Primer-probe combinations for detecting pepper blight and their applications
By designing primer-probe combinations and using RPA amplification technology, the problem of rapid and accurate detection of pepper blight pathogens in the *Phytophthora indicum* population was solved, enabling early identification and control of the disease in the field.
Patent Information
- Application Number
- CN202510282374.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-11
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2045-03-11
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify pepper blight pathogens in the *Phytophthora indica* population, leading to delays in disease control and hindering early detection and prevention.
A primer-probe combination, including a forward primer, a reverse primer, and a probe, was designed for recombinase polymerase amplification (RPA) detection. Combined with LF chromatography, it can specifically identify and detect *Pepper Blight* causal agent. Detection samples include plant tissue and soil samples.
It enables precise detection of pepper blight pathogens in the *Phytophthora indicum* population, with a detection sensitivity of 50 pg/μL. It can quickly identify pathogens in the field and support early disease control.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection, specifically to primer-probe combinations for detecting pepper blight pathogens and their applications. Background Technology
[0002] Pepper (Piper nigrum Linn.) is a perennial tropical spice crop, known as the "King of Spices," and my country ranks fifth in the world in pepper production. Pepper blight is a devastating soil-borne disease caused by *Phytophthora capsici*. *Phytophthora capsici* not only harms pepper but can also infect more than 50 other economic crops, including: peppers, tomatoes and other solanaceous crops; cucumbers, watermelons and other cucurbitaceous crops; cabbage, bok choy and other cruciferous crops; beans, cowpeas and other legumes; and tropical crops such as pepper and rubber trees, etc., posing a significant threat to agriculture. *Phytophthora capsici* is characterized by rapid spread, high susceptibility to outbreaks, strong destructive power, and difficulty in prevention and control, making it a global challenge for pest and disease control. "Early detection and early prevention" is the consistent policy for controlling this type of disease. Rapid identification of the pathogen is the key to "early detection."
[0003] Phytophthora capsici exhibits widespread regional genetic diversity, leading to regional variations in its mating morphology, pathogenicity, and drug resistance. This differentiation exists not only between large regions such as countries and provinces, but also between smaller regions within provinces and even between different hosts within the same region. It is generally believed that the genetic and morphological differences in Phytophthora capsici are particularly significant between tropical and temperate regions. Currently, there is no effective method to identify the groups that harm this crop from the numerous Phytophthora capsici populations. Summary of the Invention
[0004] In view of this, the technical problem to be solved by the present invention is to provide a primer-probe combination for detecting pepper blight and its application. The primer-probe combination and detection method provided by the present invention have the advantages of high specificity, high sensitivity, simple equipment, and rapid detection.
[0005] This invention provides a primer-probe combination, comprising a forward primer, a reverse primer, and a probe, wherein:
[0006] The forward primer has the following characteristics:
[0007] (1) Nucleotide sequences as shown in SEQ ID NO:1 and SEQ ID NO:2; or
[0008] (2) The complementary sequence of the nucleotide sequence shown in (1); or
[0009] (3) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (1) or (2), and which has the same or similar function as the nucleotide sequence shown in (1) or (2); or
[0010] (4) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1), (2) or (3);
[0011] The reverse primer has the following characteristics:
[0012] (5) A nucleotide sequence as shown in SEQ ID NO:2; or
[0013] (6) The complementary sequence of the nucleotide sequence shown in (5); or
[0014] (7) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (5) or (6), and which has the same or similar function as the nucleotide sequence shown in (5) or (6); or
[0015] (8) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (5), (6) or (7).
[0016] The probe has:
[0017] (9) A nucleotide sequence as shown in SEQ ID NO:3; or
[0018] (10) The complementary sequence of the nucleotide sequence shown in (9); or
[0019] (11) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (9) or (10), and which has the same or similar function as the nucleotide sequence shown in (9) or (10); or
[0020] (12) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (9), (10) or (11).
[0021] In some embodiments, the 5' end of the reverse primer is labeled with biotin;
[0022] The probe has a fluorescent group labeled at its 5' end, and an idsp group modified between 30 bp and 31 bp from the 5' end. The probe also has a group modified at its 3' end to block polymerase amplification.
