Method for screening beta-zearalenol aptamer based on Capture-SELEX (systematic evolution of ligands by exponential enrichment) technology
Screening of β-ZOL aptamers through Capture-SELEX technology solves the screening problems in the existing technology, achieves high sensitivity and specificity detection, and improves the ability of food safety detection.
Patent Information
- Application Number
- CN202510270052.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-07
- Publication Date
- 2025-05-30
AI Technical Summary
The prior art is difficult to effectively screen β-zeal gibberellenol (β-ZOL) aptamers, limiting the sensitivity and specificity of food safety detection.
β-ZOL was screened using Capture-SELEX technology, and nucleic acid aptamers with high affinity and specificity were screened through 11 rounds of enrichment and high-throughput sequencing.
It realizes high sensitivity and high specificity detection of β-ZOL, provides fast and economical detection methods, and improves the ability of food safety detection.
Smart Images

Figure CN120060267A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of screening of β-zearalenol aptamers, and particularly relates to a method for screening β-zearalenol aptamers based on Capture-SELEX technology. Background Art
[0002] β-zearalenol (β-ZOL) is a reduced metabolite produced by zearalenone (ZEN), and its analogues also include α-zearalenol (α-ZOL). ZEN is one of the most common and widely distributed mycotoxins, which widely exists in important crops such as corn, wheat, and sorghum. It has a strong estrogenic effect on animals and humans, leading to reproductive disorders and decreased fertility. Therefore, it is classified as a Group 3 carcinogen by the International Agency for Research on Cancer (IARC) of the World Health Organization. Some tissues of animals can generate ZOL from ZEN, including the intestine, liver, and even blood. The severe toxic effects of ZOL will cause circular pollution and harm through the enrichment of the food chain, bringing huge health risks to humans and animals.
[0003] Traditional detection techniques such as instrumental analysis and immunoassay methods are currently used for the accurate and sensitive detection of mycotoxins. However, the requirements of expensive and complex instrument configurations, instability, and extensive sample pretreatment processes limit the on-site application of these methods. As an alternative to antibodies, nucleic acid aptamers are short oligonucleotide sequences of ssDNA or RNA molecules screened by the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology in vitro. Nucleic acid aptamers can recognize a variety of targets, including pathogens, cells, bacteria, proteins, viruses, small molecules of agricultural veterinary drugs, mycotoxins, metal ions, and so on. They mainly form secondary structures such as hairpins, pseudoknots, bulges, G-quadruplexes, and T-junctions through intrastrand folding. The chemical groups at the key sites of these spatial conformations are close to some chemical groups of the target molecule, and then tightly bind to the target molecule based on hydrogen bonds, van der Waals forces, hydrophobic and electrostatic interactions, or base stacking, and can distinguish structurally similar targets. Aptamers not only have high affinity and specificity, but also have the advantages of a wide target range, short selection cycle, small molecular weight, low cost, stable properties, easy synthesis and modification, etc. In recent decades, the technology of SELEX has been further innovated and developed, such as graphene oxide-SELEX, capillary electrophoresis-SELEX, cell-SELEX, fluorescence-activated cell sorting-SELEX, etc. However, there are still huge gaps and difficulties in the screening of small molecules by these methods, probably because small molecules are difficult to immobilize on solid carriers, lack functional groups for coupling, and the affinity of small molecule targets is much lower than that of macromolecule targets and other influencing factors.
[0004] At present, relevant research on the screening of β-ZOL aptamers has not been reported. Based on the demand for food safety detection and the actual application potential of aptamers, there is an urgent need for β-ZOL aptamers. Summary of the Invention
[0005] The present invention aims at the technical problems to be solved, overcomes the deficiencies of the prior art, and provides a method for screening β-zearalenol aptamers based on Capture-SELEX technology.
[0006] One of the purposes of the present invention is to provide β-zearalenol aptamers screened based on Capture-SELEX technology, and the nucleotide sequences of the β-zearalenol aptamers are shown in SEQ ID NO.1 and / or SEQ ID NO.2.
[0007] The second purpose of the present invention is to provide a method for screening β-zearalenol aptamers based on Capture-SELEX technology, including the following steps: Step 1: Using β-zearalenol as the target small molecule, perform 11 rounds of screening on the initial library, and adopt the Capture-SELEX method to enrich the sequences specifically recognizing the target. Step 2: Perform high-throughput sequencing on the enriched library obtained by specifically recognizing the target, and then perform Kmer splicing analysis to select 5 candidate nucleic acid aptamers Seq7, Seq10, Seq20, Seq39, and Seq41. Step 3: Modify the 5' end of the candidate nucleic acid aptamer with FAM fluorescence labeling, and modify the 3' end of the capture strand (cDNA) with a Dabcyl quenching group. Use the fluorescence quenching-recovery method to test the affinity and specificity of the 5 candidate nucleic acid aptamers, and obtain two nucleic acid aptamers Seq7 and Seq10 with high affinity.
[0008] The present invention uses Capture-SELEX technology to screen the aptamers of β-ZOL, gradually optimizes the screening process and conditions to improve the success rate of screening small molecule target aptamers, and finally verifies the affinity and specificity of the enriched sequences, providing a reference for the development of a rapid detection method for β-ZOL.
[0009] The further optimized technical solution of the present invention is as follows: Preferably, the sequence of the initial library of the β-zearalenol aptamer is 5ˊ-GGAGGCTCTCGGGACGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGTCCCGATGCTGCAATCGTAA-3ˊ.
