Gene recombinant plasmid for expressing elastin-like polypeptide

By designing and constructing a gene recombinant plasmid with a vector of amphiphilic elastin-like polypeptides, it is expressed in BL21 (DE3) competent cells, the problems of low expression efficiency and poor stability of the peptide in the prior art are solved, and high-purity and high yield elastin-like polypeptide expression is achieved.

CN120060305APending Publication Date: 2025-05-30BEIJING UNIV OF CHEM TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510150332.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-11
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

The prior art is limited by the expression ability of the host cell, the solubility of the target protein and the inducible expression conditions when expressing elastin-like polypeptides, resulting in unsatisfactory yield and activity.

Method used

A gene recombinant plasmid was designed, the vector was an amphiphilic elastin polypeptide, whose amino acid sequence was G(VPGX1G)n(VPGX2G)nYKm, X1 is a hydrophobic amino acid, and X2 is a hydrophilic amino acid. By constructing a recombinant plasmid and expressing it in BL21 (DE3) competent cells, it was purified by purifying the amphiphilic elastin polypeptide.

Benefits of technology

It improves the expression efficiency of elastomeric polypeptides, enhances the solubility and stability of the polypeptide, improves the purity and yield of the final product, and provides flexibility to control its physical and chemical properties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060305A_ABST
    Figure CN120060305A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicine, and provides a gene recombinant plasmid for expressing elastin-like polypeptide, the gene recombinant plasmid comprises a carrier, the carrier is amphiphilic elastin-like polypeptide, the amino acid sequence of the amphiphilic elastin-like polypeptide is G (VPGX1G) n (VPGX2G) nYKm, X1 is hydrophobic amino acid, X2 is hydrophilic amino acid, n is equal to 20-50, and m is equal to 1-10; by constructing the specific gene recombinant plasmid, the expression efficiency of the elastin-like polypeptide can be effectively improved, the purity and yield of the final product are higher, and the solubility and stability of the generated polypeptide are enhanced by the designed amphiphilic structure, so that subsequent purification and application are facilitated; by adjusting the amino acid sequence and composition of the synthesized polypeptide, the physicochemical characteristics of the polypeptide can be accurately controlled, and flexibility is provided for the design of biological materials.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and specifically relates to a gene recombinant plasmid for expressing elastin-like polypeptide. Background Art

[0002] Due to its excellent biocompatibility and mechanical properties, elastin-like polypeptide is widely used in the fields of biomedicine, tissue engineering, and biomaterials. Elastin is an important structural protein in nature, mainly present in skin, blood vessels, and lung tissues, endowing these tissues with good elasticity and extensibility. Due to its biological functions and physical properties, the research on elastin-like polypeptide has gradually attracted the attention of the scientific community;

[0003] The traditional process for extracting elastin is complex, costly, and has limited yield. Therefore, expressing elastin-like polypeptide in microorganisms through gene recombination technology has become an ideal alternative. Gene recombinant plasmids can effectively introduce target genes into host cells to achieve high-level expression of target proteins. However, existing technologies and expression systems are often limited by factors such as the expression ability of host cells, the solubility of target proteins, and induction expression conditions, resulting in unsatisfactory yields and activities of the final products.

[0004] For this reason, those skilled in the art have proposed a gene recombinant plasmid for expressing elastin-like polypeptide, aiming to optimize the amino acid sequence design and expression system construction of elastin-like polypeptide to make it have better solubility and higher biocompatibility during the expression process. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides a gene recombinant plasmid for expressing elastin-like polypeptide to solve the problems raised in the background art.

[0006] A gene recombinant plasmid for expressing elastin-like polypeptide, including a vector, wherein the vector is an amphiphilic elastin-like polypeptide, and the amino acid sequence of the amphiphilic elastin-like polypeptide is G(VPGX 1 G) n (VPGX 2 G) n YK m , where X1 is a hydrophobic amino acid, X2 is a hydrophilic amino acid, and n = 20 - 50, m = 1 - 10.