[0023] In some specific embodiments, the 5' end of the reverse primer is labeled with biotin;
[0024] The probe has a 6-FAM fluorescent group labeled at its 5' end and a C3dSpacer blocking group modified at its 3' end to block polymerase amplification.
[0025] This invention provides the application of the aforementioned primer-probe combination in the preparation of reagents or kits for detecting Piper blast fungus.
[0026] In some embodiments, the samples being tested include plant tissue and / or soil samples.
[0027] The present invention provides a reagent or kit for detecting pepper blight pathogens, including the aforementioned primer-probe combination.
[0028] In some embodiments, the mixture may also include at least one of RPA enzyme, RPA reaction buffer, magnesium acetate solution, chromatography buffer, ddH2O, and chromatography test strip.
[0029] In some embodiments, the concentration of the magnesium acetate solution is 280 mM, and the chromatography buffer is a 0.1 M Tris buffer with a pH of 7.5 to 8.5.
[0030] This invention provides a method for detecting pepper blight pathogens, comprising the following steps:
[0031] Step 1: Extract DNA from the sample;
[0032] Step 2: Using the DNA of the sample as a template, perform RPA amplification using the primer-probe combination or the reagent or kit described above;
[0033] Step 3: Determine whether the sample contains pepper blight pathogen based on the RPA amplification results in Step 2.
[0034] In some embodiments, the RPA amplification reaction system includes:
[0035]
[0036] In some embodiments, the reaction conditions for RPA amplification are 25–45°C for 5–60 min.
[0037] In some embodiments, step 2 uses the reagents or kits described in claim 5 or 6 for RPA amplification. In step 3, the amplification product, RPA reaction solution, and HybriDetectAssay Buffer are mixed to prepare a mixture. The sample area of the chromatography strip is placed in the mixture and left at room temperature for 3-4 minutes before observing the results. If both the control line and the test line of the chromatography strip show bands, the test result is positive, indicating that the sample contains *Piper blast fungus*. If only the control line shows a band on the test strip, the test result is negative, indicating that the sample does not contain *Piper blast fungus*. If only the test line shows a band or no bands appear on the test strip, the test result is invalid.
[0038] Compared with existing technologies, the primer-probe combination provided by this invention can effectively detect the subgroup of pepper blight pathogen within the *Phytophthora capsici* population, improving the detection accuracy from the level of conventional species to the level of intraspecific subgroups. The detection sensitivity can reach 50 pg / μL. Combined with integrated rapid DNA extraction, RPA isothermal amplification, and LF flow chromatography methods, it can be performed in the field within 30 minutes, eliminating the need for a laboratory setting. This provides a rapid and accurate identification method for field control and scientific research of pepper blight. Attached Figure Description
[0039] Figure 1 This shows the sequence alignment results of the ypt1 gene of various Phytophthora species in Example 1 and the primer positions;
[0040] Figure 2 Example 1 compares the detection accuracy of the primer set of the present invention with that of the control primer 1. In this example, primers 1 and 2 are *Phytophthora capsici* (isolated from Hainan pepper), primer 3 is *Phytophthora capsici* (isolated from Fujian pepper), primer 4 is *Phytophthora capsici* (isolated from Jiangsu pepper), primer 5 is *Phytophthora capsici* (isolated from Shandong eggplant), primer 6 is *Phytophthora capsici* (isolated from Yunnan zucchini), primer 7 is *Phytophthora capsici* (isolated from Hainan tomato), primer 8 is *Phytophthora tobacco*, primer 9 is *Phytophthora soybean*, primer 10 is *Phytophthora pathogenica*, primer 11 is *Phytophthora parasitica*, primer 12 is *Phytophthora palmatum*, primer 13 is *Fusarium solani*, primer 14 is *Colletotrichum gloeosporioides*, primer 15 is *Dispora cocovenenans*, primer 16 is *Escherichia coli*, primer 17 is *Bacillus subtilis*, primer 18 is *Pseudomonas fluorescens*, and primer 19 is a water control.
