SNP (Single Nucleotide Polymorphism) molecular marker for detecting soybean quality gene and application of SNP molecular marker

Abstract

The invention provides an SNP molecular marker for detecting soybean quality genes and application of the SNP molecular marker, and belongs to the technical field of soybean quality detection. The sequence of the SNP molecular marker is shown as SEQ ID NO.1, an A / T polymorphic site exists at the 71bp in the SEQ ID NO.1, a G / T polymorphic site exists at the 876bp in the SEQ ID NO.1, the 71bp and the 876bp are located at the 6680029th site and the 6680836th site of an encoding gene on a chromosome 18 respectively, the genotypes of the 6680029th site comprise the genotypes of AA, TT and AT, and the genotypes of the 6680836th site comprise the genotypes of GG, TT and GT. The molecular marker identification method disclosed by the invention can be used for rapidly screening out soybean materials with high water-soluble protein content.

Description

Technical Field

[0001] The present invention relates to the technical field of soybean quality detection, and particularly relates to an SNP molecular marker for detecting soybean quality genes and its application. Background Art

[0002] Soybean is an important grain and oil crop, and its yield and quality directly affect global food security and agricultural economy. Soybean is a nutritious food, rich in protein, and is the main raw material for various soy products. Its by-products are also important feed sources, providing a rich source of protein. The quality of soybean is mainly determined by the content of water-soluble protein. However, in soybean breeding, there is a lack of effective molecular markers to quickly and accurately detect gene mutations, which limits its application in quality improvement.

[0003] Traditional detection methods require a large amount of time and resources and are difficult to achieve high-throughput detection in large-scale breeding.

[0004] Therefore, it is necessary to develop an efficient SNP molecular marker that can quickly detect gene mutations in soybeans and provide strong technical support for soybean breeding. Through SNP markers, the genetic variations of soybean genes can be more comprehensively understood, providing more accurate genetic information for soybean quality improvement. Summary of the Invention

[0005] The purpose of the present invention is to provide an SNP molecular marker for detecting soybean quality genes and its application, aiming to solve the problem that comprehensive and accurate detection information cannot be provided for the genetic variation and improvement of soybean genes in the prior art.

[0006] In order to achieve the above object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides an SNP molecular marker for detecting soybean quality genes, and the sequence of the SNP molecular marker is as shown in SEQ ID NO.1.

[0008] Further, there is an A / T polymorphism site at the 71st bp in SEQ ID NO.1, and a G / T polymorphism site at the 876th bp.

[0009] Further, the 71st bp and the 876th bp in SEQ ID NO.1 are respectively located at the 6,680,029th and 6,680,836th positions of the coding gene on chromosome 18.

[0010] Further, the genotypes at the 6,680,029th position include AA, TT, and AT genotypes, and the genotypes at the 6,680,836th position include GG, TT, and GT genotypes.

[0011] Further, the dominant genotype at the 6680029th position is AA, and the dominant genotype at the 6680836th position is GG.

[0012] The present invention also provides an application of the SNP molecular marker for detecting soybean quality genes as described in the above technical solution. Specifically, the application is the use of the SNP molecular marker in molecular breeding assisted selection, rapid detection and evaluation of quality traits, and precise identification and management of germplasm resources.

[0013] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0014] By comparing the SNP locus genotypes of different soybean varieties and combining their quality performances, the present invention establishes an association model between SNP loci and quality traits. This molecular marker can quickly and accurately identify soybean quality, shortening the time and cost of traditional quality identification, providing a powerful tool for soybean breeding, and contributing to the cultivation of new soybean varieties with higher quality.

[0015] The molecular marker identification method of the present invention also has the advantages of being unaffected by environmental factors. Through this method, soybean materials with high water-soluble protein content can be quickly screened out. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is a genotyping result diagram of the 6680029th position of the SNP marker described in Example 1 of the present invention in 82 variety and line materials.

[0017] Figure 2 It is a genotyping result diagram of the 6680836th position of the SNP marker described in Example 1 of the present invention in 82 variety and line materials.

[0018] Figure 3 It is a comparison result diagram of the water-soluble protein content of different haplotype soybean materials in Example 1 of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0019] The present invention provides an SNP molecular marker for detecting soybean quality genes, and the sequence of the SNP molecular marker is as shown in SEQ ID NO.1.

[0020] In the present invention, there is an A / T polymorphism site at the 71st bp of SEQ ID NO.1, and a G / T polymorphism site at the 876th bp.