[0010] The specific operations of step 1 are as follows: Step 1.1, hybridization of the initial library and the capture strand (cDNA) - After mixing the initial library and cDNA in the screening buffer, heat them in a water bath at 95°C for 10 minutes and then slowly cool to room temperature; Step 1.2, preparation of the microgravity column - Add streptavidin agarose beads to the microgravity column and wash the microgravity column with the screening buffer; Step 1.3, capture of the complex of the initial library and the capture strand by the agarose beads - Add the complex of the initial library and the capture strand to the agarose beads, collect the complex filtrate after gravity outflow, and add the filtrate again twice to couple the DNA library and cDNA complex to the column to the maximum extent; Step 1.4, wash the agarose beads to remove the unbound initial library - Add the screening buffer to wash the agarose beads, collect the washing solution, and retain the 10th washing solution (Wash10) for quantification; Step 1.5, add the eluent with the target for positive screening - Add the eluent to the agarose beads, repeat the elution twice, and retain the supernatant of the three elutions, that is, the positive screening eluent; Step 1.6, perform real-time fluorescence quantitative polymerase chain reaction (qPCR) quantification on the positive screening eluent in step 1.5 and the washing solution in step 1.4; Step 1.7, after concentrating the positive screening eluent, PCR amplify the DNA sequence in the concentrate using a forward primer, a biotin-labeled reverse primer, and Taq polymerase; Step 1.8, preparation of single-stranded DNA - Capture the double-stranded DNA in the PCR amplification result with streptavidin-modified agarose magnetic beads, wash the magnetic beads capturing the double-stranded DNA with NaOH solution, and centrifuge to collect the supernatant, which is the single-stranded DNA; Step 1.9, perform Capture-SELEX cycles on the enriched single-stranded DNA library according to steps 1.1 to 1.8 until 11 rounds are completed.
[0011] In the present invention, biotin-labeled capture strand (cDNA) is hybridized with a random library through Capture-SELEX, and the library is immobilized on a streptavidin-modified solid-phase carrier. The library is eluted using a free target, and the weaker or unbound sequences are still retained on the solid-phase carrier. The amount of substance of the single-stranded DNA screened out in each round is monitored by real-time fluorescence quantitative PCR (qPCR), all eluents are PCR amplified, and finally single-stranded DNA is prepared by the biotin-streptavidin magnetic bead method. Repeat the above steps 11 rounds, and finally perform high-throughput sequencing on the enriched library, and use the affinity evaluation technology to measure the dissociation constant (KD) and specificity to obtain the nucleic acid aptamer of β-ZOL.
[0012] The specific operations of step 1.8 are as follows: Step 1.8.1, Mix streptavidin-modified magnetic beads - Place the agarose magnetic beads modified with streptavidin on a rotator and rotate at room temperature for 15 minutes. Take 100 μL and place it in a centrifuge tube for standby; Step 1.8.2, Remove non-covalently coupled streptavidin on the magnetic beads - In the centrifuge tube containing 100 μL of the mixed magnetic beads, magnetically separate and remove the supernatant. Add 100 μL of 100 mM NaOH solution, pipette and mix well, rotate and mix at room temperature for 5 minutes, magnetically separate and remove the supernatant. Then add 1 mL of 1× PB / NaCl buffer to the centrifuge tube, magnetically separate and remove the supernatant, and repeat 2 times to remove the supernatant; Step 1.8.3, Capture double-stranded DNA in the PCR mixture with streptavidin-modified agarose magnetic beads - Add 400 μL of the PCR mixture and 400 μL of 2×PB / NaCl buffer to each centrifuge tube, and rotate and mix at room temperature for 2 hours; Step 1.8.4, Elute with NaOH - After washing the magnetic beads 3 times with 500 μL of 1×PBS / NaCl, pipette 100 μL of 200 mM NaOH to soak the magnetic beads capturing double-stranded DNA, mix well at room temperature for 30 minutes, magnetically separate and collect the supernatant, which is the single-stranded DNA library; Step 1.8.5, Quantify the library - Neutralize the single-stranded DNA library with an equal amount of HCl, and perform concentration quantification by measuring the ultraviolet-visible absorption intensity at 260 nm.
[0013] In step 1.1, the sequence of the capture strand is 5ˊ-GTCGTCCCGAGAGCCATA-BioTEG-3ˊ; in step 1.7, the sequence of the forward primer is 5ˊ- GGAGGCTCTCGGGACGAC-3ˊ, and the sequence of the reverse primer is 5ˊ-TTACGATTGCAGCATCGGGACG-3ˊ.
[0014] The specific operations of step 1.6 are as follows: Step 1.6.1, Prepare the initial library standards and samples to be tested - Use nuclease-free water to prepare the following 7 initial library Pool solutions with different concentrations as standards, and the DNA concentrations are 1000 pM, 100 pM, 10 pM, 1 pM, 0.1 pM, and 0.01 pM respectively; at the same time, prepare the sample solution to be tested with a concentration range of 0.01 pM to 1000 pM; Step 1.6.2, Preparation of qPCR solution - Prepare according to the formula that every 100 μL of qPCR solution contains 10 μL of 2×Premix Taq hot start enzyme, 2 μL of FP (5 μM), 2 μL of RP (5 μM), 3 μL of nuclease-free water, 1 μL of 20×Eva Green nucleic acid dye, and 2 μL of sample; Step 1.6.3, Set the qPCR instrument program - The first step is to preheat at 95°C for 1 minute; the second step is to heat at 95°C for 30 seconds; the third step is to anneal at 51°C for 30 seconds; the fourth step is to extend at 72°C for 30 seconds. The second to fourth steps are cycled 34 times, and the fluorescence signal is collected in the fourth step each time; Step 1.6.4, Draw a working curve based on the data of the standard samples collected. The abscissa of the curve represents the concentration points from high to low, and the ordinate is the average Ct value. Calculate the amount of DNA contained in the unknown sample based on the working curve and the Ct value of the sample to be tested.
[0015] The specific operation of the said Step 1.7 is as follows: After concentrating the positive screening eluate to 100 μL, prepare the PCR mixture. According to the formula that every 100 μL of PCR mixture contains 50 μL of 2×Premix Taq Hot Start; 10 μL of forward primer FP (5 μM), 10 μL of reverse primer RP (5 μM), 20 μL of nuclease-free water, and 10 μL of positive screening concentrate; the amplification conditions are pre-denaturation at 95°C for 60 s, denaturation at 92°C for 15 s, annealing at 61°C for 30 s, and extension at 72°C for 45 s.