[0041] Figure 3Example 2 shows a comparison of the detection accuracy of the primer and probe set of the present invention with the control primer 2. 1 and 2 are *Phytophthora capsici* (isolated from Hainan pepper), 3 is *Phytophthora capsici* (isolated from Fujian pepper), 4 is *Phytophthora capsici* (isolated from Jiangsu pepper), 5 is *Phytophthora capsici* (isolated from Shandong eggplant), 6 is *Phytophthora capsici* (isolated from Yunnan zucchini), 7 is *Phytophthora capsici* (isolated from Hainan tomato), 8 is *Phytophthora tobacco*, 9 is *Phytophthora soybean*, 10 is *Phytophthora pathogenica*, 11 is *Phytophthora parasitica*, 12 is *Phytophthora palmatum*, 13 is *Fusarium solani*, 14 is *Colletotrichum gloeosporioides*, 15 is *Dioscorea opposita*, 16 is *Escherichia coli*, 17 is *Bacillus subtilis*, 18 is *Pseudomonas fluorescens*, and 19 is a water control.
[0042] Figure 4 The results of detecting different concentrations of *Piper blast fungus* DNA in Example 3 are shown, where 1-9 are 200 ng / μL, 100 ng / μL, 31.25 ng / μL, 6.25 ng / μL, 1.25 ng / μL, 250 pg / μL, 50 pg / μL, 10 pg / μL and water control, respectively.
[0043] Figure 5 The experimental flowchart in Example 4 is shown;
[0044] Figure 6 The results of rapid field testing of pepper leaf samples in Example 4 are shown. In this example, 1 is a leaf after artificial inoculation with pepper wilt pathogen, 2-8 are pepper leaf samples from the field, and 9 is a healthy pepper leaf.
[0045] Figure 7 The results of rapid field testing of pepper vine samples in Example 5 are shown, where 1 is a pepper vine artificially inoculated with pepper wilt pathogen, 2-8 are field pepper vine samples, and 9 is a healthy pepper vine;
[0046] Figure 8 The results of rapid field detection of suspected pepper blight samples in Example 6 are shown. In this example, 1 is pepper blight pathogen DNA, 2 is water, and 3-44 are suspected pepper blight samples collected in the field. Detailed Implementation
[0047] This invention provides a primer-probe combination for detecting pepper blight pathogens and its applications. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.
[0048] The test materials used in this invention are all commercially available products. The invention will be further illustrated below with reference to specific embodiments.
[0049] Example 1
[0050] The ypt1 gene sequence, containing guanosine triphosphate (GTP)-binding protein, exhibits distinct conserved and variable regions among Phytophthora species, and is considered useful for species identification. A comparison of the ypt1 sequence differences between two *Phytophthora capsici* strains isolated from Hainan pepper and five strains isolated from other domestic and international hosts, as well as eight other *Phytophthora* species, yielded the following results: Figure 1 As shown. Although the homology among the seven *Phytophthora capsici* species was over 99%, two of the pepper host strains had a 12bp gap compared to the other five host *Phytophthora capsici* strains (see...). Figure 1 The upstream primer position provides a basis for identifying *Phytophthora capsici* causal agent from *Phytophthora capsici* populations. Based on the differences between the isolated *Phytophthora capsici* strain and other *Phytophthora* species, this invention designed a set of detection primers suitable for recombinase polymerase amplification (RPA), including upstream primer 5'-AGTTAGAGCACTGGACTAATTATCTTGTGC-3' (SEQ ID NO:1), downstream primer 5'-Biotin-ATCCAATGGCACTGAAGTTCTGCGTGCGTTAC-3' (SEQ ID NO:2), and probe 5'-6-FAM-AAGAGTCTTTCAACAACGTCAAGCAGTGGT / idsp / GCATGAGAT CGATAG-C3 Space-3' (SEQ ID NO:3), where idsp is a baseless nucleotide analog that allows the probe to be specifically recognized and used for positive band development in the detection results.
[0051] The detection accuracy of the primer set was compared with that of control primer 1, which was derived from the draft for comments on the Hainan Provincial Local Standard "Technical Specification for Molecular Detection of Pepper Blight Pathogen" published online by the Hainan Provincial Department of Agriculture and Rural Affairs (website link: https: / / agri.hainan.gov.cn / hnsnyt / xxgk / tzgg / gggs / 202408 / t20240813_3713941.html). The upstream primer was 5'-GACGTTTTAGTTAGAGCAC-3' (SEQ ID NO:4), and the downstream primer was 5'-AATGGCACTGAAGTTCTG-3' (SEQ ID NO:5), amplifying a target fragment length of 230 bp. The upstream and downstream primers of this invention can be used for conventional PCR amplification without probes. The amplified target fragment length was 218 bp.
