Aspergillus niger, preparation, use and method for preparing citric acid

By screening the highly active Aspergillus niger strain SYHQ-13 and optimizing the fermentation conditions, the problem of low citric acid yield from Aspergillus niger fermentation was solved, achieving efficient and low-cost citric acid production.

CN120082445BActive Publication Date: 2026-01-09BINZHOU SANYUAN BIOLOGICAL TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510584902.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-08
Publication Date
2026-01-09
Estimated Expiration
2045-05-08

AI Technical Summary

Technical Problem

Existing methods for producing citric acid using Aspergillus niger fermentation suffer from problems such as low strain activity, low acid production, and high production costs. Current improvement methods have failed to effectively address the issues of increasing yield and efficiency.

Method used

A highly viable Aspergillus niger strain, SYHQ-13, was screened out. By optimizing the fermentation medium and conditions, the fermentation time was shortened to 55 h, the yield reached 245 g/L, and the conversion rate was as high as 98%.

Benefits of technology

It achieves efficient production of citric acid, shortens fermentation time, reduces production costs, and is suitable for industrial applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120082445B_ABST
    Figure CN120082445B_ABST
Patent Text Reader

Abstract

The application discloses Aspergillus niger, a preparation, application and a preparation method of citric acid, and belongs to the technical field of microorganisms. Aspergillus niger The Aspergillus niger (Aspergillus niger) provided by the application is preserved in the China General Microbiological Culture Collection Center on December 26, 2022, the address of the preservation center is No. 1, Xili, Beichen West Road, Beijing City, Chaoyang District, and the Institute of Microbiology of the Chinese Academy of Sciences is located at No. 3, Xili, Beichen West Road, Beijing City, Chaoyang District; the preservation number is CGMCC No. 40466. The Aspergillus niger (Aspergillus niger) strain has high activity and good stability, the yield of citric acid reaches 245 g / L, the conversion rate is high, and the fermentation time is shortened to < 60 h in the citric acid production process, so that the production cost is greatly reduced, and the Aspergillus niger is suitable for industrial production of citric acid. Aspergillus niger ​
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microbial technology, and particularly relates to Aspergillus niger, preparation, application and preparation method of citric acid. BACKGROUND

[0002] The information disclosed in this Background section is only for the purpose of increasing an understanding of the general context of the present application and does not necessarily constitute an admission that the information forms part of the prior art already known in this field.

[0003] As an important organic acid, citric acid has a wide range of applications in food, chemical, textile, environmental protection, medicine, cosmetics and other industries. Aspergillus niger is outstanding in the industrial production of citric acid fermentation due to its low by-product and wide substrate selection. At present, the market demand for citric acid is relatively scarce, and most of the Aspergillus niger strains for citric acid fermentation have low activity and low acid production, so it is of great significance to study Aspergillus niger strains with high activity and high citric acid production.

[0004] Some researchers have improved the production of citric acid to 187 g / L by regulating the production of Aspergillus niger for citric acid fermentation, reducing the amount and cycle of seed production, and improving the stability of seed quality. Some researchers have obtained Aspergillus niger engineering strains through genetic engineering, although the production of citric acid has been improved, but the final yield is only 183 g / L. Some researchers remove citric acid during fermentation, which shortens the fermentation time and improves the conversion rate, but significantly increases the production cost. SUMMARY

[0005] In order to solve the problems of the prior art, the present application provides an Aspergillus niger, preparation, application and preparation method of citric acid. The present application aims at the problems of low yield and long fermentation time in the existing Aspergillus niger fermentation production of citric acid, and through a large number of screening, a high-activity Aspergillus niger (Aspergillus niger) is screened from corn farmland in Zhanhua, Shandong. Aspergillus niger The yield of citric acid reaches 245 g / L, and the conversion rate is as high as 98% through fermentation in the fermentation medium for 55 h. The method has high raw material conversion rate, high yield, and the product is easy to separate and purify.

