure of H1 chain with a concentration of 640 μmol / L, 35 μL of the hairpin structure of H2 chain with a concentration of 640 μmol / L, and 7 μL of the trigger probe with a concentration of 100 μmol / L in a volume ratio of 5:5:1, and incubate at 37 °C for 12 h to carry out a hybridization chain reaction to obtain a DNA hydrogel. The results are shown in Figure 4 , as can be seen from the figure, the DNA hydrogel does not produce water stains on the filter paper, indicating that the method of this example can form a hydrogel.

[0016] Example 4: Specificity detection experiment of the detection system To verify the specificity of the detection system of the present invention for Zn 2+ , mix 400 μL of 300 μmol / L H3 chain solution, 400 μL of 300 μmol / L H4 chain solution, and 80 μL of 150 μmol / L enzyme chain, and carry out HCR reaction by denaturing at 95 °C for 10 min. After the reaction is completed, the system is slowly cooled to room temperature and left standing for 2 hours to obtain the HCR product. Add 40 μL of Zn 2+ solution with a concentration of 10 μM to the HCR product, and after standing for 60 min, detect it with an enzyme-labeled instrument and analyze it through the fluorescence signal value; At the same time, measure the specificity of other different heavy metal ions (Pb 2+ , Cu 2+ , Ca 2+ , Fe 3+ , Ni 2+ , Cr 2+ , K + , Cd 2+ , Mn 2+ ) and the mixed solution for the detection system under the same above conditions. The mixed solution is a liquid obtained by mixing the above 10 metal ions according to the above concentrations.

[0017] The results are shown in Figure 5 , as can be seen from the figure, when the concentration of Zn 2+ is 10 μM and the concentrations of other metal ions are 1 mM, the fluorescence intensity of the experimental group adding Zn 2+ is significantly higher than that of the experimental groups adding other metal ions. In the case of mixed detection, the fluorescence intensity of the mixed solution group is also significantly higher than that of the experimental groups adding other metal ions; the experimental results show that the detection system of the present invention has specificity and anti-interference ability for zinc ions, so the constructed detection system can specifically detect the target heavy metal ions.

[0018] Example 5: Sensitivity detection experiment of the detection system To verify the sensitivity of the developed detection system, Zn 2+The solution was prepared into solutions with different concentrations, namely 0, 10 nM, 30 nM, 50 nM, 70 nM, 80 nM, 90 nM, 100 nM, 500 nM, 900 nM, 10 μM, and 30 μM. The preparation of the HCR product in this example was the same as that in Example 4; The Zn solution with the above concentrations was added to the HCR product 2+ After standing for 60 min, the fluorescence intensity was detected using a microplate reader at a wavelength of 521 nm. By measuring the fluorescence intensities of a series of samples with known zinc ion concentrations, a standard curve between the fluorescence intensity and the zinc ion concentration was plotted to obtain a linear equation.

[0019] The results are shown in Figure 6 a. In the range of 0 - 30 μM, the fluorescence intensity increased with the increase in the concentration of Zn. In the concentration range of 10 - 90 nM, ΔF showed a linear relationship with the concentration ( 2+ b). For the detection system of Zn, the linear equation was Y = 1312.55287X + 17185.68621 (X is in nM), the linear correlation coefficient was R Figure 6 = 0.99939, and the detection limit was 0.41 nM. The detection system of the present invention has high sensitivity and a wide detection limit. 2+ 2 2+ Example 6: Visual detection of DNA hydrogel combined with capillary

[0020] 1. The DNA hydrogel was prepared by referring to the method in Step 2 of Example 1; 2. 10 μL of the Zn solution with a concentration of 10 μM was added to the DNA hydrogel, and at the same time, 10 μL of metal ion solutions with the same concentration (Pb 2+ 2+ 2+ 3+ 2+ 2+ + 2+ 2+ 3+ 2+ 2+ + 2+ 2+ + 2+ 2+ Mn 2+ ), etc.) were added. At the same time, a blank control without adding metal solution was set. After standing for 60 min, the reacted liquid was aspirated with a capillary, and the capillary was placed above a scale for reading, with two decimal places reserved. The results are shown in Figure 7 . It can be seen from the figure that the flowing distance of the experimental group solution after adding the zinc ion solution is higher than that of other metals, and the flowing distances of other metal ions are not much different from the blank, indicating that zinc ions have a specific cleavage effect on the HCR product in the DNA hydrogel, destroying the DNA hydrogel network structure and forming a sol liquid.

