Construction method of drug-resistant depression animal model

Abstract

The invention belongs to the technical field of animal model construction, and discloses a construction method of a drug-resistant depression animal model. A Cx43flox / flox mouse is constructed through a CRISPR / Cas9 technology, an AAV virus vector of Cre recombinase encoding a GfaABC1D promoter is further injected into the forehead cortex in a positioned mode, and a model mouse of the forehead cortex with the astrocyte Cx43 being conditionally knocked out is constructed. Through behavioral experiments and inflammatory reaction detection, depression-like behaviors of animals in the model and inflammatory reaction of the forehead cortex are evaluated, and treatment failure of antidepressant drugs on the model is observed. According to the invention, the drug-resistant depression animal model can be stably, simply and repeatedly constructed, and a research basis is provided for research on the pathogenesis of refractory depression and development of antidepressant drugs.

Description

Technical Field

[0001] The present invention belongs to the technical field of animal model construction, and particularly relates to a method for constructing an animal model of drug-resistant depression. Background Art

[0002] Depression is a mental disorder that seriously affects mood, behavior, and health. The main symptoms include persistent low mood, accompanied by somatic symptoms such as insomnia, loss of vitality, and easy fatigue. In severe cases, there is even a suicidal tendency. Currently, the drugs for clinical treatment of depression mainly include serotonin reuptake inhibitors and norepinephrine reuptake inhibitors targeting the monoamine system, but they have disadvantages such as slow onset and poor patient compliance. At the same time, about 30% of patients do not respond well to the drugs and show treatment-resistant depression. New antidepressant drugs such as esketamine can have a certain improvement effect on treatment-resistant depression, but they also have mental side effects such as addiction and hallucination. Therefore, developing therapeutic drugs with both safety and effectiveness has very important scientific value and clinical significance.

[0003] Animal models of depression are important tools for evaluating antidepressant drugs and studying the pathogenesis of depression, and are the basis for new drug discovery. Currently, commonly used animal models of depression include the chronic unpredictable mild stress model (CUMS), the chronic social defeat model (CSDS), learned helplessness (LH), the glucocorticoid-induced model, the olfactory bulbectomy model (OBX), the early life stress model (ELS), the lipopolysaccharide (LPS)-induced model, etc. Although these models can simulate the pathological characteristics of depression to a certain extent, they also have their own deficiencies. The CUMS model is a commonly used model for evaluating antidepressant drugs, but it has a long modeling period, requires repeated stress, has individual differences, and is easily affected by changes in the surrounding environment. The CSDS model has a shorter modeling period compared to the CUMS model and can reflect social interaction and distinguish stress sensitivity, but it cannot be used for modeling female animals and is likely to cause relatively severe anxiety-like behaviors in animals. The LH model has a short modeling period and the experiment is relatively simple, but the duration of depressive-like behaviors in the model is short, and there is currently also a controversy over whether learned helplessness is a specific pathological characteristic of depression patients. The glucocorticoid-induced model has relatively small individual differences, but requires continuous administration multiple times and continuous monitoring of behavioral performance. The OBX model can stably induce depressive-like behaviors in animals, but the injury is irreversible and the mortality rate is relatively high, and there are significant differences from the pathogenesis of clinical depression. The ELS model includes mother-infant separation, etc., and its phenotypic changes are relatively stable, but special breeding of neonatal mice is required, and the experiment is relatively cumbersome. The LPS-induced depressive model can better simulate inflammation-induced depressive-like behaviors and is suitable for the study of depression with inflammation as the target, but it has the disadvantage of a relatively short duration of depressive-like behaviors, and repeated administration is required. Multiple peripheral LPS injections are likely to cause disorders in other systems. However, traditional models cannot effectively simulate the drug resistance symptoms of treatment-resistant depression and are not suitable as tools for studying treatment-resistant depression.

[0004] Research has shown that the out-of-control inflammatory response is one of the important pathological characteristics of treatment-resistant depression. The efficacy of anti-depressant drugs is closely related to the inflammatory response. For example, the plasma C-reactive protein level of treatment-resistant depression patients is significantly increased, and autopsy results of treatment-failed patients show a significant up-regulation of inflammatory factor levels in the brain. On the other hand, non-steroidal anti-inflammatory drugs, cytokine monoclonal antibodies, etc. also have a certain improvement effect on depression, and the effect of anti-inflammatory treatment combined with anti-depressant treatment is more obvious, further indicating that the inflammatory response is an important target for studying drug-resistant depression.