[0006] In order to achieve the above-mentioned purpose, the technical scheme of the present application is as follows:

[0007] In a first aspect of the present application, an Aspergillus niger (Aspergillus niger) is provided. Aspergillus niger The Aspergillus niger was deposited at the China General Microbiological Culture Collection Center on December 26, 2022, and the deposit number is CGMCC No.40466.

[0008] In a second aspect of the present application, a preparation is provided, which comprises the above-mentioned Aspergillus niger (Aspergillus niger).Aspergillus niger ) or a fermentation broth thereof.

[0009] In a third aspect, the present application provides the above-mentioned Aspergillus niger (A. niger) for use in the production of citric acid. Aspergillus niger ) or the above-mentioned preparation for use in the production of citric acid.

[0010] In some embodiments of this implementation, the use comprises fermenting the above-mentioned Aspergillus niger (A. niger) in a culture medium to obtain citric acid. Aspergillus niger ) to obtain citric acid.

[0011] In a fourth aspect, the present application provides a method for preparing citric acid, comprising the following steps:

[0012] Inoculating the above-mentioned Aspergillus niger (A. niger) into a fermentation medium to obtain citric acid. Aspergillus niger ) to obtain citric acid.

[0013] In some embodiments of this implementation, the method comprises:

[0014] Inoculating the above-mentioned Aspergillus niger (A. niger) into a culture medium and culturing until spores are produced; Aspergillus niger

[0015] Culturing the spores in a seed culture medium to obtain a seed broth;

[0016] Inoculating the seed broth into a fermentation medium to ferment and obtain citric acid.

[0017] In some embodiments of this implementation, the above-mentioned Aspergillus niger (A. niger) is inoculated into the culture medium and cultured at 30-45°C. Aspergillus niger In some embodiments of this implementation, the spores are inoculated into the seed culture medium at a concentration of 1×10 5 -1×10 6 / mL.

[0018] The culture conditions are: 30-40°C, 250-350 rpm, and 20-30 h of shaking culture to obtain the seed broth.

[0019] In some embodiments of this implementation, the seed broth is inoculated into the fermentation medium at an inoculation amount of 5-15%, and fermented at 30-40°C, 300-350 rpm for 50-55 h to obtain citric acid.

[0020] In some embodiments of this implementation, the total sugar content of the seed culture medium is 100-150 g / L, and the total nitrogen content is 2-4 g / L.

[0021]

[0022] ​​The total sugar content of the fermentation medium is 200-250 g / L, the total nitrogen content is 1-1.5 g / L, and the pH value is 5-6.

[0023] The beneficial effects of the present application are:

[0024] The present application provides a strain of Aspergillus niger (Aspergillus niger) SYHQ-13. Aspergillus niger The strain has high activity, the yield of citric acid reaches 245 g / L, the conversion rate is high, and the fermentation time is shortened to <60 h (to 55 h) in the production process of citric acid, which greatly reduces the production cost and is suitable for industrial production of citric acid. BRIEF DESCRIPTION OF DRAWINGS

[0025] The drawings accompanying the specification of the present application serve to provide a further understanding of the present application, and the illustrative embodiments of the present application and their descriptions serve to explain the present application, and do not constitute an improper limitation on the present application.

[0026] Aspergillus niger The colony morphology of Aspergillus niger SYHQ-13 obtained in Example 1 of the present application on solid medium. DETAILED DESCRIPTION

[0027] Biological preservation instructions:

[0028] Culture name: Aspergillus niger (Aspergillus niger) SYHQ-13 Figure 1 , which was preserved in the China General Microbiological Culture Collection Center on December 26, 2022, and the address of the preservation center is: No. 3, Institute of Microbiology, Chinese Academy of Sciences, Beijing City, Chaoyang District, Beichen West Road 1st Courtyard; the preservation number is: CGMCC No. 40466.

[0029] The Aspergillus niger (Aspergillus niger) SYHQ-13 mentioned in the present application is the strain with the preservation number CGMCC No. 40466. Aspergillus niger The present application discloses a strain of Aspergillus niger, a preparation, an application, and a preparation method of citric acid.

[0030] The present application discloses a strain of Aspergillus niger, a preparation, an application, and a preparation method of citric acid.