[0016] The specific operation of the said Step 3 is as follows: Step 3.1, Modify the 5' end of each candidate nucleic acid aptamer with FAM, label the 3' end of the capture strand with Dabcyl, and make it partially complementary to the 5' end of the candidate nucleic acid aptamer; Step 3.2, Dissolve the FAM-labeled candidate aptamer in a buffer solution (1 M NaCl, 20 mM MgCl 2 , 5.4 mM KCl, 20 mM, 3.6 mM KH 2 PO 4 , PH = 7.4), incubate at 95°C for 10 minutes, and slowly cool at room temperature for 20 minutes; Step 3.3, Hybridize the FAM-labeled aptamer with the capture strand at a molar ratio of 1:5. Mix the aptamer and the capture strand in the buffer solution, incubate at 95°C for 10 minutes, and slowly cool at room temperature for 20 minutes; Step 3.4: Add β-zeranol with a concentration of 10 μM to the FAM-aptamer-quencher complex I0, allowing β-zeranol to competitively bind to the aptamer. After thorough vortex mixing, incubate at room temperature for 30 minutes. Step 3.5: Record the fluorescence spectra of the samples prepared in Steps 3.2 - 3.4 under an excitation light of 494 nm, with an emission range of 500 to 590 nm. All fluorescence spectra are measured under the same conditions, and the change in fluorescence intensity is determined by comparing the fluorescence intensities of different solutions at 520 nm.
[0017] A third object of the present invention is to provide the application of the β-zeranol aptamer prepared by the above method in food safety detection.
[0018] The starting random sequence of the present invention contains a 30-nt random sequence library and constant primer region binding regions at both ends. In the library design, a short stem (8 - 10 nt) is formed by a part of the two primer regions. After the capture strand (cDNA) part hybridizes with the starting random library, it can compete with the short stem through structural switching during target binding. Capture-SELEX hybridizes biotin-labeled cDNA with the random library and immobilizes the library on a streptavidin-modified solid-phase carrier. The library is eluted using the free target, and the weaker or unbound sequences remain on the solid-phase carrier. The amount of single-stranded DNA selected in each round is monitored by real-time fluorescence quantitative PCR (qPCR). All eluates are amplified by PCR, and finally single-stranded DNA is prepared by the biotin-streptavidin magnetic bead method. Repeat the above steps 11 times, and finally perform high-throughput sequencing on the enriched library, and use the affinity evaluation technology to determine the dissociation constant (KD) and specificity to obtain the nucleic acid aptamer of β-ZOL. The method of the present invention immobilizes the library on a solid-phase matrix, avoiding the disadvantages of few binding sites for small molecule targets and lack of immobilization functional groups, with simple operation and easy optimization of experimental conditions. Moreover, the two candidate nucleic acid aptamers obtained by the present invention respectively have the characteristics of high affinity and high specificity, and the excellent performance of the selected nucleic acid aptamer fully confirms the feasibility of the method of the present invention.
[0019] The present invention first uses the Capture-SELEX technology to screen for β-ZOL aptamers, without modifying small molecules, with good specificity, high sensitivity, and strong affinity, and can achieve highly sensitive and rapid detection of β-ZOL without professional instrument assistance; the library designed by the present invention is more conducive to the binding of the target and the sequence, and is conducive to the formation of the stem-loop structure, which is more conducive to the library detaching from the solid-phase carrier; in the present invention, the concentration of the positive selection target decreases in a gradient, from 100 μmol / L in the first round to 20 μmol / L in the 11th round, which is more conducive to the enrichment of β-ZOL aptamers with high affinity. Brief Description of the Drawings
[0020] Figure 1 It is a flow chart of Capture-SELEX. Among them, A is the design of the DNA library used in Capture-SELEX; B is the specific process of Capture-SELEX.
[0021] Figure 2 It is a fluorescence spectrogram for measuring the relative affinity of 5 candidate nucleic acid aptamers by using the fluorescence resonance energy transfer method.
[0022] Figure 3 It is a specific characterization diagram for measuring Seq7 and Seq10 by using the fluorescence resonance energy transfer method.
[0023] Figure 4 It is a dissociation constant diagram for measuring Seq7 and Seq10 by using the fluorescence resonance energy transfer method.
[0024] Figure 5 It is a secondary structure diagram for simulating Seq7 and Seq10 by using RNAstructure. Detailed Description of the Invention
[0025] The technical solution of the present invention will be further described in detail below in conjunction with the embodiments: These embodiments are implemented on the premise of the technical solution of the present invention, and detailed implementation manners and specific operation processes are given, but the protection scope of the present invention is not limited to the following embodiments.
[0026] The starting random sequence of the present invention includes a 30-nt random sequence library and constant primer region binding regions at both ends. In library design, a short stem (8-10 nt) is formed by a part of the two primer regions. The capture strand (cDNA) that can partially hybridize with the starting random library can compete with the stem through structural switching during target binding. Capture-SELEX hybridizes the biotin-labeled cDNA with the random library and immobilizes the library on a streptavidin-modified solid-phase carrier. The library is eluted with the free target, and the weakly or unbound sequences are still retained on the solid-phase carrier. The amount of single-stranded DNA selected in each round is monitored by real-time fluorescence quantitative PCR (qPCR), all eluates are amplified by PCR, and finally single-stranded DNA is prepared by the biotin-streptavidin magnetic bead method. The above steps are repeated 11 rounds, and finally the enriched library is subjected to high-throughput sequencing, and the dissociation constant (KD) and specificity are measured by using the affinity evaluation technology to obtain the nucleic acid aptamer of β-ZOL.
[0027] The overall technical solution of the present invention includes the following process: 1. Using β-ZOL as a target small molecule, 11 rounds of Capture-SELEX were carried out to enrich sequences that specifically recognize the target (the experimental parameters for each round are shown in Table 3).
[0028] 2. High-throughput sequencing of the enriched library.
[0029] 3. Affinity and specificity tests for screening candidate aptamer sequences.
[0030] The materials and reagents mentioned in this invention can be purchased from domestic and foreign commercial channels or obtained from free channels by the public, and will not be elaborated here one by one. The names, sequences and uses of the DNA used in this invention are shown in Table 1. The reagents used in this invention are shown in Table 2.