[0005] Astrocytes are the most abundant glial cells in the central nervous system and play a very important role in maintaining brain homeostasis and regulating the balance of the brain internal environment. Astrocytes can regulate neuroinflammation in the brain through both anti-inflammatory and pro-inflammatory aspects, and are closely related to the pathogenesis of depression. Connexin Cx43 is the most abundant connexin in astrocytes. Six connexins form a connexon to participate in the formation of gap junction channels and hemichannels, mediating cell communication and material exchange. The prefrontal cortex is an important part of the limbic system and is involved in the regulation of emotions. Studies have shown that the expression level of Cx43 protein in the prefrontal cortex of patients with depression is significantly reduced, and blocking the gap junctions of astrocytes in the prefrontal cortex can lead to depressive-like behaviors in animals. In addition, astrocytic Cx43 is involved in the regulation of inflammatory responses. On the one hand, inflammatory responses lead to disorders of astrocytic gap junctions and an increase in the opening of hemichannels. On the other hand, knocking out astrocytic Cx43 will cause an increase in the levels of interleukin-1β (IL-1β) and TNF-α in the brain, and up-regulate the expression levels of inflammatory-related genes such as chemokines. Importantly, some studies have shown that inhibiting gap junctions mediated by astrocytic Cx43 can lead to ineffective treatment with fluoxetine, further demonstrating the important role of astrocytic Cx43-mediated neuroinflammation in drug-resistant depression, and animal models constructed based on astrocytic Cx43 can simulate the neuroinflammatory response and drug treatment resistance of refractory depression.

[0006] To simulate the biological phenotypes resulting from gene deletion in animals, methods such as complete gene knockout and conditional knockout are commonly used. Gene targeting using technologies like TALEN, ZFN, and CRISPR / Cas9 enables gene knockout at the whole-body tissue and cell level. Its advantage is that stable breeding can be carried out after successful construction, but it cannot be used for the study of embryonic lethal genes, and systemic gene deletion may trigger functional disorders in multiple systems. The conditional knockout model can specifically knockout genes in cell types, mainly constructed using the Cre-loxP recombination system, which is divided into two strategies. One is to use transgenic technology to cross Cre animals with specific promoters and flox animals with floxed sites knocked in to obtain animals with systemic conditional gene knockout. However, for the central nervous system, due to the different functions of different brain regions and their respective complex regulatory roles in physiological processes, systemic conditional knockout cannot simulate the pathological changes in key brain regions. Another strategy is to use transgenic technology to construct flox animals with floxed sites knocked in, and then inject a viral vector encoding Cre recombinase with a specific promoter into specific brain regions. Selecting a suitable viral vector can maintain the gene knockout effect for a long time. This method can precisely regulate gene expression in specific brain regions and is more suitable for the study of the central nervous system. Therefore, constructing an animal model with conditional knockout of astrocyte Cx43 in the prefrontal cortex using CRISPR / Cas9 and the Cre-loxP system can simulate the deletion of astrocyte Cx43 in the prefrontal cortex and serve as an animal model for studying the pathogenesis of drug-resistant depression and the development of antidepressant drugs.

[0007] Therefore, based on the above content, the present invention is proposed. Summary of the Invention

[0008] The object of the present invention is to provide a method for constructing an animal model of drug-resistant depression, providing a basis for the evaluation of refractory depression treatment drugs targeting inflammatory responses and the study of the pathogenesis of drug-resistant depression with dysregulated inflammatory responses as the core.

[0009] To achieve the above object, the present invention adopts the following technical solutions:

[0010] A method for constructing an animal model of drug-resistant depression includes the following steps: Construction of Cx43 flox / flox mice, injection of AAV viral vector, detection of gene knockout effect, evaluation of mouse behavior, evaluation of inflammatory response, evaluation of antidepressant treatment effect.

[0011] Preferably, the construction of the Cx43 flox / flox mice adopts the CRISPR / Cas9 technology.

[0012] Furthermore, the targeting sequence of sgRNA was selected from the second exon of Cx43, and then the following oligo sequences were used: targeting site 1: CCTGTATCTGGGTGCTATTAC, m-Cx43-gRNAUP1: 5’-TAGGGTAATAGCACCCAGATAC-3’ and m-Cx43-gRNA DOWN1: 5’-AAACGTATCTGGGTGCTATTAC-3’; targeting site 2: CAAAAGTAGGGAAAGGGGAGG, m-Cx43-gRNA UP2: 5’-TAGGCAAAAGTAGGGAAAGGGG-3’, and m-Cx43-gRNADOWN2: 5’-AAACCCCCTTTCCCTACTTTTG-3’. The sgRNA PCR product containing the T7 promoter was amplified from the pUC57-sgRNA expression vector (Addgene ID: 51132).