[0031] The present application discloses a strain of Aspergillus niger, a preparation, an application, and a preparation method of citric acid. Aspergillus niger), which is preserved in China General Microbiological Culture Collection Center on December 26, 2022, and the preservation number is CGMCC No. 40466.

[0032] The Aspergillus niger ( Aspergillus niger ) is a natural strain, which is screened from nature.

[0033] Specifically, the screening method of the strain is as follows: the sample collected from the natural environment is inoculated on PDA medium (potato 200 g / L, glucose 20 g / L), pH 7.0, temperature 30℃, 300 r / min shaker culture for 100 h, and then a proper amount of sample is diluted, and the diluted liquid is coated on the solid medium (bran 36 g / L, diammonium hydrogen sulfate 10 g / L, dipotassium hydrogen sulfate 0.2 g / L, magnesium sulfate 0.1 g / L, agar 20 g / L), and cultured at 30℃ for 3 days; the strain with a colony morphology similar to Aspergillus niger is selected, inoculated into a 24-well deep well plate containing fermentation medium, and cultured at 35℃, 300 r / min for 55 h, and then the content of citric acid in the fermentation broth is detected.

[0034] The detection method of citric acid is as follows: the content of citric acid is detected by using a Water high performance liquid chromatograph, an HPX87H chromatographic column (4.6*250 mm, 5 μm), a column temperature of 30℃, a mobile phase of 5 mM sulfuric acid solution, a flow rate of 0.5 mL / min, a sample injection amount of 10 μL, and ultraviolet light detection at a detection wavelength of 210 nm.

[0035] The second typical embodiment of the present application provides a preparation, which comprises the above-mentioned Aspergillus niger ( Aspergillus niger ) or the fermentation broth thereof.

[0036] The third typical embodiment of the present application provides the above-mentioned Aspergillus niger ( Aspergillus niger ) or the above-mentioned preparation for producing citric acid.

[0037] In some embodiments of the embodiment, the application comprises fermenting the above-mentioned Aspergillus niger ( Aspergillus niger ) in a culture medium to obtain citric acid.

[0038] The fourth typical embodiment of the present application provides a preparation method of citric acid, which comprises the following steps:

[0039] Inoculating the above-mentioned Aspergillus niger ( Aspergillus niger ) into a fermentation medium to ferment and obtain citric acid.

[0040] In some embodiments of the embodiment, the preparation method specifically comprises the following steps:

[0041] The above-mentioned Aspergillus niger is inoculated into a culture medium and cultured until spores are produced; Aspergillus niger

[0042] The spores are inoculated into a seed culture medium and cultured to obtain a seed liquid;

[0043] The seed liquid is inoculated into a fermentation culture medium and fermented to obtain citric acid.

[0044] According to the present application, the conditions for the culture until spores are produced are not particularly limited, but in order to shorten the culture time and obtain fresh spores, preferably, the above-mentioned Aspergillus niger is inoculated into a culture medium and cultured at 30-45°C. Aspergillus niger

[0045] According to the present application, the culture medium is not particularly limited and can be a culture medium conventionally used in the art, as long as it allows the Aspergillus niger to grow normally and produce spores.

[0046] According to the present application, the conditions for the culture of the spores in the seed culture medium are not particularly limited, but in order to shorten the culture time, preferably, the spores are inoculated into the seed culture medium at a concentration of 1x10 5 -1x10 6

[0047] According to the present application, the conditions for the fermentation are not particularly limited, but in order to shorten the fermentation time, the seed liquid is inoculated into a fermentation culture medium at an inoculation amount of 5-15%, and preferably, the fermentation is carried out at 30-40°C and 300-350 rpm for 50-55 h to obtain citric acid.

[0048] According to the present application, the seed culture medium is not particularly limited and can be a seed culture medium conventionally used in the art, as long as it allows the Aspergillus niger to grow normally. Preferably, the total sugar content of the seed culture medium is 100-150 g / L and the total nitrogen content is 2-4 g / L, based on the volume of the seed culture medium.