[0007] Preferably, the preparation steps of the amphiphilic elastin-like polypeptide are as follows:

[0008] S1. Construct a recombinant plasmid, and the target gene sequence is the gene sequence for expressing the amphiphilic elastin-like polypeptide;

[0009] S2. Transfer the above recombinant plasmid into BL21(DE3) competent cells to obtain a transformed strain, and resuscitate and culture the transformed strain in a medium.

[0010] S3. After the culture is completed, transfer the transformed strain to a medium containing ampicillin for culture, screen the transformed strain that has successfully transformed the plasmid and continue the culture.

[0011] S4. After inducing the transformed strain that has successfully transformed the plasmid with isopropyl-β-D-thiogalactoside, collect the cell precipitate, and after disrupting and purifying the cell precipitate, obtain amphiphilic elastin-like polypeptides.

[0012] Preferably, the amino acid sequence of the amphiphilic elastin-like polypeptide is the sequence shown in SEQ ID NO.1, and then the target gene sequence in S1 is the sequence shown in SEQ ID NO.2.

[0013] Preferably, the amino acid sequence of the amphiphilic elastin-like polypeptide is the sequence shown in SEQ ID NO.3, and then the target gene sequence in S1 is the sequence shown in SEQ ID NO.4.

[0014] Preferably, the amino acid sequence of the amphiphilic elastin-like polypeptide is the sequence shown in SEQ ID NO.5, and then the target gene sequence in S1 is the sequence shown in SEQ ID NO.6.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] By constructing a specific gene recombinant plasmid, the present invention can effectively improve the expression efficiency of elastin-like polypeptides, making the purity and yield of the final product higher, and the designed amphiphilic structure enhances the solubility and stability of the generated polypeptides, thus contributing to subsequent purification and application; by adjusting the amino acid sequence and composition of the synthesized polypeptides, their physicochemical properties can be precisely controlled, providing flexibility for the design of biomaterials. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is a schematic diagram of the electrophoresis staining of the amphiphilic elastin-like polypeptide provided by the embodiment of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0018] The following further describes in detail the embodiments of the present invention in conjunction with the drawings. The following embodiments are used to illustrate the present invention, but cannot be used to limit the scope of the present invention.

[0019] As shown in the attached Figure 1 figure:

[0020] Example 1: A recombinant plasmid for expressing elastin-like polypeptide, comprising a vector, the vector being an amphiphilic elastin-like polypeptide, and the amino acid sequence of the amphiphilic elastin-like polypeptide being G(VPGX 1 G) n (VPGX 2 G) n YK m , where X1 is a hydrophobic amino acid such as leucine, isoleucine, phenylalanine, etc., X2 is a hydrophilic amino acid such as serine, alanine, glutamic acid, etc., and the terminal lysine can be coupled to the axial carboxyl ligand of the platinum(IV) prodrug, and n = 20 - 50, m = 1 - 10.

[0021] The amino acid sequence of the amphiphilic elastin-like polypeptide is the sequence shown in SEQ ID NO.1, and the terminal lysine thereof is coupled to the axial carboxyl ligand of the platinum(IV) prodrug.

[0022] The steps for preparing the amphiphilic elastin-like polypeptide are as follows:

[0023] S1. Construct a recombinant plasmid, and the target gene sequence is the sequence shown in SEQ ID NO.2;

[0024] First, synthesize the target gene fragment, and then use the pET-25b(+) plasmid as a vector. After digestion with enzymes and ligation, a recombinant plasmid is obtained;

[0025] The pET-25b(+) plasmid contains a resistance selection marker, usually a resistance gene against an antibiotic (such as ampicillin resistance), so that only the host cells carrying the plasmid can grow in a medium containing the corresponding antibiotic. This resistance marker facilitates the plasmid transformation and screening processes. The pET-25b(+) plasmid can be widely used in a variety of Escherichia coli host cells, such as the BL21(DE3) series.