[0031] Table 1 Name Sequence (5’-3’) Use Pool GGAGGCTCTCGGGACGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGTCCCGATGCTGCAATCGTAA Screen the initial library cDNA GTCGTCCCGAGAGCCATA Capture strand, hybridize with the library FP GGAGGCTCTCGGGACGAC Forward primer, for PCR amplification and high-throughput sequencing RP TTACGATTGCAGCATCGGGACG Reverse primer, for high-throughput sequencing Biotin-RP Biotin-TTACGATTGCAGCATCGGGACG 5’-end biotinylated reverse primer, for PCR amplification Seq7 GGAGGCTCTCGGGACGACGGGCATCTGGGTGGGTACGGGGTGATTCCTGTCGTCCCGATGCTGCAATCGTAA One of the selected candidate nucleic acid aptamers of β-ZOL Seq10 GGAGGCTCTCGGGACGACCATATACTGGGTGGGTACGGGGTGTAGCTGGTCGTCCCGATGCTGCAATCGTAA One of the selected candidate nucleic acid aptamers of β-ZOL Seq20 GGAGGCTCTCGGGACGACCGGGATGTGGGTGGGTACGGGGTCATTTAGGTCGTCCCGATGCTGCAATCGTAA One of the selected candidate nucleic acid aptamers of β-ZOL Seq39 GGAGGCTCTCGGGACGACCATGCCTGGGTGGGTACGGGGTGGCGTTAGGTCGTCCCGATGCTGCAATCGTAA One of the selected candidate nucleic acid aptamers of β-ZOL Seq41 GGAGGCTCTCGGGACGACCACTATCTGGGTGGGTACGGGGTGTTGGGGGTCGTCCCGATGCTGCAATCGTAA One of the selected candidate nucleic acid aptamers of β-ZOL FAM-Seq7 FAM-GGAGGCTCTCGGGACGACGGGCATCTGGGTGGGTACGGGGTGATTCCTGTCGTCCCGATGCTGCAATCGTAA FAM-labeled Seq7, for the determination of specificity and dissociation constant based on fluorescence resonance energy transfer method FAM-Seq10 FAM-GGAGGCTCTCGGGACGACCATATACTGGGTGGGTACGGGGTGTAGCTGGTCGTCCCGATGCTGCAATCGTAA FAM-labeled Seq10, for the determination of specificity and dissociation constant based on fluorescence resonance energy transfer method cDNA-Dabcyl GTCGTCCCGAGAGCCATA-Dabcyl Dabcyl-modified capture strand for determining the dissociation constant of the selected aptamer with β-ZOL Table 2 Chinese name Full English name or abbreviation Purchased company β-Zearalenol β-ZOL Aladdin (Shanghai) α-Zearalenol α-ZOL Prionex (Qingdao) Aflatoxin B1 AFB1 Prionex (Qingdao) Ochratoxin A OTA MCE (Shanghai) Streptavidin agarose magnetic beads MAg25K / Streptavidin Innovative Reagents (Suzhou) Streptavidin agarose gel beads Streptavidin Agarose beads Thermo scientific (USA) 20×Eva Green nucleic acid dye 20×Eva Green nucleic acid dye Biotium (USA) Super Red nucleic acid dye Super Red acid dye Biosharp (Beijing) 2×Premix Taq Hot Start enzyme 2×Premix Taq Hot Start Veron Takara (Japan) 2×RNA Loading Buffer 2×RNA Loading Buffer Takara (Japan) 20 bp DNA Ladder 20 bp DNA Ladder Takara (Japan) RNase-free Water RNase-free Water Takara (Japan) Mini gravity column Mini gravity column Bio-Rad (Shanghai) Example 1 Screening of β-ZOL aptamer using Capture-SELEX
[0032] The chemically synthesized DNA random library (see A in Figure 1 and Table 1) consists of three major parts, namely the primer binding regions at both ends and the middle random sequence region. The flanking regions of the library include primer sequences and capture regions. In the library design, a short stem (8 - 10 nt) is formed by a part of the two primer regions. The capture strand (cDNA) that can partially hybridize with the starting random library can compete with the stem through structural switching during target binding. When designing the primer sequences, we removed the primers that were expected to form heterodimers or homodimers. Moreover, the melting temperatures (Tm) of the primers were similar to ensure clear bands after PCR.
[0033] Using β-ZOL as a target small molecule, 11 rounds of Capture-SELEX were carried out to enrich sequences that can recognize the target. The experimental parameters for each round are shown in Table 3, and the specific steps are as follows: Step 1. Hybridization of the DNA library with the capture strand (cDNA): For the first round, 200 pmol of the DNA library was selected. After determining the library concentration, 5 molar ratios of cDNA were used. The DNA library and cDNA were prepared in 250 μL of screening buffer (1 M NaCl, 20 mM MgCl 2 , 5.4 mM KCl, 20 mM, 3.6 mM KH 2 PO 4 , PH = 7.4). The above solution was heated in a 95°C water bath for 10 minutes and slowly cooled to room temperature.
[0034] Step 2. Preparation of the microgravity column: Step 2.1. Add 200 μL of streptavidin agarose beads to the microgravity column; Step 2.2. Wash the microgravity column 5 times with the screening buffer.
[0035] Step 3. Agarose beads capture the DNA library and cDNA complex: Add the hybridization complex of the DNA library and cDNA to the microgravity column containing streptavidin agarose beads. After gravity flow-through, collect the complex filtrate, and add the filtrate 2 more times to couple the DNA library and cDNA complex to the column to the maximum extent.
[0036] Step 4. Wash the microgravity column containing agarose beads to remove the unbound library: Add 250 μL of the screening buffer to the microgravity column containing agarose beads and wash 10 times, and collect the washing solution. Retain the washing solution of the 10th time (Wash10) for quantification.
[0037] Step 5. Add the eluent containing the target β-zearalenol for positive screening: For the target β-ZOL, select the dry powder with a purity above 98% to avoid impurity competition binding or interference with the screening. In the previous rounds of screening, a higher concentration of the target is required to elute the sequences that can bind to it, so as to avoid difficult competition for binding to the aptamer. Add the eluent with the target with a total volume of 250 μL to the agarose beads, repeat the elution twice, and retain the supernatant of the three elutions, that is, the positive screening eluent.
[0038] Step 6. Quantify the positive screening eluent in Step 5 and the washing solution in Step 4 by real-time fluorescence quantitative polymerase chain reaction (qPCR).