[0013] Furthermore, the obtained product was purified and used as a template for in vitro transcription.

[0014] Furthermore, linearized pST1374-NLS-flag-linker-Cas9 (Addgene ID: 44758) was used for in vitro transcription with the T7 ULTRA kit to obtain Cas9 mRNA.

[0015] Furthermore, Cas9 mRNA, sgRNA, and the Cx43 floxing donor were all purified and then mixed and injected into the fertilized eggs of C57BL / 6 mice. The injected embryos were transplanted into the oviducts of pseudopregnant females for generating chimeric mice. Confirmation was performed by PCR.

[0016] Preferably, the conditions for the PCR were: 95 °C for 15 minutes; 95 °C for 30 seconds, Δ -2 °C for 30 seconds, 72 °C for 3 minutes, 30 cycles; 72 °C for 10 minutes. The primer sequences were forward primer: CCTTAATACTAAATACATCTTCGGCAAG; reverse primer: CCAATGAGACTCTTACTAGAATTTAAGCTC.

[0017] Furthermore, the PCR product was purified for TA cloning and sequencing.

[0018] Furthermore, after mating and screening, homozygous mice were obtained by mouse tail identification. The method for mouse tail identification was: cut off the distal 0.2 - 0.5 cm of the mouse tail, lyse the mouse tail and extract the DNA template, amplify the target gene using PCR, and perform agarose gel electrophoresis on the PCR product.

[0019] Furthermore, the obtained homozygous mice were injected with an AAV viral vector into the prefrontal cortex. Four weeks after viral expression, mice with conditional knockout of Cx43 in prefrontal cortical astrocytes were obtained. Preferably, the viral vector was pAAV-GfaABC1D-mcherry-T2A-Cre-WPRE, the serotype was 2 / 9, and 0.5 μL was injected into each side bilaterally.

[0020] Preferably, the method for detecting the gene knockout effect was immunofluorescence co-staining of GFAP and Cx43 in the prefrontal cortex.

[0021] Preferably, the methods for mouse behavioral testing were tail suspension test, forced swimming test, sucrose preference test, and open field test. Mice meeting the following conditions were considered to exhibit depressive-like behaviors: compared with control group mice, the immobile time was significantly prolonged in the tail suspension test and forced swimming test, the sucrose intake rate was significantly decreased in the sucrose preference test, and the residence time in the central area was significantly shortened in the open field test.

[0022] Preferably, the method for neuroinflammation evaluation was as follows: detecting the morphological changes of astrocytes by immunofluorescence staining, detecting the content of cytokines in the prefrontal cortex by liquid suspension chip, and detecting the changes of genes related to astrocyte activation by qPCR.

[0023] Preferably, the method for detecting the morphological changes of astrocytes by immunofluorescence staining was staining with an antibody against GFAP. The indicators for analysis and statistics were the branch complexity and total branch length of astrocytes.

[0024] Preferably, the types of cytokines detected in the prefrontal cortex were: GM-CSF, G-CSF, MCP-1(CCL2), MIP-1α(CCL3), MIP-1β(CCL4), IL-12p40, IL-1α, IL-1β, Eotaxin(CCL11), IL-4, KC, TNF-α, IL-2, IL-3, IL-5, IL-6, IL-9, IL-10, IL-12p70, IL-13, IL-17, IFN-γ, RANTES(CCL5).

[0025] Preferably, the astrocyte activation-related marker genes are: C3, H2-T23, Serping1, H2-D1, Ggta1, Iigp1, Gbp2, Fbln5, Ugt1a, Fkbp5, Psmb8, Srgn, Clcf1, Tgm1, Ptx3, S100a10, Sphk1, Cd109, Ptgs2, Emp1, Slc10a6, Tm4sf1, Lcn2, Steap4, S1pr3, Timp1, Hspb1, Cxcl10, Cd44, Osmr, Cp, Serpinga3n, Aspg, Vim.

[0026] Preferably, the method for evaluating the antidepressant treatment effect is as follows: After intraperitoneal injection of an equal volume of physiological saline or 10 mg / kg of escitalopram at 1, 3, 6, and 12 hours, the tail suspension test is used to evaluate the effect of the drug on the immobility time.