[0049] According to the present application, the fermentation culture medium is not particularly limited and can be a fermentation culture medium conventionally used in the art, as long as it allows the Aspergillus niger to ferment normally. Preferably, the total sugar content of the fermentation culture medium is 200-250 g / L, the total nitrogen content is 1-1.5 g / L, and the pH value is 5-6, based on the volume of the fermentation culture medium.

[0050] According to the present application, the raw materials for the preparation of the fermentation culture medium are not particularly limited and can be the raw materials conventionally used in the art.​​​

[0051] The Aspergillus niger of the present application can produce citric acid by fermentation in the presence of a high concentration of sugar (starch sugar). Preferably, the fermentation medium contains starch sugar. Starch sugar refers to sugar obtained by enzymatic preparation using starch-containing grains, crops, potatoes, etc. as raw materials, including maltose, glucose, fructose, etc.

[0052] The starch sugar can be obtained by mixing starch with amylase (alpha-amylase or isoamylase) for liquefaction. The preparation method of starch sugar is as follows: using starch-containing grains, crops, potatoes, etc. as raw materials, the raw materials are prepared into starch slurry, and the starch slurry is mixed with amylase (alpha-amylase or isoamylase) for liquefaction. The liquefaction conditions are: pH 6-7, temperature 85-100℃, and liquefaction time 1-2 h. Finally, starch liquefaction liquid is obtained, which includes maltose, glucose, fructose.

[0053] The Aspergillus niger of the present application can produce citric acid by fermentation in the presence of a nitrogen source (corn slurry). Preferably, the fermentation medium contains corn slurry. Corn slurry refers to a product obtained by enzymatic preparation using starch-containing corn flour as raw material.

[0054] The corn slurry can be obtained by mixing corn flour with amylase (alpha-amylase or isoamylase) and saccharifying enzyme for liquefaction and saccharification. The preparation method of corn slurry is as follows: using starch-containing corn flour as raw material, and mixing with amylase (alpha-amylase or isoamylase) and saccharifying enzyme for liquefaction and saccharification. The liquefaction conditions are: pH 5-7, temperature 80-90℃, and liquefaction time 2-4 h. Finally, corn slurry subjected to liquefaction and saccharification is obtained.

[0055] According to the present application, the amount of raw material for preparing the fermentation medium is not particularly limited, and preferably, the fermentation medium is obtained by mixing starch liquefaction liquid (sugar source) with corn slurry (nitrogen source) and adjusting the pH to 5-6. The amount of starch liquefaction liquid is usually 96-98% (by weight), and the amount of corn slurry is usually 2-4% (by weight).

[0056] The test method for citric acid content (fermentation acid production) refers to GB 1886.235-2016 National Food Safety Standard Food Additive Citric Acid; Fermentation conversion rate = total acid yield / total sugar amount x 100%.

[0057] In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in combination with specific examples.

[0058] Example 1: Screening of strains

[0059] Samples collected from the natural environment were diluted 10-fold with sterile water and inoculated onto PDA medium (potato 200 g / L, glucose 20 g / L), and cultured at pH 7.0, 30℃, and 300 r / min in a shaker for 100 h. A suitable amount of sample was then diluted, and the diluted solution was spread onto solid medium (wheat bran 36 g / L, diammonium hydrogen sulfate 10 g / L, dipotassium hydrogen sulfate 0.2 g / L, magnesium sulfate 0.1 g / L, agar 20 g / L) and cultured at 30℃ for 3 days. Strains with colony morphology similar to Aspergillus niger were selected, picked out with sterile toothpicks, and inoculated into 24-well deep-well plates containing fermentation medium (total sugar content 150 g / L, total nitrogen content 1 g / L). After culturing at 35℃ and 300 r / min for 55 h, the citric acid content in the fermentation broth was measured.

[0060] Citric acid detection method: Citric acid content was detected using a Water high-performance liquid chromatograph with an HPX87H column (4.6×250 mm, 5 μm), a column temperature of 30℃, a mobile phase of 5 mM sulfuric acid solution, a flow rate of 0.5 mL / min, an injection volume of 10 μL, and detection wavelength of 210 nm ultraviolet light.