[0021] 3. To verify the detection sensitivity of the DNA hydrogel and capillary binding detection system, zinc ion solutions with concentrations of 0.7, 0.9, 1, 3, 5, 7, 9, 10, 30, 50, and 70 μM were added to the DNA hydrogel. After standing for 60 min, the liquid after the reaction was aspirated with a capillary. The capillary was placed above a scale for reading, and two decimal places were retained. A standard curve was plotted based on the liquid flow distance in the capillary and the zinc ion concentration, and the linear regression equation Y = 0.05706X + 1.4663 (R 2 = 0.99135) was obtained. The results are shown in Figure 8 . As can be seen from the figure, there is a good linear relationship between the Zn 2+ concentration in the range of 1 - 9 μM. The results indicate that the liquid flow distance in the capillary can be used to determine the zinc ion concentration in the sample to be detected, achieving the purpose of quantitative detection.

[0022] Example 7: Detection of actual samples using DNA hydrogel 1. The DNA hydrogel was prepared according to the method in step 2 of Example 1. 2. Green tea and wine were selected as the detection samples. The tea leaves were ground, sieved to remove the stems, and 0.05 g was weighed. It was dissolved in 1 mL of ultrapure water and extracted at 90 °C in a constant temperature mixer at 600 r / min for 30 min. After cooling to room temperature, it was centrifuged at 10,000 r / min for 15 min, and 1 mL of the extract was obtained by filtering through a 0.22 μM filter; the wine was used as the detection sample in its original form; the pH of the green tea extract and the wine was adjusted to 7.4 - 8.0.

[0023] 3. Detection of the combination of DNA hydrogel and capillary 20 μL of the tea extract or wine was added to the prepared DNA hydrogel. At the same time, a blank control with 20 μL of distilled water added was set. After shaking well, it was left standing at room temperature for 60 min. The liquid after the reaction was aspirated with a capillary. If the tea soup or wine contains zinc ions, the DNA hydrogel will be cleaved. Finally, the amount of the collapsed DNA hydrogel was aspirated with a capillary. The capillary was placed above a scale for reading, and two decimal places were retained. To ensure the accuracy and reliability of the constructed detection system, three replicates were performed. The capillary results are shown in Figure 9 . It can be clearly seen that the flow distances of the tea soup and the wine are significantly higher than those of the blank control group, indicating that metal zinc ions were detected in the tea soup and the wine.

Claims

1. A DNA hydrogel, characterized in that: DNA hydrogel is prepared by hybridization chain reaction using the hairpin structure of H1 chain, the hairpin structure of H2 chain and trigger probe; The nucleotide sequence of the H1 chain is GATCGCGATCCTCACTATrAGGAAGAGATGAGTAAGCCAT CTCTTCTCCG; The nucleotide sequence of the H2 chain is CATCTCTTCTCCGAGCCGGTCGAAATAGTGAGTCGGAGAAGA GATGGCTTACT; The nucleotide sequence of the trigger probe is CATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT.

2. The DNA hydrogel according to claim 1, characterized in that: The hairpin structure of the H1 chain or the hairpin structure of the H2 chain is obtained by mixing the H1 chain or the H2 chain with 1×TAE-Mg 2+ After the buffer solution is dissolved, it is denatured at 95°C for 10 min, rapidly cooled to -4°C and kept for 1 h.

3. The DNA hydrogel according to claim 1, characterized in that: The hairpin structure of the H1 chain at a concentration of 320-720 μmol / L, the hairpin structure of the H2 chain at a concentration of 320-720 μmol / L, and the trigger probe at a concentration of 14.4-100 μmol / L were mixed, and incubated at 37° C. for 12 h for hybridization chain reaction to obtain a DNA hydrogel, wherein the added amounts of the hairpin structure of the H1 chain and the hairpin structure of the H2 chain were equal.

4. Use of the DNA hydrogel described in any one of claims 1 to 3 in zinc ion detection.

5. The use according to claim 4, characterized in that: The sample to be tested is added to the DNA hydrogel, and after standing, the liquid in the mixture is absorbed by a capillary. When the volume of the liquid in the capillary is significantly higher than the volume of the added sample to be tested, it indicates that the sample to be tested contains zinc ions.

Images