[0039] Step 7. Concentrate the positive screening eluent to about 100 μL, amplify the DNA sequence by polymerase chain reaction (PCR), using the forward primer, biotin-labeled reverse primer, and Taq polymerase.
[0040] Step 8. Prepare single-stranded DNA: Step 8.1. Mix the streptavidin-modified agarose magnetic beads: Place the streptavidin-modified agarose magnetic beads on a rotator and rotate at room temperature for 15 minutes. Take 100 μL and place it in a centrifuge tube for standby.
[0041] Step 8.2. Remove the non-covalently coupled streptavidin on the magnetic beads: In the centrifuge tube containing 100 μL of the mixed magnetic beads, magnetically separate to remove the supernatant. Add 100 μL of 100 mM NaOH solution, use a pipette to blow and mix to fully mix it, rotate and mix at room temperature for 5 minutes, and magnetically separate to remove the supernatant. Add 1 mL of 1×PB / NaCl buffer (20 mM NaH 2 PO 4 ,20 mM Na2 HPO 4 , 2M NaCl), magnetically classify to remove the supernatant, and repeat 2 times to remove the supernatant.
[0042] Step 8.3 Capture double-stranded DNA in the PCR mixture with streptavidin-modified agarose magnetic beads: Add 400 μL of the PCR mixture and 400 μL of 2× PB / NaCl buffer to each centrifuge tube, and rotate and mix at room temperature for 2 hours.
[0043] Step 8.4 NaOH elution: After washing the magnetic beads 3 times with 500 μL of 1× PBS / NaCl, use a pipette to soak the magnetic beads capturing double-stranded DNA with 100 μL of 200 mM NaOH, mix at room temperature for 30 minutes, and then magnetically separate to collect the supernatant, which is the single-stranded DNA library.
[0044] Step 8.5 Library quantification: Neutralize the above single-stranded DNA library with an equal amount of HCl, and perform concentration quantification by measuring the absorbance intensity of the ultraviolet spectrum at 260 nm (nanometers).
[0045] Step 9. The library enriched in the first round enters the next round of Capture-SELEX cycle according to the above steps until 11 rounds are completed.
[0046] After the above steps are completed, perform commercial high-throughput sequencing on the enriched library obtained in the 11th round. Then test the affinity and specificity of the candidate nucleic acid aptamers, and finally screen out the optimal nucleic acid aptamers.
[0047] Table 3. Experimental parameters of 11 rounds of Capture-SELEX for library enrichment Number of rounds DNA library (pmol) β-ZOL (μM) Temperature 1 200 100 Room temperature 2 100 100 Room temperature 3 100 100 Room temperature 4 100 100 4℃ 5 100 80 Room temperature 6 100 100 Room temperature 7 100 100 Room temperature 8 100 100 Room temperature 9 100 50 Room temperature 10 50 20 Room temperature 11 50 20 Room temperature Each round of screening is carried out in the screening buffer: 1 M NaCl, 20 mM MgCl 2 , 5.4 mM KCl, 20 mM, 3.6 mM KH 2 PO 4 , PH 7.4. All screening steps are carried out at room temperature. Example 2 Monitoring of the screening process
[0048] Monitor the library enrichment in each round, and use real-time quantitative PCR technology (qPCR) and gel electrophoresis to semi-quantitatively evaluate the positive screening and background elution amounts of the library in each round. The specific operation steps of the qPCR experiment are as follows: 1. Preparation of the initial library standard and the sample to be tested: Prepare the following 7 initial library Pool solutions with different concentrations as standards using nuclease-free water, with DNA concentrations of 1000 pM (picomoles per liter), 100 pM, 10 pM, 1 pM, 0.1 pM, and 0.01 pM respectively. The sample can be diluted by different multiples according to the actual situation to make its final concentration within the range of the above standard concentrations.
[0049] 2. Preparation of qPCR solution (in triplicate for each solution): Prepare according to the formula that each 100 μL of qPCR solution contains 10 μL of 2×Premix Taq hot start enzyme, 2 μL of FP (5 μM), 2 μL of RP (5 μM), 3 μL of nuclease-free water, 1 μL of 20×EvaGreen nucleic acid dye, and 2 μL of the sample.
[0050] 3. Set the qPCR instrument program: The first step is to preheat at 95°C for 1 minute; the second step is to heat at 95°C for 30 seconds; the third step is to anneal at 51°C for 30 seconds; the fourth step is to extend at 72°C for 30 seconds. The second to fourth steps are cycled 34 times, and the fluorescence signal is collected in the fourth step each time.
[0051] 4. Place the qPCR solution into the sample cell and set the solution name and fluorescence type at the corresponding positions.
[0052] 5. The qPCR instrument starts to work. After completion, draw a working curve based on the data of the standard samples collected, and calculate the amount of DNA contained in the unknown sample based on the working curve and the Ct value of the sample to be tested.
[0053] The amounts of the positive selection eluate and Wash10 from the 1st round to the 11th round were counted (see Table 4). It can be seen that as the number of rounds increases, the ratio of the two gradually increases until the ratio of the positive selection eluate to Wash10 exceeds 20, even though the target concentration decreased in the last few rounds.
[0054] Table 4. Quantification of the positive selection eluate and Wash10 in 11 rounds of Capture-SELEX Number of rounds Positive screening (pmol) Wash10 (pmol) Positive screening / Wash 1 1.02 0.21 4.84 2 0.85 0.13 6.28 3 1.39 0.24 5.79 4 0.33 0.07 4.77 5 0.79 0.26 3.04 6 4.16 1.47 2.83 7 9.07 1.21 7.49 8 17.98 2.29 7.84 9 19.56 0.10 195.6 10 10.30 0.48 21.46 11 7.13 0.16 44.56 Example 3 High-throughput sequencing of the R11 library
[0055] Perform commercial high-throughput sequencing on the above R11 library. After PCR amplification of the R11 library (the R11 library refers to the library obtained after the 11th round of screening, that is, perform high-throughput sequencing on the library screened in the last round), the purified amplification product is subjected to high-throughput sequencing. Amplify the target sequence by a two-step PCR method and be compatible with the preparation of the Illumina sequencing library. The specific operation steps are as follows: 1. After concentrating the positive screening eluate to 100 μL, prepare the PCR mixture. For every 100 μL of the PCR mixture, it contains 50 μL of 2×Premix Taq Hot Start; 10 μL of forward primer FP (5 μM), 10 μL of reverse primer RP (5 μM), 20 μL of nuclease-free water, and 10 μL of the concentrated positive screening solution. Amplification conditions: pre-denaturation at 95°C for 60 s, denaturation at 92°C for 15 s, annealing at 61°C for 30 s, and extension at 72°C for 45 s.