[0021] In the present invention, the 71st bp and the 876th bp of SEQ ID NO.1 are respectively located at the 6680029th position and the 6680836th position of the coding gene on chromosome 18.

[0022] In the present invention, the genotype at the 6680029th position includes AA, TT, and AT genotypes, and the genotype at the 6680836th position includes GG, TT, and GT genotypes.

[0023] In the present invention, the dominant genotype at the 6680029th position is AA, and the dominant genotype at the 6680836th position is GG.

[0024] The present invention also provides primer pairs for the SNP molecular marker. The primers for the 6680029th position are as shown in SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4; the primers for the 6680836th position are as shown in SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7.

[0025] Extract the DNA of the soybean material to be tested, and use the above primers to detect the material to be tested.

[0026] The specific SEQ ID NO.1 is: GATGGAGTTTGAGGATCCCAAGCTTTTAGATTCACAATCTCTCTCTATATGGGCTACAAAATAAAACGATTTCATGAGGAAAAGAAAAATTACTAGTCATGGCTACCGCAAATAGAGCCGAACAATTTTTAAAAATATATATATATTTAAAATAAAAATAAAAAGATACCCTGACTATATAAGACGTTGAAGCTGGCGAGTTATCAGGACACTTCCACAACTCATTAAACATTTGATTTGTATATGGCAAAAGACAGTTTCATACAACTGATGCACTAAAACACAAACCAAATCAAGACAAAACCAGATTCTGAGATCGCTTCTTCTGTGAAAAAAATTCGTCTTGGCACTGATTCTTTTCGGTTTCCAATGAACTGAGAGTGAAAAGCAGGGAATTAATCAGTTTCATCCAGTGATTGGGTTTTGGCAATCAGATCAAAAACCATGAGAGAAGAAGGTTCAGGATATGACAGCACCCCTTTTTTGGATACCCAATATGCAGAATGTCACGTCGAAAGAACTGGTACAGTGTGGACTGCAGTGGCACACATAGTGACAGGAGTGATAGGGTCAGGAGTGTTGTCTTTGGCATGGAGCATTGCACAGCTTGGATGGATTGGAGGGCCACTCACTATTGTTTTCTTTGCTGCCATCACTCTCCTCTCTTCTTTCCTTCTTAGCAACACATATCGTTCTCCAGACCCTGAACTTGGCCCTCATAGGAGCTCCTCATACCTTGATGCTGTTAATTTGCATAAGGGGGAAGGGAATAGTCGCTTCTGTGCTGTTTTTGTGAACGTAAGCTTATATGGTTTTGGAATTGCTTATGTCATTACTGCTGCTATCAGCATGAGAGCAATCCAAAAATCAAACTGTTCCCAAGACAATGGGAATGAAGTAACATGTGGATTTGGGGATGGATATTTCATGCTTATTTTTGGGGCTATGCAAGTTCTTCTCTCACAGATACCCAACTTCCATAATATTCAATGGTTGTCAATTCTTGCA;

[0027] The specific SEQ ID NO.2 is: GAAGGTGACCAAGTTCATGCTTAAGACTCACCAAATTATATAAAATTCCC;

[0028] The specific SEQ ID NO.3 is: GAAGGTCGGAGTCAACGGATTAAGACTCACCAAATTATATAAAATTCCCT;

[0029] The specific SEQ ID NO.4 is: GAGTGGCACATCACACCCTTAAGAT;

[0030] The specific SEQ ID NO.5 is: GAAGGTGACCAAGTTCATGCTGGCCTG AAAGCTTCTCAGCTG;

[0031] The specific SEQ ID NO.6 is: GAAGGTCGGAGTCAACGGATTAGGCCT GAAAGCTTCTCAGCTT;

[0032] The specific SEQ ID NO.7 is: CTCTCGTTGGATCCATTGAAGGGAT.

[0033] The present invention also provides an application of the SNP molecular marker for detecting soybean quality genes in the above technical solution, and the specific application is the application of the SNP molecular marker in molecular breeding assistant selection, rapid detection and evaluation of quality traits, and precise identification and management of germplasm resources.

[0034] In the present invention, unless otherwise specified, the raw materials required for preparation are all commercially available products well-known to those skilled in the art.

[0035] The technical solution provided by the present invention will be described in detail below in conjunction with the embodiments, but they cannot be construed as limiting the protection scope of the present invention.