[0052] The specific experimental method is as follows:
[0053] (1) Collection of DNA from samples to be tested
[0054] DNA was collected from 5 *Phytophthora capsici* strains (2 from chili pepper hosts, 1 from eggplant hosts, 1 from tomato hosts, and 1 from zucchini hosts) isolated from chili pepper plants across China; DNA from 2 *Phytophthora capsici* strains; DNA from 5 *Phytophthora parasitica*, *Phytophthora palmatum*, *Phytophthora tobacco*, *Phytophthora soybean*, and *Phytophthora pathogenica*; DNA from 3 fungi (*Dispora cocovenenans*, *Colletotrichum gloeosporioides*, and *Fusarium solani*); and DNA from 3 bacteria (*Pseudomonas fluorescens*, *Escherichia coli*, and *Bacillus subtilis*). The DNA concentration was approximately 50 ng / μL.
[0055] (2) Routine PCR amplification and electrophoresis detection
[0056] The method described in the "Technical Specification for Molecular Detection of Pepper Blight Pathogen" was adopted.
[0057] Figure 2 The results show that two strains of *Phytophthora capsici* (the host of *Penicillium capsici* in Hainan) tested positive with this primer set, while five strains of *Phytophthora capsici* isolated from other hosts, five strains of *Phytophthora* from other species, three strains of fungi from different species, and three strains of bacteria from different species tested negative. This indicates that the primers can be used to identify *Phytophthora capsici*. The control primers tested positive for both *Phytophthora capsici* and other *Phytophthora capsici* strains, making it impossible to distinguish the *Phytophthora capsici* subpopulation within the *Phytophthora capsici* population.
[0058] Example 2
[0059] A comparison of the detection accuracy of the primer and probe set of this invention with that of the control primer 2.
[0060] Comparative primer 2: Comparative primer 2 is from the "Phytophthora capsici Detection Kit (Colloidal Gold Method)" (complying with enterprise standard "Q GZSLX 001-2023") of Guangdong Xuanda Testing Technology Service Co., Ltd. Upstream primer 5'-AGCAACCAAAGTTTAAGACGTTTTAGTTAGAGC-3' (SEQ ID NO:6), downstream primer 5'-Biotin-TAAATCCAATGGCACTGAAGTTCTGCGTGTGTT-3' (SEQ ID NO:7), probe 5'-6-FAM-GAGCACTGGACTAATTATTGTGCTAATTGTC / idSp / TGTGCATTT GTAGTG-C3 Space-3' (SEQ ID NO:8). The amplified target fragment length is 252bp.
[0061] The primer-probe set of the present invention includes an upstream primer, a downstream primer, and a probe, as detailed in Example 1.
[0062] The specific experimental method is as follows:
[0063] (1) Collection of DNA from samples to be tested
[0064] Same as Example 1.
[0065] (2) RPA amplification
[0066] RPA amplification was performed using the TwistAmp nfo Kit. Following the instructions, each sample of dry powder was mixed with 29.4 μL of Abuffer, 2 μL each of 10 μM forward and reverse primers, 0.6 μL of 10 μM probe, 12.5 μL of sterile water, and 1 μL of the sample DNA. 2.5 μL of buffer B was added and the mixture was inverted 8-10 times to ensure thorough mixing. The mixture was incubated at room temperature for 15 min.
[0067] (3) LF chromatography and result determination
[0068] LF chromatography detection was performed using the Milenia Genline HybriDetect 1 kit. Following the instructions, 10 μL of RPA reaction solution was added to 190 μL of HybriDetectAssay Buffer (chromatography buffer), and the mixture was inverted to mix thoroughly. The test strip was then incubated for approximately 3-5 minutes until the control line appeared. Two lines indicate a positive result, only a control line indicates a negative result, and no control line indicates failure.