[0056] The PCR products were purified and recovered using AMPure XP magnetic beads. Finally, sequencing was performed using a Nova Seq6000 / MiSeq sequencer (Illumina, San Diego, CA), and the sequencing mode was paired-end 150 bp / 300 bp.
[0057] Among the 7020 sequences obtained after high-throughput sequencing, the part excluding the primer binding region has a length of 30 bases. After removing the sequences that repeat with other small molecules, 6441 sequences remain.
[0058] Example 4 Affinity Characterization of 5 Representative Candidate Nucleic Acid Aptamers Considering the sequence occurrence frequency, 5 DNA sequences with the same longest spliced Kmer (K = 8) were selected from the top 20 sequences with the highest occurrence frequency in the deduplicated high-throughput library for affinity testing (see Table 5).
[0059] Table 5 5 Candidate Nucleic Acid Aptamers Obtained by High-Throughput Sequencing Name Candidate nucleic acid aptamer sequence Seq7 GGGCATCTGGGTGGGTACGGGGTGATTCCT Seq10 CATATACTGGGTGGGTACGGGGTGTAGCTG Seq20 CGGGATGTGGGTGGGTACGGGGTCATTTAG Seq39 CATGCCTGGGTGGGTACGGGGTGGCGTTAG Seq41 CACTATCTGGGTGGGTACGGGGTGTTGGGG The relative affinities of the 5 DNA sequences were determined using an experiment based on fluorescence resonance energy transfer. The principle of this experiment is based on the specific binding of the aptamer to β-ZOL and the fluorescence resonance energy transfer between FAM-aptamer and cDNA-Dabcyl. First, FAM was modified at the 5' end of the aptamer, and Dabcyl was labeled at the 3' end of the cDNA. The aptamer and cDNA form double-stranded DNA through base complementary pairing. At this time, the distance between FAM and Dabcyl is less than 10 nm, the fluorescence resonance energy transfer efficiency is significantly improved, the fluorescence of FAM is quenched, and the fluorescence intensity is significantly reduced. When β-ZOL is added, β-ZOL will preferentially bind specifically to the aptamer to form a β-ZOL-aptamer complex with a special structure, preventing the binding of cDNA to the aptamer, protecting the fluorescence of FAM from being quenched, and enhancing the fluorescence signal. The specific operation steps are as follows: 1. Modify the 5'-end of each candidate nucleic acid aptamer with FAM fluorescence labeling. The 3'-end of the short quenching strand (i.e., cDNA) is labeled with a Dabcyl quenching group and is partially complementary to the 5'-end of the candidate nucleic acid aptamer.
[0060] 2. Dissolve the FAM-labeled aptamer (50 nM) alone in a buffer (1 M NaCl, 20 mM MgCl 2 , 5.4 mM KCl, 20 mM, 3.6 mM KH 2 PO 4 , pH = 7.4), incubate at 95 °C for 10 minutes, and slowly cool to room temperature for 20 minutes, and record as Imax.
[0061] 3. Hybridize the FAM-labeled aptamer (50 nM) with the quenching strand at a molar ratio of 1:5: Mix the FAM-labeled aptamer and the quenching strand together in the buffer, incubate at 95 °C for 10 minutes, and slowly cool to room temperature for 20 minutes, and record as I0.
[0062] 4. Add β-ZOL with a concentration of 10 μM to the FAM-aptamer-quenching strand complex to make β-ZOL competitively bind to the aptamer. After thorough vortex mixing, incubate at room temperature for 30 minutes, and record as It.
[0063] 5. Record the fluorescence spectra of the samples prepared in steps 2-4 on a F-4500 (Hitachi, Japan) under excitation at 494 nm, with an emission range of 500 to 590 nm. All fluorescence spectra are measured under the same conditions, and the change in fluorescence intensity is determined by comparing the fluorescence intensities of different solutions at 520 nm.
[0064] Calculate the fluorescence recovery value based on the fluorescence intensity response value, as shown in A-E of Figure 2 ( Figure 2 the final concentration of the nucleic acid aptamer is 50 nM, the final concentration of cDNA is 250 nM, and the final concentration of β-ZOL is 10 μM). It is found that the fluorescence recovery values of Seq7 and Seq10 among the 5 candidate nucleic acid aptamers are relatively high, thus preliminarily judging that the affinity of these 2 aptamers is better. Example 5 Specificity, Dissociation Constant and Secondary Structure of β-ZOL Nucleic Acid Aptamers Seq7 and Seq10
[0065] Characterize the specificity, dissociation constant and secondary structure of the preferred nucleic acid aptamers Seq7 and Seq10 of β-ZOL (see A-B of Figure 3 , A-B of Figure 4 , A-B of Figure 5A-B). First, the specificity of Seq7 and Seq10 was determined using experiments based on fluorescence resonance energy transfer. The specific operation steps are as follows: 1. Modify the 5'-end of each candidate nucleic acid aptamer with FAM. The short quenching strand (i.e., cDNA) is labeled with Dabcyl at the 3'-end and is partially complementary to the 5'-end of the candidate nucleic acid aptamer.
[0066] 2. Based on the fixed aptamer and cDNA concentrations, hybridize the FAM-labeled aptamer (50 nM) with the quenching strand at a molar ratio of 1:5, incubate at 95 °C for 10 minutes, and slowly cool at room temperature for 20 minutes.
[0067] 3. Add β-ZOL at a concentration of 10 μM and other mycotoxins (such as α-ZOL, ZEN, OTA, AFB1) to the FAM-aptamer-quenching strand complex respectively. After vortexing thoroughly, incubate at room temperature for 30 minutes.