[0061] Through screening more than 1200 strains from over 100 samples, a highly active Aspergillus niger was finally identified from cornfields in Zhanhua, Shandong. Aspergillus niger The sequence of SYHQ-13 and its associated ITS (internal transcribed spacer) is shown in SEQ ID NO.1. It was deposited on December 26, 2022, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 40466.

[0062] GTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA (SEQ ID NO. 1)

[0063] The selected Aspergillus niger (SYHQ-13) was used to perform the following tests. Aspergillus niger

[0064] Example 2: Stability test of the strain

[0065] With the increase of the number of passages, the changes of the selected strain, such as spore yield and activity, were investigated. The selected Aspergillus niger (SYHQ-13) was used to perform the following tests. Aspergillus niger ​SYHQ-13 stalks were streaked onto solid culture medium (wheat bran 36 g / L, diammonium bisulfate 10 g / L, dipotassium bisulfate 0.2 g / L, magnesium sulfate 0.1 g / L, agar 20 g / L). The culture was incubated at 30°C for 72 h, representing the second generation. Following this method, the second-generation stalk spores were progressively transferred to solid culture medium (wheat bran 36 g / L, diammonium bisulfate 10 g / L, dipotassium bisulfate 0.2 g / L, magnesium sulfate 0.1 g / L, agar 20 g / L) to obtain the 3rd, 4th, 5th, 6th, 7th, 8th, 9th, and 10th generations of spores. The spores from the 10 generations were prepared into spore suspensions, and the spore counts were determined using a hemocytometer to obtain the number of spores per plate for each generation.

[0066] Aspergillus niger ( Aspergillus niger SYHQ-13 was inoculated into 250 mL shake flasks containing 50 mL of fermentation medium (total sugar content 150 g / L, total nitrogen content 1 g / L) for shake flask culture. The inoculum size was 2.5 × 10⁻⁶. 5 After culturing at 35℃ and 300 r / min for 55 h, the citric acid content in the fermentation broth was measured and the fermentation conversion rate was calculated.

[0067] The results are shown in Table 1:

[0068] Table 1 Results of strain passaging stability experiments

[0069]

[0070] As shown in Table 1, this Aspergillus niger ( Aspergillus niger With increasing subculturing, the spore yield and citric acid yield of SYHQ-13 remained relatively stable, indicating that Aspergillus niger (…) Aspergillus niger SYHQ-13 has good stability.

[0071] Example 3: Aspergillus niger ( Aspergillus niger Acid resistance verification of SYHQ-13

[0072] To test the acid resistance of the strain, the pH of the initial fermentation medium was adjusted (2-5), and then the yield of citric acid was tested.

[0073] Aspergillus niger ( Aspergillus niger SYHQ-13 was streaked onto a solid culture medium (wheat bran 36 g / L, diammonium hydrogen sulfate 10 g / L, dipotassium hydrogen sulfate 0.2 g / L, magnesium sulfate 0.1 g / L, agar 20 g / L). The medium was incubated at 30°C for 72 h.

[0074] Aspergillus niger activated on solid culture medium ( Aspergillus nigerSYHQ-13 spores were inoculated into 250 ml shake flasks containing 50 mL of fermentation medium (total sugar content 150 g / L, total nitrogen content 1 g / L) for shake flask culture. The inoculum size was 2.5 × 10⁻⁶ spores. 5 The inoculum density was 1 spore / mL, and the initial pH of the fermentation medium was adjusted to (2, 3, 4, 5, 6). The inoculum size was 2.5 × 10⁻⁶. 5 After culturing at 35℃ and 300 r / min for 55 h, the citric acid content in the fermentation broth was measured and the fermentation conversion rate was calculated.

[0075] Table 2 Results of acid resistance test of the strains

[0076]

[0077] Table 2 shows that the citric acid production of this Aspergillus niger strain decreased with decreasing pH of the fermentation medium. However, the conversion rate remained at 88% even when the pH dropped to 2, indicating that Aspergillus niger (… Aspergillus niger SYHQ-13 has good acid resistance.