[0069] Figure 3 The results show that two strains of *Phytophthora capsici* (the host of *Penicillium capsici* in Hainan) tested positive with this primer set, while five strains of *Phytophthora capsici* isolated from other hosts, five strains of *Phytophthora* from other species, three strains of fungi from different species, and three strains of bacteria from different species tested negative. This indicates that the primers can be used to identify *Phytophthora capsici*. The control primers tested positive for both *Phytophthora capsici* and other *Phytophthora capsici* strains, making it impossible to distinguish the *Phytophthora capsici* subpopulation within the *Phytophthora capsici* population.
[0070] Example 3
[0071] Sensitivity analysis of DNA concentration in *Piper blast fungus* samples using the primer and probe set of this invention.
[0072] (1) DNA preparation of the sample to be tested
[0073] Prepare samples of *Piper blast fungus* DNA for testing. The concentration gradients are: 200 ng / μL, 100 ng / μL, 31.25 ng / μL, 6.25 ng / μL, 1.25 ng / μL, 250 pg / μL, 50 pg / μL, and 10 pg / μL.
[0074] (2) RPA amplification
[0075] Same as Example 2.
[0076] (3) LF chromatography and result determination
[0077] Same as Example 2.
[0078] Figure 4 The results show that obvious positive bands were detected in samples with concentrations of 200 ng / μL, 100 ng / μL, 31.25 ng / μL, 6.25 ng / μL, 1.25 ng / μL, and 250 pg / μL. A faint band was detected in a sample with a concentration of 50 pg / μL, which was also considered positive. No detection bands were found in the 10 pg / μL sample and the water control. These results indicate that the lower limit of DNA concentration detectable by this method is 50 pg / μL, and ideal bands can be observed at DNA concentrations ≥250 pg / μL.
[0079] Example 4
[0080] The detection results and verification of pepper leaf samples using the primer and probe set of this invention are illustrated in the following flowchart. Figure 5 As shown. The specific experimental method is as follows:
[0081] (1) DNA extraction from pepper leaf samples
[0082] Take 30-50 mg of tissue from the diseased-healthy junction and place it in a 2.0 ml EP tube. Add 500 μl of DNA extraction buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1% Tween 20, 2% PVP-40) and one glass bead (approximately 5 mm in diameter). Shake vigorously up and down for 15 seconds. Take a qualitative filter paper strip approximately 3 × 50 mm in length and width, immerse it in the extraction buffer for 5 seconds, remove it, gently dip it into 800 μl of washing buffer (10 mM Tris pH 8.0, 0.1% Tween 20), and immediately lift it out. Repeat this immersion and extraction process 3-5 times.
[0083] (2) RPA amplification
[0084] RPA amplification was performed using the TwistAmp nfo Kit. Following the instructions, each sample of dry powder was mixed with 29.4 μL of Abuffer, 2 μL each of 10 μM forward and reverse primers, 0.6 μL of 10 μM probe, and 13.5 μL of sterile water. The DNA-carrying sample was gently immersed and lifted, repeated 15 times. 2.5 μL of buffer B (from the amplification kit) was added, and the mixture was inverted 8-10 times to ensure thorough mixing. The mixture was incubated at room temperature for 15 minutes.
[0085] (3) LF chromatography and result determination
[0086] Same as Example 2.
[0087] (4) Laboratory method validation of test results
[0088] 100 mg of the same sample from “(1) DNA extraction from pepper leaf samples” was taken and DNA was extracted using a “High-Efficiency Plant Genomic DNA Extraction Kit” (DP350, Tiangen). PCR amplification was performed using the ypt1 universal primers (ypt1-F: ACGGAGAGCTACATCTCGAC; ypt1-R: GTCAGATCGCTCTTGTTACC) and a “2×HotStart Taq PCR Premixed Reagent” (KT202, Tiangen). After separation of the PCR products by 1% agarose gel electrophoresis, the target band was purified and recovered using a “Universal DNA Purification and Recovery Kit” (DP214, Tiangen). The recovered products were TA cloned using a “pMD 18-T Vector Cloning Kit” (6011, TaKaRa) and then transformed into Escherichia coli TOP10 competent cells. Positive clones were screened by colony PCR and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. After performing BLAST alignment analysis on the NCBI website, the sequencing results were entered into Table 1.