[0026] As a vector, the pET-25b(+) plasmid has relatively stable genetic characteristics and can stably replicate and inherit in host cells. This stability ensures that the recombinant plasmid can still maintain the integrity of its structure and function during long-term culture and multiple passages. The DNA molecule of the plasmid is relatively small, making it easy to perform various molecular biology operations, such as extraction, purification, digestion with enzymes, ligation, etc. These operations are relatively simple and fast, making the construction and identification processes of the recombinant plasmid more efficient. In summary, the recombinant plasmid has the advantages of stability, reliability, simplicity of operation, flexibility, high efficiency, economy, and safety.

[0027] S2. Thaw the BL21(DE3) competent cells in an ice-water bath. Take 3 μL of the above recombinant plasmid at 200 ng / μL and mix it evenly with 50 μL of BL21(DE3) competent cells, and let it stand in the ice-water bath for 30 min. After standing, perform heat shock at 42 °C for 60 s. After heat shock, quickly place it in the ice-water bath and let it stand for 2 min. Then add 250 μL of LB liquid medium without antibiotics, mix well, and place it in a shaker at 37 °C, and shake and resuscitate at 200 rpm for 60 min.

[0028] S3. After the resuscitation culture, dilute the bacteria obtained in S2 5-fold with LB liquid medium containing 50 μL / mL ampicillin (Amp), evenly spread it on the LB solid medium containing Amp, invert the plate, and culture it overnight.

[0029] The next day, pick multiple single colonies into 4 mL of LB liquid medium containing Amp, shake it in a shaker at 37 °C at 230 rpm until OD is 0.6 - 0.8, take 2 μL for colony PCR. Select the bacteria with successfully transformed plasmids (corresponding gene bands appear in colony PCR), expand the volume to 100 mL, and shake and culture it in a shaker at 37 °C at 230 rpm until OD is 0.6 - 0.8.

[0030] S4. Add isopropyl-β-D-thiogalactoside with a final concentration of 1 mM to the bacteria finally obtained in S3, and induce it at 16 °C and 230 rpm for 24 h. After induction, centrifuge at 4 °C and 7000 rpm for 10 min, discard the supernatant, and collect the bacterial cell pellet I.

[0031] Resuspend the collected bacterial cell pellet I with water, centrifuge at 4 °C and 7000 rpm for 10 min, discard the supernatant, and collect the bacterial cell pellet II again.

[0032] After resuspending the bacterial cell pellet II with the equilibration buffer, break the bacteria using an ultrasonic disruptor under ice-water bath conditions, then centrifuge at 4 °C and 12000 rpm for 10 min, collect the supernatant, filter it through a 0.45 μM filter membrane, and perform purification using a nickel column after filtration. The purified polypeptide is dialyzed overnight in 1×PBS at 4 °C to obtain amphiphilic ELP. Aliquot the amphiphilic ELP and store it at -20 °C.

[0033] SEQ ID NO.1 is as follows:

[0034] GVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGYKKKKKK。

[0035] SEQ ID NO.2 is as follows:

[0036]

[0037] Example 2: A gene recombinant plasmid for expressing an elastin-like polypeptide, comprising a vector, the vector being an amphiphilic elastin-like polypeptide, and the amino acid sequence of the amphiphilic elastin-like polypeptide being G(VPGX 1 G) n (VPGX 2 G) n YK m , wherein X1 is a hydrophobic amino acid such as leucine, isoleucine, phenylalanine, etc., X2 is a hydrophilic amino acid such as serine, alanine, glutamic acid, etc., and the lysine at the end can be coupled with the axial carboxyl ligand of the platinum(IV) prodrug, and n = 20 - 50, m = 1 - 10.

[0038] The amino acid sequence of the amphiphilic elastin-like polypeptide is the sequence shown in SEQ ID NO.3, and the lysine at its end is coupled with the axial carboxyl ligand of the platinum(IV) prodrug.