[0027] Beneficial technical effects: The present invention provides a method for constructing an animal model of drug-resistant depression. Through CRISPR / Cas9 technology, mouse breeding, screening, and identification, Cx43 flox / flox mice were constructed. Further, by using an AAV virus encoding Cre recombinase with the astrocyte promoter GfaABC1D, an animal model with conditional knockout of astrocyte Cx43 in the prefrontal cortex was constructed, and the depressive-like behaviors and inflammatory responses of this model were evaluated. Compared with the existing inventions, the main beneficial effects are as follows: (1) This model does not require multiple repeated stress, drug administration, etc. After virus injection, no other modeling experiments are required, which is simpler than traditional models. (2) This model is based on the Cre-loxP system for gene knockout, and can obtain stable gene manipulation effects with small individual differences, and the model is more stable and consistent. (3) Based on a suitable viral vector, the gene knockout effect of this model can last for a long time, and the biological phenotype is more persistent than that of traditional models. (4) This model can simulate the significant decrease in Cx43 expression and neuroinflammatory responses in the prefrontal cortex of depression, and can be used as a research tool for the pathogenesis of refractory depression and antidepressant drugs targeting inflammatory responses. (5) This model can simulate the failure of antidepressant treatment and can be used as a research tool for the pathogenesis and treatment drugs of refractory depression. Description of the Drawings

[0028] Figure 1 Schematic diagram of the construction of the conditional knockout astrocyte Cx43 model

[0029] Figure 2 Result diagram of agarose gel electrophoresis for mouse tail DNA identification

[0030] Figure 3 Result diagram of immunofluorescence staining of GFAP and Cx43 in the prefrontal cortex

[0031] Figure 4 Graph of the immobility time results in the mouse tail suspension test

[0032] Figure 5 Graph of the immobility time results in the mouse forced swimming test

[0033] Figure 6 Graph of the sucrose intake rate results in the mouse sucrose preference test

[0034] Figure 7 Graph of the residence time results in the central area of the mouse open field test

[0035] Figure 8 Immunofluorescence staining map of GFAP in the prefrontal cortex

[0036] Figure 9 Statistical result graph of the branching complexity of astrocytes in the prefrontal cortex

[0037] Figure 10 Statistical result graph of the total length of astrocyte branches in the prefrontal cortex

[0038] Figure 11 Graph of the detection results of the contents of 23 cytokines in the prefrontal cortex

[0039] Figure 12 Graph of the detection results of the expression levels of astrocyte activation markers in the prefrontal cortex

[0040] Figure 13 Graph of the effect of escitalopram on the immobility time of control mice in the tail suspension test

[0041] Figure 14 Graph of the effect of escitalopram on the immobility time of model mice in the tail suspension test Detailed implementation mode

[0042] Next, the technical solutions of the present invention will be clearly and completely described in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0043] Example 1 Cx43 flox / flox Construction of mice

[0044] Cx43 flox / flox The schematic diagram of the construction of Cx43 mice is shown in Figure 1The sgRNA targeting sequences were selected from the second coding exon of the Cx43 gene and amplified using the pUC57-sgRNA expression vector (Addgene ID: 51132). The following oligo sequences were used: Target site 1: CCTGTATCTGGGTGCTATTAC, m-Cx43-gRNAUP1: 5’-TAGGGTAATAGCACCCAGATAC-3’ and m-Cx43-gRNA DOWN1: 5’-AAACGTATCTGGGTGCTATTAC-3’; Target site 2: CAAAAGTAGGGAAAGGGGAGG, m-Cx43-gRNAUP2: 5’-TAGGCAAAAGTAGGGAAAGGGG-3’, and m-Cx43-gRNADOWN2: 5’-AAACCCCCTTTCCCTACTTTTG-3’.

[0045] The obtained products were purified by gelatin and used as templates for in vitro transcription, which was carried out using the MEGA short script T7 kit (Life Technology, AM1354). Cas9 mRNA was in vitro transcribed from the linearized pST1374-NLS-flag-linker-Cas9 (Addgene ID: 44758) using the above-mentioned T7 ULTRA kit. Cas9 mRNA, sgRNA, and the Cx43 floxing donor were purified and then mixed and injected into the fertilized eggs of C57BL / 6 mice. The injected embryos were transferred into the oviducts of pseudopregnant females for the generation of chimeric mice. Confirmation was performed by PCR using allele-specific primers (forward primer: CCTTAATACTAAATACATCTTCGGCAAG; reverse primer: CCAATGAGACTCTTACTAGAATTTAAGCTC). The PCR conditions were as follows: 95 °C for 15 minutes; 95 °C for 30 seconds, △ -2 °C for 30 seconds, 72 °C for 3 minutes, 30 cycles; 72 °C for 10 minutes. Then the PCR products were purified for TA cloning and subsequent sequencing.