[0089] Table 1. Comparison of field rapid test results and laboratory test results for pepper leaf and vine samples.
[0090] Note: + indicates a positive test result; - indicates a negative test result.
[0091] Figure 6 The results showed that the test results of artificially inoculated leaves infected with pepper blight (sample 1) were positive, the test results of field pepper leaf sample 2 were positive, the test results of field pepper leaf samples 3 to 8 were negative, and the test results of healthy pepper leaf control were negative.
[0092] As can be seen from Table 1, the field test results are completely consistent with the laboratory identification results.
[0093] Example 5
[0094] Detection results and verification of pepper vine samples using the primer and probe set of this invention.
[0095] The implementation method is the same as in Example 4.
[0096] The result is from Figure 7 It can be seen that the test results of artificially inoculated pepper wilt pathogen-infected stems (sample 1) were positive, the test results of field pepper vine samples 5 and 6 were positive, the test results of field pepper vine samples 3, 4, 7 and 8 were negative, and the test results of healthy pepper vine controls were negative.
[0097] As can be seen from Table 1, the field test results are completely consistent with the laboratory identification results.
[0098] Example 6
[0099] Field application of the primer and probe set of the present invention
[0100] The implementation method is the same as in Example 4.
[0101] Figure 8 The results showed that the DNA sample (positive control) of pepper wilt pathogen was positive; the water sample (negative control) was negative; among the 22 field samples (3-44) suspected of having pepper wilt, 23 samples were positive and 19 samples were negative; the DNA control was positive, the water control was negative, and there were 0 failed tests.
[0102] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A primer-probe combination, characterized in that, It includes forward primers, reverse primers, and probes, among which: The nucleotide sequence of the forward primer is shown in SEQ ID NO:1; The nucleotide sequence of the reverse primer is shown in SEQ ID NO:2; The nucleotide sequence of the probe is shown in SEQ ID NO:3; The probe has a fluorescent group labeled at its 5' end, and an idsp group modified between 30 bp and 31 bp from the 5' end. The probe also has a group modified at its 3' end to block polymerase amplification.
2. The primer-probe combination according to claim 1, characterized in that, The 5' end of the reverse primer is labeled with biotin.
3. The use of the primer-probe combination according to claim 1 or 2 in the preparation of reagents or kits for detecting pepper blight pathogens.
4. The application according to claim 3, characterized in that, The samples tested include plant tissue and / or soil samples.
5. A reagent or kit for detecting pepper blight pathogens, characterized in that, Includes the primer-probe combination as described in claim 1 or 2.
6. The reagent or kit according to claim 5, characterized in that, It also includes at least one of the following: RPA enzyme, RPA reaction buffer, magnesium acetate solution, chromatography buffer, ddH2O, and chromatography test strip.
7. A method for detecting pepper blight pathogen, characterized in that, Includes the following steps: Step 1: Extract DNA from the sample; Step 2: Using the DNA of the sample as a template, perform RPA amplification using the primer-probe combination described in claim 1 or 2, or the reagent or kit described in claim 5 or 6; Step 3: Determine whether the sample contains pepper blight pathogen based on the RPA amplification results in Step 2.
8. The method according to claim 7, characterized in that, The reaction system for RPA amplification includes:
9. The method according to claim 8, characterized in that, The reaction conditions for RPA amplification are 25–45°C for 5–60 min.
10. The method according to claim 7, characterized in that, Step 2 involves RPA amplification using the reagents or kits described in claim 5 or 6. In step 3, the amplification product, RPA reaction solution, and chromatography buffer are mixed to prepare a mixture. The sample area of the chromatography strip is placed in the mixture and left at room temperature for 3–4 minutes before observing the results. If both the control line and the test line of the chromatography strip show bands, the test result is positive, indicating that the sample contains *Piper blast fungus*. If only the control line shows a band on the test strip, the test result is negative, indicating that the sample does not contain *Piper blast fungus*. If only the test line appears on the test strip or no band appears at all, the test result is invalid.
Citation Information
Patent Citations
Molecular detection method for high throughput detection of 8 species of phytophthora
CN110079631A
DNA bar code and primer group for identifying genetic relationship of pepper and application of DNA bar code and primer group
CN116334292A