[0039] The steps for preparing the amphiphilic elastin-like polypeptide are as follows:

[0040] S1. Construct a recombinant plasmid, and the target gene sequence is the sequence shown in SEQ ID NO.4;

[0041] S2. Transform the recombinant plasmid into BL21(DE3) competent cells and culture with shaking for resuscitation;

[0042] S3. Dilute the bacteria obtained in S2 5-fold in LB liquid medium containing 50 μL / mL ampicillin (Amp), evenly spread it on the LB solid medium containing Amp, invert the plate, and culture overnight;

[0043] Select the bacteria with successfully transformed plasmids and expand the culture to OD 0.6 - 0.8;

[0044] S4. Add isopropyl-β-D-thiogalactoside with a final concentration of 1 mM to the bacteria finally obtained in S3 to induce the expression of the elastin-like polypeptide; wash and lyse the bacteria, collect the supernatant after centrifugation, and purify the supernatant using a nickel column; dialyze the purified polypeptide overnight in 1×PBS at 4°C to obtain the amphiphilic ELP, aliquot the amphiphilic ELP and store it at -20°C.

[0045] SEQ ID NO.3 is as follows:

[0046] GVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGYKKKKKK。

[0047] SEQ ID NO.4 is as follows:

[0048]

[0049] Example 3: A gene recombinant plasmid for expressing elastin-like polypeptide, comprising a vector, the vector being an amphiphilic elastin-like polypeptide, and the amino acid sequence of the amphiphilic elastin-like polypeptide being G(VPGX 1 G) n (VPGX 2 G) n YK m , where X1 is a hydrophobic amino acid such as leucine, isoleucine, phenylalanine, etc., X2 is a hydrophilic amino acid such as serine, alanine, glutamic acid, etc., and the terminal lysine can be coupled with the axial carboxyl ligand of the platinum(IV) prodrug, and n = 20 - 50, m = 1 - 10.

[0050] The amino acid sequence of the amphiphilic elastin-like polypeptide is the sequence shown in SEQ ID NO.5, and the terminal lysine thereof is coupled with the axial carboxyl ligand of the platinum(IV) prodrug.

[0051] The steps for preparing the amphiphilic elastin-like polypeptide are as follows:

[0052] S1. Construct a recombinant plasmid, and the target gene sequence is the sequence shown in SEQ ID NO.6;

[0053] S2. Transform the recombinant plasmid into BL21(DE3) competent cells and culture them by shaking and resuscitating;

[0054] S3. Dilute the bacteria obtained in S2 by 5 times in LB liquid medium containing 50 μL / mL ampicillin (Amp), evenly spread them on the LB solid medium containing Amp, invert the plate, and culture overnight;

[0055] Select the bacteria with successfully transformed plasmids and expand the culture to OD 0.6 - 0.8;

[0056] S4. Add isopropyl-β-D-thiogalactoside with a final concentration of 1 mM to the bacteria finally obtained in S3 to induce the expression of elastin-like polypeptide; wash and lyse the bacteria, collect the supernatant after centrifugation, and purify the supernatant using a nickel column; dialyze the purified polypeptide overnight in 1×PBS at 4°C to obtain amphiphilic ELP, aliquot the amphiphilic ELP and store it at -20°C.

[0057] SEQ ID NO.5 is as follows:

[0058] GVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGIGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGYKKKKKKKK。

[0059] SEQ ID NO.6 is as follows:

[0060] GGAGTTCCGGGTATCGGCGTTCCGGGCATTGGGGTTCCGGGTATTGGTGTCCCGGGTATTGGTGTCCCGGGCATCGGTGTGCCGGGCATCGGCGTTCCGGGCATCGGCGTGCCCGGCATTGGTGTTCCCGGGATCGGTGTGCCGGGTATCGGTGTTCCGGGGATCGGCGTGCCGGGCATCGGCGTGCCGGGCATTGGTGTTCCGGGCATCGGTGTCCCGGGCATCGGCGTGCCGGGTATTGGTGTGCCGGGTATTGGCGTGCCGGGCATCGGTGTTCCGGGTATTGGCGTGCCGGGCATTGGTGTGCCAGGCATCGGCGTGCCGGGTATTGGCGTGCCTGGGATCGGTGTGCCGGGGATCGGCGTCCCAGGCGCAGGTGTTCCAGGCGCAGGTGTCCCAGGCGCAGGTGTGCCTGGTGCTGGTGTCCCGGGTGCAGGCGTGCCAGGCGCAGGCGTGCCGGGTGCAGGCGTGCCGGGTGCAGGTGTTCCAGGCGCTGGCGTGCCGGGTGCTGGTGTGCCGGGTGCAGGCGTTCCGGGTGCAGGTGTACCAGGTGCAGGTGTTCCGGGCGCAGGCGTGCCGGGTGCTGGTGTTCCGGGCGCAGGTGTTCCGGGCGCAGGTGTTCCGGGTGCTGGCGTGCCGGGTGCAGGCGTTCCGGGTGCTGGTGTGCCGGGTGCAGGTGTCCCGGGCGCAGGTGTTCCGGGCGCTGGTGTGCCAGGTGCAGGCTACAAAAAAAAGAAGAAGAAAAAGAAA。