[0046] The obtained mice were mated, screened, and bred. Tail identification of the obtained mice was performed as follows: Ear tags were numbered and tails were cut at 9 - 14 days after birth. The tail length was approximately 0.2 - 0.5 cm and stored in a -20 °C refrigerator for later use; Tail DNA was extracted using a tail lysis kit; The extracted template DNA was subjected to PCR amplification; The PCR products were subjected to agarose gel electrophoresis, and an agarose gel electrophoresis showed a band of 383 bp ( Figure 2 ), and thus homozygous Cx43 flox / flox mice were obtained.

[0047] Construction of Conditional Knockout of Cx43 in Prefrontal Cortex Astrocytes in Example 2

[0048] Inject 500 nl of pAAV-GfaABC1D-mcherry-T2A-Cre-WPRE virus into the bilateral prefrontal cortices (AP, +2.34 mm; DV, -2 mm; ML, -0.25 mm) of homozygous Cx43 flox / flox mice, and use the injection of pAAV-GfaABC1D-mcherry-3xFLAG-WPRE as a control. The specific operation steps are as follows:

[0049] (1) Anesthetize the mice with a mixture of 95% O 2 / 5% CO 2 mixed gas;

[0050] (2) Fix the anesthetized mice on the stereotaxic apparatus, adjust the position of the ear bars on both sides so that the skull of the mice is on the same horizontal plane; disinfect the skin of the mice with 75% alcohol, cut the skin along the midline of the skull, and use 3% H 2 O 2 to remove the subcutaneous tissue and periosteum to fully expose the skull;

[0051] (3) Locate the bregma and mark it, and read the reading of the bregma using the stereotaxic apparatus. Refer to the mouse brain stereotaxic atlas, drill holes in the skull at a position 2.34 mm in front of the origin and ±0.25 mm on both sides.

[0052] (4) Select a 1 μL microinjector (flat head needle), aspirate 500 nL of the virus solution and fix it on the stereotaxic apparatus, and the injection depth is 2 mm; turn on the microinjection pump and set the injection speed to 50 nL / min.

[0053] (5) After the injection is completed, stop the needle for 10 minutes, and then slowly pull out the needle;

[0054] (6) Suture the wound on the mouse's head, apply an appropriate amount of penicillin, and then put the mouse back into the cage and raise it normally for 4 weeks.

[0055] After 4 weeks of viral expression, the mice were anesthetized and perfused through the heart to obtain the brain. After fixation with 4% paraformaldehyde and dehydration, coronal sections of the prefrontal cortex were obtained using a cryostat. These sections were sequentially immersed in antigen retrieval solution for 15 minutes, 1% Triton X-100 for 10 minutes, and blocked with 5% bovine serum albumin (BSA) for 30 minutes. Subsequently, the sections were incubated overnight at 4°C with the following primary antibodies: anti-GFAP (diluted 1:200, Z0334, Dako) and anti-Cx43 (diluted 1:50, sc-271837, Santa Cruz Biotechnology). The next day, after washing 3 times with PBS containing 1% Tween 20 (PBST), the corresponding secondary antibody (Thermo Fisher Scientific) was added and incubated in the dark for 2 hours. After washing 3 times with PBST, the sections were mounted with DAPI Fluoromount-G (Thermo Fisher Scientific) in the dark. The sections were photographed and analyzed using a confocal microscope. The expression of Cx43 in the prefrontal cortex of the conditional knockout mouse model was significantly reduced ( Figure 3 ), indicating the successful construction of a mouse model with conditional knockout of Cx43 in prefrontal cortex astrocytes.