[0068] 4. Record the fluorescence spectra of the samples with different targets on F-4500 (Hitachi, Japan) under excitation at 494 nm, and the emission range is from 500 nm to 590 nm. All fluorescence spectra are measured under the same conditions, and the change in fluorescence intensity is determined by comparing the fluorescence intensities of different solutions at 520 nm.
[0069] The results of Seq7 are as Figure 3 shown in A. Compared with β-ZOL, the fluorescence recovery values of other mycotoxins are all lower, and it can be seen that there is no cross-reaction between OTA and AFB1 and β-ZOL. At the same time, the addition of β-ZOL leads to a significant recovery of the fluorescence of the FAM-aptamer. This result indicates that Seq7 has high specificity for β-ZOL. The results of Seq10 are as Figure 3 shown in B. Compared with β-ZOL, the fluorescence recovery values of other mycotoxins are relatively lower, and the specificity results are worse than those of Seq7.
[0070] Next, the dissociation constants of Seq7 and Seq10 were determined using the same method as above. The dissociation constant measured for Seq7 was 1.35 μM, and the dissociation constant measured for Seq10 was 463 nM ( Figure 4 A-B). The specific steps are as follows: 1. Modify the 5'-end of each candidate nucleic acid aptamer with FAM. The short quenching strand (i.e., cDNA) is labeled with Dabcyl at the 3'-end and is partially complementary to the 5'-end of the candidate nucleic acid aptamer.
[0071] 2. Fix the concentration of FAM-labeled aptamer at 50 nM, set 8 different concentration points for cDNA-Dabcyl (0 nM, 10 nM, 20 nM, 30 nM, 50 nM, 100 nM, 250 nM, 500 nM), mix the aptamer and the quenching strand at each concentration point in the buffer, incubate at 95 °C for 10 minutes, and slowly cool at room temperature for 20 minutes.
[0072] 3. Record the fluorescence spectra of the aptamer-quencher complexes with different concentrations on an F-4500 (Hitachi, Japan) at an excitation wavelength of 494 nm, and the emission range is from 500 nm to 590 nm. All fluorescence spectra are measured under the same conditions, and the change in fluorescence intensity is determined by comparing the fluorescence intensities of different solutions at 520 nm. Calculate the fluorescence quenching value based on the fluorescence intensity response value, and calculate Kd1.
[0073] 4. On the basis of fixing the aptamer and cDNA concentrations, hybridize the FAM-labeled aptamer (50 nM) with the quenching strand at a molar ratio of 1:5, incubate at 95 °C for 10 minutes, and slowly cool at room temperature for 20 minutes. Add different concentrations of β-ZOL (0 μM, 0.5 μM, 1 μM, 5 μM, 10 μM, 20 μM, 40 μM, 50 μM) to the FAM-aptamer-quencher complex, vortex thoroughly and incubate at room temperature for 30 minutes. Record the fluorescence signals as described above, and determine the change in fluorescence intensity by comparing the fluorescence intensities of different solutions at 520 nm. Calculate the fluorescence recovery value based on the fluorescence intensity response value, and calculate Kd2 (see Table 6).
[0074] Table 6. Dissociation constants of representative candidate nucleic acid aptamers and β-ZOL determined by fluorescence resonance energy transfer-based method Nucleic acid aptamer name Dissociation constant (KD) Seq7 1.35 μM Seq10 463 nM 5. Finally, calculate the Kd value according to the ratio of Kd1 / Kd2.
[0075] Use DNA Fold to simulate the secondary structures of Seq7 and Seq10 (https: / / www.unafold.org / mfold / applications / dna-folding-form.php), and the results are shown in Figure 5 A-B of
[0076] As described above, it is only the specific implementation manner in the present invention, but the protection scope of the present invention is not limited thereto. Any transformation or replacement that can be understood and conceived by those who are familiar with the technology within the technical scope disclosed by the present invention should be covered within the scope of the present invention. Therefore, the protection scope of the present invention should be subject to the protection scope of the claims.
Claims
1. The β-zearalenol aptamer screened based on Capture-SELEX technology is characterized by: The nucleotide sequence of the β-zearalenol aptamer is shown in SEQ ID NO.1 and / or SEQ ID NO.
2.
2. A method for screening β-zearalenol aptamers based on Capture-SELEX technology, characterized in that: The following steps are involved: Step 1: Using β-zearalenol as the target small molecule, the initial library was screened for 11 rounds, and the Capture-SELEX method was used to enrich the sequences that specifically recognized the target. Step 2: High-throughput sequencing of the enriched library obtained by specific target recognition, followed by Kmer splicing analysis, to select 5 candidate nucleic acid aptamers; Step 3: The 5' end of the candidate nucleic acid aptamer was modified with a FAM fluorescent label, and the 3' end of the capture chain was modified with a Dabcyl quenching group. The affinity and specificity of the five candidate nucleic acid aptamers were tested using the fluorescence quenching-recovery method to obtain two nucleic acid aptamers with high affinity, Seq7 and Seq10.
3. The method for screening β-zearalenol aptamers based on Capture-SELEX technology according to claim 2, characterized in that: The sequence of the initial library of β-zearalenol aptamers is 5ˊ-GGAGGCTCTCGGGACGACNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGTCCCGATGCTGCAATCGTAA-3ˊ.
4. The method for screening β-zearalenol aptamers based on Capture-SELEX technology according to claim 3, characterized in that: The specific operations of step 1 are as follows: Step 1.1, hybridization of the initial library with the capture strand: After mixing the initial library with the cDNA in the screening buffer, heat it in a 95°C water bath for 10 minutes and slowly cool it to room temperature; Step 1.2, preparing a microgravity column - adding streptavidin agarose beads to the microgravity column, and washing the microgravity column with a screening buffer; Step 1.3, capture of the complex of the initial library and the capture strand by agarose beads - add the complex of the initial library and the capture strand to the agarose beads, collect the complex filtrate after gravity flow, and add the filtrate again twice to maximize the coupling of the DNA library and cDNA complex to the column; Step 1.4, wash the agarose beads to remove the unbound initial library - add the screening buffer to the agarose beads for washing, collect the washing solution, and retain the 10th washing solution (Wash10) for quantification; Step 1.5, add the eluent with the target for positive screening - add the eluent to the agarose beads, repeat the elution twice, and retain the supernatant of the three elutions, which is the positive screening eluent; Step 1.6, quantifying the positive screening eluate of step 1.5 and the cleaning solution of step 1.4 by real-time fluorescent quantitative polymerase chain reaction; Step 1.7, after the positive screen eluate is concentrated, a DNA sequence in the concentrate is amplified by PCR using a forward primer, a biotin-labeled reverse primer, and Taq polymerase; Step 1.8, preparing single-stranded DNA - using streptavidin-modified magnetic beads to capture double-stranded DNA in the PCR amplification results, washing the magnetic beads that captured double-stranded DNA with NaOH solution, and centrifuging to collect the supernatant, which is single-stranded DNA; In step 1.9, the enriched single-stranded DNA library is subjected to Capture-SELEX cycles according to steps 1.1 to 1.8 until 11 cycles are completed.