[0078] Example 4: Aspergillus niger ( Aspergillus niger Application of SYHQ-13 in the synthesis of citric acid

[0079] (1) Aspergillus niger ( Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus niger Aspergillus SYHQ-13 was inoculated onto a solid culture medium (wheat bran 36 g / L, diammonium hydrogen sulfate 10 g / L, dipotassium hydrogen sulfate 0.2 g / L, magnesium sulfate 0.1 g / L, agar 20 g / L) capable of spore production by Aspergillus niger, and cultured at 30°C until fresh spores were produced; the spores were collected and cultured at 6 × 10⁻⁶ ppm. 5 The spores were inoculated at a concentration of 100 spores / mL into the seed culture medium, which had a total sugar content of 100 g / L and a total nitrogen content of 2 g / L. The seed culture was then carried out under the following conditions: 30℃, 300 rpm shaking culture for 30 h to obtain the seed culture.

[0080] (2) Inoculate the seed culture at a rate of 10% (3×10⁻⁶) 5 Aspergillus niger (CFU / mL) was inoculated into a fermentation medium (250L fermenter). The total sugar content of the fermentation medium was 250 g / L, the total nitrogen content was 1.5 g / L, the pH value was 6, and the dissolved oxygen content was controlled at 35%. Fermentation was carried out at 35℃ and 350 rpm for 55 h to obtain citric acid. After the fermentation was completed, the citric acid yield was measured to be 245 g / L, and the conversion rate was 98%.

[0081] The above merely provides the preferred embodiments of the present application, and is not used to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the principles and technical scope of the present application shall fall into the scope of the present application.

Claims

1. Aspergillus niger ( Aspergillus niger SYHQ-13, characterized in that, The Aspergillus niger was deposited at the China General Microbiological Culture Collection Center on December 26, 2022, with accession number CGMCC No. 40466.

2. A formulation, characterized in that, Including Aspergillus niger as described in claim 1 ( Aspergillus niger SYHQ-13 or its fermentation broth.

3. The Aspergillus niger as described in claim 1 ( Aspergillus niger The use of SYHQ-13 or the formulation of claim 2 in the production of citric acid.

4. The application as described in claim 3, characterized in that, The application includes processing the Aspergillus niger of claim 1 in a culture medium. Aspergillus niger SYHQ-13 was fermented to obtain citric acid.

5. A method for preparing citric acid, characterized in that, Includes the following steps: The Aspergillus niger as described in claim 1 ( Aspergillus niger SYHQ-13 was inoculated into a fermentation medium for fermentation to obtain citric acid.

6. The preparation method according to claim 5, characterized in that, The preparation method includes: The Aspergillus niger as described in claim 1 ( Aspergillus niger SYHQ-13 was inoculated onto the culture medium and cultured until spores were produced; Spores were inoculated into a seed culture medium and cultured to obtain a seed solution; The seed culture was inoculated into a fermentation medium for fermentation to obtain citric acid.

7. The preparation method according to claim 6, characterized in that, The Aspergillus niger (as described in claim 1) Aspergillus niger SYHQ-13 was inoculated onto the culture medium and cultured at 30-45℃.

8. The preparation method according to claim 6, characterized in that, Spores were 1×10 5 -1×10 6 Inoculate the seed culture medium at a concentration of 1 / mL and culture. The culture conditions were: 30-40℃, 250-350 rpm shaking culture for 20-30 h to obtain seed culture.

9. The preparation method according to claim 6, characterized in that, Inoculate the seed culture into the fermentation medium at an inoculum rate of 5-15%, and ferment at 30-40℃ and 300-350 rpm for 50-55 h to obtain citric acid.

10. The preparation method according to claim 6, characterized in that, The total sugar content of the seed culture medium is 100-150 g / L, and the total nitrogen content is 2-4 g / L; The fermentation medium has a total sugar content of 200-250 g / L, a total nitrogen content of 1-1.5 g / L, and a pH value of 5-6.

Citation Information

Patent Citations

  • Aspergillus niger and application thereof as well as citric acid preparation method through fermentation

    CN102399702A

  • Aspergillus niger and application thereof in preparation of citric acid

    CN116676200A