[0061] Importantly, it should be noted that the construction and arrangement of the present application shown in multiple different exemplary embodiments are merely illustrative. Although only a few embodiments are described in detail in this disclosure, those who refer to this disclosure should readily understand that many modifications are possible without materially departing from the novel teachings and advantages of the subject matter described in this application. Other substitutions, modifications, changes, and omissions may be made in the design, operating conditions, and arrangement of the exemplary embodiments without departing from the scope of the present invention. Therefore, the present invention is not limited to a particular embodiment, but extends to various modifications that still fall within the scope of the appended claims.

[0062] In addition, in order to provide a concise description of the exemplary embodiments, all features of the actual embodiments may not be described (i.e., those features that are not relevant to the currently contemplated best mode of carrying out the present invention or those features that are not relevant to implementing the present invention).

[0063] It should be understood that, in the development of any actual implementation, as in any engineering or design project, numerous specific implementation decisions may be made. Such development efforts may be complex and time-consuming, but for those of ordinary skill in the art who benefit from this disclosure, without undue experimentation, such development efforts will be a routine task of design, fabrication, and production.

[0064] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention may be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered within the scope of the claims of the present invention.

Claims

1. A genetic recombinant plasmid for expressing an elastin-like polypeptide, characterized in that: The invention comprises a carrier, wherein the carrier is an amphiphilic elastin-like polypeptide, and the amino acid sequence of the amphiphilic elastin-like polypeptide is G(VPGX1G) n (VPGX2G) n YK m , wherein X1 is a hydrophobic amino acid, X2 is a hydrophilic amino acid, and n=20-50, m=1-10.

2. A genetically recombinant plasmid for expressing an elastin-like polypeptide as claimed in claim 1, characterized in that: The steps for preparing the amphiphilic elastin-like polypeptide are as follows: S1. constructing a recombinant plasmid, wherein the target gene sequence is a gene sequence for expressing an amphipathic elastin-like polypeptide; S2, transferring the above recombinant plasmid into BL21 (DE3) competent cells to obtain a transformed strain, and resuscitating the transformed strain in a culture medium; S3. After the culture is completed, the transformed strain is transferred to a medium containing ampicillin for culture, and the transformed strain with successful transformation of the plasmid is selected and continued to be cultured; S4. After inducing the transformed strain with the successfully transformed plasmid with isopropyl-β-D-thiogalactoside, the bacterial precipitate is collected, and the bacterial precipitate is crushed and purified to obtain the amphiphilic elastin-like polypeptide.

3. A genetically recombinant plasmid for expressing an elastin-like polypeptide as claimed in claim 2, characterized in that: The amino acid sequence of the amphiphilic elastin-like polypeptide is the sequence shown in SEQ ID NO.1, and the S1 target gene sequence is the sequence shown in SEQ ID NO.

2.

4. A genetically recombinant plasmid for expressing an elastin-like polypeptide as claimed in claim 2, characterized in that: The amino acid sequence of the amphiphilic elastin-like polypeptide is the sequence shown in SEQ ID NO.3, and the S1 target gene sequence is the sequence shown in SEQ ID NO.

4.

5. A genetically recombinant plasmid for expressing an elastin-like polypeptide as claimed in claim 2, characterized in that: The amino acid sequence of the amphiphilic elastin-like polypeptide is the sequence shown in SEQ ID NO.5, and the S1 target gene sequence is the sequence shown in SEQ ID NO.6.