[0056] Example 3 Behavioral evaluation of the animal model

[0057] The model animals identified by gene knockout were subjected to behavioral evaluation. The tail suspension test, forced swimming test, and sucrose preference test were used to evaluate depressive-like behaviors, and the open field test was used to evaluate anxiety-like behaviors. The specific methods are as follows:

[0058] Tail suspension test: The mice were suspended in a tail suspension box 10 cm above the ground, and the tail was hung on the top of the tail suspension box through a rack. The test was conducted for a total of 6 minutes, and the immobility time of the mice in the last 4 minutes was recorded. Forced swimming test: The mice were placed in a transparent bucket with a diameter of 18 cm and a height of 58 cm, which was filled with water at a temperature of 23 ± 1°C. The test was conducted for a total of 6 minutes, and the immobility time of the mice in the last 4 minutes was recorded. Sucrose preference test: After allowing the mice to freely access 1% sucrose solution and ordinary drinking water for 48 h, they were deprived of water and food for 24 h. After water and food deprivation, the mice were housed individually and freely drank 1% sucrose solution and ordinary drinking water for 12 h. The water bottles were exchanged 6 h after the start of the experiment, and the consumption ratio of sucrose water by the mice was recorded. Open field test: The mice were placed in an open field box of 50×50×40 cm and allowed to freely explore the open field box for 5 min, and the residence time of the mice in the central area of the open field was recorded.

[0059] The results showed that the mice with conditional knockout of astrocytic Cx43 in the tail suspension test ( Figure 4 ) and forced swimming test ( Figure 5)The immobile time was significantly prolonged, and the sucrose intake rate in the sucrose preference test was significantly decreased( Figure 6 ), showing depressive-like behaviors. In the open field test, the residence time of the mice in the central area was significantly shortened( Figure 7 ), showing anxiety-like behaviors.

[0060] Neuroinflammation evaluation of the animal model in Example 4

[0061] The neuroinflammation evaluation of the animal model includes the following methods: GFAP immunofluorescence staining was performed on the prefrontal cortex sections to analyze the morphology of astrocytes; a liquid suspension chip was used to detect the cytokine content in the prefrontal cortex; qPCR was used to detect the gene expression levels of markers related to the activation of astrocytes in the prefrontal cortex. The specific methods are as follows:

[0062] Immunofluorescence staining: After anesthetizing the mice, the brains were perfused through the heart. After fixation with 4% paraformaldehyde and dehydration, coronal sections of the prefrontal cortex were obtained using a cryostat. These sections were successively immersed in antigen retrieval solution for 15 minutes, 1% Triton X-100 for 10 minutes, and blocked with 5% bovine serum albumin (BSA) for 30 minutes. Subsequently, the sections were incubated overnight at 4°C with the following primary antibody: anti-GFAP (diluted 1:200, Z0334, Dako). The next day, after washing 3 times with PBS containing 1% Tween 20 (PBST), the corresponding secondary antibody (Thermo Fisher Scientific) was added and incubated in the dark for 2 hours. After washing 3 times with PBST, the sections were mounted in the dark using DAPI Fluoromount-G (Thermo Fisher Scientific). Photographs were taken using a confocal microscope( Figure 8 ), and the photographed results were analyzed for cell branch complexity and total branch length using ImageJ. The results showed that after conditional knockout of astrocytic Cx43, the astrocyte branch complexity increased( Figure 9 ), and the branch length increased( Figure 10 ), indicating that the cells were in an activated state.

[0063] Liquid suspension chip detection of cytokines: Bio-Plex Pro Mouse Cytokine Grp IPanel23-plex chip was used for detection. The cytokine items detected were GM-CSF, G-CSF, MCP-1 (CCL2), MIP-1α (CCL3), MIP-1β (CCL4), IL-12p40, IL-1α, IL-1β, Eotaxin (CCL11), IL-4, KC, TNF-α, IL-2, IL-3, IL-5, IL-6, IL-9, IL-10, IL-12p70, IL-13, IL-17, IFN-γ, RANTES (CCL5). The specific operation method is as follows:

[0064] After the mice were anesthetized, the brain tissue was removed and placed on ice. After being rinsed with saline, the prefrontal cortex tissue was separated with a surgical blade and lysed with RIPA lysis buffer. The lysate sample was centrifuged at 10,000 rpm for 10 min, the supernatant was taken, and the volume was supplemented to 50 μL with a mixture of Sample Diluent: RIPA = 24:1 and 0.5% BSA before detection. Take the microbeads and oscillate them on an oscillator at 1,400rpm for 30s, and dilute the microbeads with Assay Buffer; oscillate the diluted microbeads again with an oscillator at 1400rpm for 30s, add 50μL to each well of a 96-well plate, and wash three times with a plate washer; take 50μL of the prepared standard, sample, and Blank and add them to a 96-well plate, stick a sealing film, and place it on a flat plate oscillator at 850rpm, incubate at room temperature in the dark for 30min; discard the sample and wash three times with a plate washer; use Antibody Diluent to dilute the Detection Antibody according to the instructions; add 25μL of the diluted Detection Antibody to each well, stick a sealing film, and place it on a flat plate shaker at 850rpm; oscillate, incubate at room temperature in the dark for 30min; discard the detection antibody and wash three times with a plate washer; use Assay Buffer diluted Streptavidin-PE according to the instructions; add 50μL diluted Streptavidin-PE to each well, affix sealing film, place on a flat shaker at 850rpm, incubate at room temperature in the dark for 10min; wash 3 times with a plate washer; add 125μL Assay Buffer to each well to resuspend, affix sealing film, place on a flat shaker at 850rpm, incubate at room temperature in the dark for 2min; send to the calibrated Bio-Plex machine for reading. The results showed that the levels of IL-1β, Eotaxin, GM-CSF, and TNF-α in the prefrontal cortex were significantly increased ( Figure 11 ).

[0065] qPCR detection of the gene expression changes of astrocyte activation markers: Detect the following astrocyte A1, A2, and PAN response markers: C3, H2-T23, Serping1, H2-D1, Ggta1, Iigp1, Gbp2, Fbln5, Ugt1a, Fkbp5, Psmb8, Srgn, Clcf1, Tgm1, Ptx3, S100a10, Sphk1, Cd109, Ptgs2, Emp1, Slc10a6, Tm4sf1, Lcn2, Steap4, S1pr3, Timp1, Hspb1, Cxcl10, Cd44, Osmr, Cp, Serpinga3n, Aspg, Vim. The specific operation method is as follows:

[0066] After anesthetizing the mice, take out the brain tissues and place them on ice. After rinsing with physiological saline, separate the prefrontal cortex tissues with a surgical blade, add 1 ml of TRIZOL, grind and mix well, and lyse for 15 min; add 200 μL of chloroform, shake vigorously for 25 s, and let stand at room temperature for 4 min; centrifuge at 12,000 rpm at 4°C for 10 min, carefully aspirate the supernatant into another clean and enzyme-free 1.5 ml centrifuge tube; add an equal volume of isopropanol and invert 6 - 8 times, let stand at room temperature for 5 min; centrifuge at 12,000 rpm at 4°C for 10 min, discard the supernatant; add 0.75 mL of 75% ethanol (prepared with DEPC water) to wash the precipitate, centrifuge at 12,000 rpm at 4°C for 5 min, discard the ethanol; repeat washing the precipitate once; carefully pour off the supernatant, carefully aspirate the remaining liquid in the centrifuge tube with a pipette, open the tube cap, and dry the precipitate on the ultra-clean bench; dissolve the precipitate with 30 μL of DEPC water. Use an Implen Nanophotometer to measure the RNA concentration and the A260 / A280 ratio.

[0067] Reverse transcription to synthesize cDNA: Take 1 μg of total RNA and synthesize cDNA according to the instructions. Specific steps: First, add 1 μL of Oligo(dT) to the total RNA, make up to 8 μL with water, mix well, incubate the mixture at 65°C for 5 min, and then quickly cool on ice for 2 min. Then, sequentially add 10 μL of 2×Ts Reaction Mix, 1 μL of RT / RI Enzyme Mix, and 1 μL of gDNARemover, incubate at 42°C for 15 min, and finally inactivate the reverse transcriptase by heating at 85°C for 5 s to terminate the reaction. The reaction solution is used as the PCR template.

[0068] Fluorescence quantitative PCR: Prepare the reaction system according to the instructions, and perform PCR amplification and detection on the machine. The total reaction system is 20 μL, including 10 μL of Super Mix 2×, 0.4 μL each of the upstream and downstream primers (10 μM), 2 μL of cDNA template, and make up to 20 μL with water. The reaction conditions are as follows: pre-denaturation at 94°C for 30 s; within the cycle, denaturation at 94°C for 5 s, annealing at 60°C for 30 s, for a total of 40 cycles, and collect fluorescence signals at the end of each cycle extension to draw the amplification curve. After 40 cycles, set the reaction steps (95°C for 15 s, 60°C for 1 min, 95°C for 15 s), and collect fluorescence signals throughout the heating process from 60°C to 94°C to draw the melting curve. The results show that the expression levels of the marker genes of the A1, A2, and PAN reactions in the prefrontal cortex are significantly up-regulated ( Figure 12 ).