[0036] Example 1

[0037] (1) Select test materials

[0038] Use 82 different soybean core germplasms provided by the National Center for Soybean Improvement, as shown in Table 1 specifically:

[0039] Table 1 82 different quality soybean germplasm tables

[0040]

[0041]

[0042] (2) Design primers for SNP molecular markers

[0043] The nucleotide sequences of the primers at the 6680029th position are shown in SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4; the nucleotide sequences of the primers at the 6680836th position are shown in SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7;

[0044] (3) Prepare template DNA

[0045] Extract the DNA of 82 soybean materials. Detect with Nanodrop2100, and the A260 / 280 is between 1.8 - 2.0, indicating that the DNA sample has no protein contamination; the A260 / 230 is between 1.8 - 2.0, indicating that the DNA sample has a low salt ion concentration. Adjust the DNA concentration to 10 - 20 ng / μL;

[0046] (4) Genotyping

[0047] Use the SNP primers to detect 82 test materials. The reaction system of the 384 - well plate is shown in Table 2;

[0048] The specific procedure is: pre - denaturation at 95°C for 15 minutes; 95°C for 20 seconds (denaturation) - 65°C - 55°C for 1 minute (annealing & extension: amplify for 10 cycles with a touch - down program, decreasing 0.6°C per cycle); 95°C for 20 seconds (denaturation) - 55°C for 60 seconds and continue to amplify for 30 cycles.

[0049] Table 2 Reaction system of the 384 - well plate

[0050]

[0051] Note: During the liquid separation process of Meridian, in order to exhaust air bubbles, 230 μL of the reaction solution will be lost each time a pair of primers is added, that is, 115 μL of 2x Mastermix and ddH 2 O each 115 μL

[0052] After the amplification is completed, use the BMG PHERAstar instrument to detect the fluorescence signal and view the genotyping situation. The results are as Figure 1 、 Figure 2 shown; Figure 1 For the SNP at the 6680029th position, among them, the genotypes of red, blue, and green are TT, AA, and TA respectively; Figure 2 For the SNP at the 6680836th position, among them, the genotypes of red, blue, and green are TT, GG, and TG respectively.

[0053] The genotyping results of each material are shown in Table 3. The genotype AA-GG is haplotype 1 (Hap1), the genotype TT-TT is Hap2, and the genotype TT-GG is Hap3. Among the 82 materials, 36 materials are Hap1, 32 materials are Hap2, 13 materials are Hap3, and one material has a heterozygous genotype (TA-TG).

[0054] Table 3 Genotyping Table of 82 Soybeans with Different Qualities

[0055]

[0056]

[0057] The water-soluble protein contents of materials with different haplotypes were compared, and the results are as Figure 3 shown. Based on Figure 3 it can be seen that: the water-soluble protein of Hap1 materials is the highest, and the water-soluble protein content of Hap3 is the lowest, indicating that the molecular marker combining two SNP loci (SNP-6680029, SNP-6680836) can be used to quickly detect soybean materials with high water-soluble protein.

[0058] The above is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A SNP molecular marker for detecting soybean quality genes, characterized in that: The sequence of the SNP molecular marker is shown as SEQ ID NO.

1.

2. The SNP molecular marker for detecting soybean quality genes according to claim 1, characterized in that: In the SEQ ID NO.1, there is an A / T polymorphic site at the 71 bp position, and there is a G / T polymorphic site at the 876 bp position.

3. The SNP molecular marker for detecting soybean quality genes according to claim 2, characterized in that: The 71 bp and the 876 bp in the SEQ ID NO. 1 are located at the 6680029th and 6680836th positions of the coding gene on chromosome 18 respectively.

4. The SNP molecular marker for detecting soybean quality genes according to claim 3, characterized in that: The genotype at position 6680029 includes AA, TT and AT genotypes, and the genotype at position 6680836 includes GG, TT and GT genotypes.

5. The SNP molecular marker for detecting soybean quality genes according to claim 4, characterized in that: The dominant genotype at position 6680029 is AA, and the dominant genotype at position 6680836 is GG.

6. A use of the SNP molecular marker for detecting soybean quality genes according to any one of claims 1 to 5, characterized in that: The application specifically refers to the application of the SNP molecular marker in molecular breeding assisted selection, rapid detection and evaluation of quality traits, and precise identification and management of germplasm resources.

Images