5. The method for screening β-zearalenol aptamers based on Capture-SELEX technology according to claim 4, characterized in that: The specific operation of step 1.8 is as follows: Step 1.8.1, mix the streptavidin-modified agarose beads - place the streptavidin-modified agarose beads on a rotator at room temperature for 15 minutes, take 100 μL into a centrifuge tube for later use; Step 1.8.2, remove the non-covalently coupled streptavidin on the magnetic beads - add 100 μL of 100 mM NaOH solution to the centrifuge tube containing 100 μL of mixed magnetic beads, mix by pipetting, rotate and mix at room temperature for 5 minutes, remove the supernatant by magnetic classification, then add 1 mL of 1× PB / NaCl buffer to the centrifuge tube, remove the supernatant by magnetic classification, and repeat twice to remove the supernatant; Step 1.8.3, capture double-stranded DNA in PCR mixture with streptavidin-modified agarose beads - add 400 μL PCR mixture and 400 μL 2× PB / NaCl buffer to each centrifuge tube and rotate at room temperature for 2 hours; Step 1.8.4, NaOH elution - After washing the magnetic beads three times with 500 μL 1× PBS / NaCl, use a pipette to soak the magnetic beads that capture double-stranded DNA with 100 μL 200 mM NaOH, mix at room temperature for 30 minutes, and collect the supernatant by magnetic separation, which is the single-stranded DNA library; Step 1.8.5, Library quantification - Neutralize the single-stranded DNA library with an equal amount of HCl and quantify the concentration by measuring the UV-visible absorption intensity at 260 nm.
6. The method for screening β-zearalenol aptamers based on Capture-SELEX technology according to claim 4, characterized in that: In the step 1.1, the sequence of the capture strand is 5'-GTCGTCCCGAGAGCCATA-BioTEG-3'; in the step 1.7, the sequence of the forward primer is 5'-GGAGGCTCTCGGGACGAC-3', and the sequence of the reverse primer is 5'-TTACGATTGCAGCATCGGGACG-3'.
7. The method for screening β-zearalenol aptamers based on Capture-SELEX technology according to claim 4, characterized in that: The specific operation of step 1.6 is as follows: Step 1.6.1, preparation of initial library standards and test samples - use nuclease-free water to prepare the following 7 different concentrations of initial library Pool solutions as standards, with DNA concentrations of 1000 pM, 100 pM, 10 pM, 1 pM, 0.1 pM, and 0.01 pM respectively; at the same time, prepare test sample solutions with concentrations ranging from 0.01 pM to 1000 pM; Step 1.6.2, qPCR solution preparation - prepare the qPCR solution according to the formula containing 10 μL 2× Premix Taq hot start enzyme, 2 μL FP, 2 μL RP, 3 μL nuclease-free water, 1 μL 20× Eva Green nucleic acid dye, and 2 μL sample per 100 μL; Step 1.6.3, set the qPCR instrument program: the first step is to preheat at 95℃ for 1 minute; the second step is to heat at 95℃ for 30 seconds; the third step is to anneal at 51℃ for 30 seconds; the fourth step is to extend at 72℃ for 30 seconds, and the second to fourth steps are cycled 34 times, and the fluorescence signal is collected every time in the fourth step; Step 1.6.4, draw a working curve based on the data of the collected standard samples, and calculate the amount of DNA contained in the unknown sample based on the working curve and the Ct value of the sample to be tested.
8. The method for screening β-zearalenol aptamers based on Capture-SELEX technology according to claim 4, characterized in that: The specific operation of step 1.7 is as follows: After the positive screening eluate was concentrated to 100 μL, the PCR mixture was prepared, and each 100 μL PCR mixture contained 50 μL of 2×Premix Taq Hot Start; 10 μL of forward primer FP, 10 μL of reverse primer RP, 20 μL of nuclease-free water, and 10 μL of positive screening concentrate; the amplification conditions were 95°C pre-denaturation for 60 s, 92°C denaturation for 15 s, 61°C annealing for 30 s, and 72°C extension for 45 s.
9. The method for screening β-zearalenol aptamers based on Capture-SELEX technology according to claim 2, characterized in that: The specific operation of step 3 is as follows: Step 3.1, the 5' end of each candidate nucleic acid aptamer is modified with FAM, and the 3' end of the capture strand is labeled with Dabcyl and partially complementary to the 5' end of the candidate nucleic acid aptamer; Step 3.2, dissolve the FAM-labeled candidate aptamer in buffer, incubate at 95°C for 10 minutes, and slowly cool at room temperature for 20 minutes; Step 3.3, hybridize the FAM-labeled aptamer with the capture strand at a molar ratio of 1:5, mix the aptamer and the capture strand in a buffer, incubate at 95°C for 10 minutes, and slowly cool at room temperature for 20 minutes; Step 3.4, add 10 μM β-zearalenol to the FAM-aptamer-quencher chain complex to allow β-zearalenol to compete with the aptamer for binding, vortex thoroughly to mix, and incubate at room temperature for 30 minutes; In step 3.5, the fluorescence spectra of the samples prepared in steps 3.2-3.4 were recorded under 494 nm excitation light with an emission range of 500 to 590 nm. All fluorescence spectra were measured under the same conditions, and the change in fluorescence intensity was determined by comparing the fluorescence intensity of different solutions at 520 nm.
10. Use of the β-zearalenol aptamer prepared by the method according to any one of claims 2 to 9 in food safety detection.