[0069] Example 4 Evaluation of the antidepressant effect of the animal model

[0070] The evaluation method for the antidepressant treatment of the animal model is as follows: Intraperitoneally inject 10 mg / kg of escitalopram (prepared with normal saline) into the mice, and intraperitoneally inject the same volume of normal saline solution into the control mice. Evaluate the therapeutic effect of the drug by the tail suspension test at 1, 3, 6, and 12 h after injection. The method of the tail suspension test is as follows: Hang the mice in a tail suspension box 10 cm above the ground, and hang the tail on the top of the tail suspension box through a rack. Test for a total of 6 minutes, and record the immobile time of the mice in the last 4 minutes. The results show that escitalopram can significantly shorten the immobile time of the control mice in the tail suspension test at 1 and 3 h after administration ( Figure 13 ), but cannot improve the immobile time of the model mice in the tail suspension test ( Figure 14 ), indicating that the antidepressant drug fails to treat this model.

[0071] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or modify some or all of the technical features, improve or equivalently replace them; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for constructing an animal model of drug-resistant depression: After constructing Cx43 flox / flox mice, a viral vector is stereotactically injected into the prefrontal cortex, and behavioral evaluation, inflammatory response evaluation, and evaluation of the antidepressant treatment effect are carried out.

2. The construction method of claim 1, characterized in that, the Construction of Cx43 flox / flox The construction method for mice is the CRISPR / Cas9 technique.

3. The construction method of claim 2, the CRISPR / Cas9 technology, characterized by: Select the targeting sequence of sgRNA from the second exon of Cx43; the oligo sequences used: targeting site 1: CCTGTATCTGGGTGCTATTAC, m-Cx43-gRNA UP1: 5’-TAGGGTAATAGCACCCAGATAC-3’ and m-Cx43-gRNA DOWN1: 5’-AAACGTATCTGGGTGCTATTAC-3’; targeting site 2: CAAAAGTAGGGAAAGGGGAGG, m-Cx43-gRNA UP2: 5’-TAGGCAAAAGTAGGGAAAGGGG-3’, and m-Cx43-gRNADOWN2: 5’-AAACCCCCTTTCCCTACTTTTG-3’.

4. The construction method of claim 1, characterized in that, the stereotaxic injection viral vector in the prefrontal cortex is pAAV- GfaABC1D-mcherry-T2A-Cre-WPRE, the serotype is 2 / 9, and the injection volume is 0.5 μL for each side bilaterally.

5. The construction method of an animal model of drug-resistant depression of claim 1, characterized in that, the behavioral evaluation method is: using the tail suspension test, forced swimming test, sucrose preference test and open field test for evaluation.

6. The construction method of claim 1, characterized in that, the inflammatory response evaluation method is: using astrocyte morphology detection, cytokine content detection, and astrocyte activation gene marker detection for evaluation.

7. The construction method of claim 6, characterized in that, for the astrocyte morphology detection, the method used is immunofluorescence staining.

8. The construction method of claim 6, characterized in that, for the cytokine content detection, the types of cytokines detected are GM-CSF, G-CSF, MCP-1(CCL2), MIP-1α(CCL3), MIP-1β(CCL4), IL-12p40, IL- 1α, IL-1β, Eotaxin(CCL11), IL-4, KC, TNF-α, IL-2, IL-3, IL-5, IL-6, IL-9, IL- 10, IL-12p70, IL-13, IL-17, IFN-γ, RANTES(CCL5).

9. The construction method of claim 6, characterized in that, For the detection of the astrocyte activation gene markers, the detected gene markers are C3, H2-T23, Serping1, H2-D1, Ggta1, Iigp1, Gbp2, Fbln5, Ugt1a, Fkbp5, Psmb8, Srgn, Clcf1, Tgm1, Ptx3, S100a10, Sphk1, Cd109, Ptgs2, Emp1, Slc10a6, Tm4sf1, Lcn2, Steap4, S1pr3, Timp1, Hspb1, Cxcl10, Cd44, Osmr, Cp, Serpinga3n, Aspg, Vim.

10. The construction method according to claim 1, characterized in that the method for evaluating the antidepressant treatment effect is: after intraperitoneal injection of 10 mg / kg of escitalopram at 1, 3, 6, and 12 hours, the tail suspension test is used to evaluate the drug treatment effect.

11. Use of the construction method of a drug-resistant depression animal model according to claim 1 in the evaluation of antidepressant drugs.

12. Use of the construction method of a drug-resistant depression animal model according to claim 1 in the study of the pathogenesis of depression.

Images