Product and method for detecting CD71 biallele editing cell by using CRISPR / Cas12a system

Abstract

The invention discloses a product and a method for detecting a CD71 biallele editing cell by using a CRISPR / Cas12a system, and belongs to the technical field of biology. The technical problem to be solved by the invention is how to detect the CD71 gene biallele editing cell. The product for detecting the CD71 diallele editing cell disclosed by the invention comprises crRNA (Ribonucleic Acid) of which the target sequence is SEQ ID NO.5, LbCas12a protein, an LbCas12a protein enzyme digestion buffer solution, a DNA (Deoxyribose Nucleic Acid) probe 1 (6-FAM-TTATT-BHQ1) or a DNA probe 2 (6-FAM-TTTTTATTTTT-C6 Biotin), and a primer pair as shown in SEQ ID NO.1 and SEQ ID NO.2. The invention also discloses a kit for detecting the CD71 diallele editing cell. The product provided by the invention can be used for screening CD71 gene diallele editing cells generated by CRISPR / Cas9 induction.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to products and methods for detecting CD71 biallelically edited cells using the CRISPR / Cas12a system. Background Art

[0002] The CRISPR / Cas9 system is a powerful gene editing tool. Its principle is based on the ability of the Cas9 endonuclease to recognize and cleave specific DNA sequences under the guidance of gRNA. When performing gene editing on cells, by designing gRNA targeting a specific gene, the Cas9 enzyme can precisely cleave at the target gene locus. This process can lead to DNA double-strand breaks, thereby triggering the cell's DNA repair mechanisms, including non-homologous end joining and homologous recombination repair. During this process, mutations such as insertions, deletions, or substitutions may occur, thus achieving the purpose of gene editing. When editing operations are simultaneously performed on the two alleles of a specific gene, biallelically edited cells can be generated. Such biallelically edited cells have important research value in the fields of gene function research, disease model construction, and gene therapy.

[0003] The CD71 gene, also known as transferrin receptor 1 (TfR1), is a type II transmembrane glycoprotein that binds to transferrin (Tf). It plays a key role in the process of cellular iron uptake. It can specifically bind to the transferrin-iron complex and transport iron ions into the cell through receptor-mediated endocytosis to meet the iron requirements of cell growth, proliferation, and various metabolic processes. In addition to the above functions, CD71 also shows potential as a drug delivery carrier. Research has shown that transferrin, as a natural targeting carrier, can bind to specific drugs or substances to form stable complexes. These complexes are then mediated by the CD71 receptor on the cell surface, thereby achieving precise transport into the cell. In addition, the CD71 gene is highly expressed during erythropoiesis and plays an indispensable role in the development and maturation of red blood cells. At the same time, in some tumor cells, the CD71 gene is also highly expressed and is closely related to the proliferation, invasion, and metastasis of tumor cells. There is also research indicating that CD71 can serve as an entry receptor for viruses and participate in the early invasion process of various viruses into host cells. Given the numerous biological functions of CD71, obtaining CD71 gene biallelically edited cells is of great significance for studying the functions of the CD71 gene.

[0004] However, the efficient and accurate detection of biallelically edited cells has always been a challenge. Although traditional gene sequencing technologies can accurately detect changes in gene sequences, the operation process is relatively cumbersome and time-consuming, making it difficult to achieve rapid and high-throughput detection. The CRISPR / Cas12a system is an RNA-guided DNA endonuclease technology. Its core lies in the formation of a complex between the Cas12a protein and a specifically designed CRISPR RNA (crRNA). This complex can precisely recognize and target DNA regions containing specific PAM sequences, cut downstream of the PAM sequence, and generate DNA double-strand breaks. At the same time, the CRISPR / Cas12a detection system is relatively simple and can obtain detection results in a relatively short time, promising to provide an efficient and convenient detection method for biallelically edited cells. Summary of the Invention

[0005] The technical problem to be solved by the present invention is how to detect biallelically edited cells of the CD71 gene.

[0006] To solve the above technical problem, the present invention first provides a product for detecting biallelically edited cells of CD71 using the CRISPR / Cas12a system, containing crRNA, and the target sequence of the crRNA is SEQ ID NO.5.

[0007] In the above product, the crRNA can be a single-stranded RNA shown in SEQ ID NO.8.

[0008] In an embodiment of the present invention, the crRNA is transcribed from a double-stranded DNA composed of SEQ ID NO.6 and SEQ ID NO.7.

[0009] The above product may also contain DNA probe 1 or DNA probe 2. DNA probe 1 is a single-stranded DNA labeled with a fluorescent group (such as a 6-FAM group) and a quenching group (such as a BHQ1 group) at both ends; DNA probe 2 is a single-stranded DNA labeled with a Biotin group and a 6-FAM group at both ends, and its sequence is as shown in SEQ ID NO.9.

[0010] Specifically, DNA probe 1 can be: 6-FAM-TTATT-BHQ1.

[0011] DNA probe 2 can be: 6-FAM-TTTTTTTATTTTTTT-C6Biotin.

[0012] The above-mentioned product may also contain LbCas12a protein and LbCas12a protease cleavage buffer (such as 10×LbCas12a Cleavage Buffer (product of Guangzhou Aidy Gene Technology Co., Ltd., catalog number EDE0005-B)).

[0013] The LbCas12a protein may be a product of Guangzhou Aidy Gene Technology Co., Ltd., catalog number EDE0005.

[0014] The LbCas12a protease cleavage buffer may be 10×LbCas12a Cleavage Buffer (product of Guangzhou Aidy Gene Technology Co., Ltd., catalog number EDE0005-B).

[0015] The above-mentioned product may also contain a primer pair, which consists of two single-stranded DNAs shown by SEQ ID NO.1 and SEQ ID NO.2.

[0016] The above-mentioned product may be composed of the crRNA and the LbCas12a protein, or may be composed of the crRNA, the LbCas12a protein and the LbCas12a protease cleavage buffer, or may be composed of the crRNA, the LbCas12a protein and DNA probe 1, or may be composed of the crRNA, the LbCas12a protein and DNA probe 2, or may be composed of the crRNA, the LbCas12a protein, DNA probe 1 and the LbCas12a protease cleavage buffer, or may be composed of the crRNA, the LbCas12a protein, DNA probe 2 and the LbCas12a protease cleavage buffer, or may be composed of the crRNA, the LbCas12a protein and the primer pair, or may be composed of the crRNA, the LbCas12a protein, the LbCas12a protease cleavage buffer and the primer pair, or may be composed of the crRNA, the LbCas12a protein, DNA probe 1 and the primer pair, or may be composed of the crRNA, the LbCas12a protein, DNA probe 2 and the primer pair, or may be composed of the crRNA, the LbCas12a protein, DNA probe 1, the LbCas12a protease cleavage buffer and the primer pair, or may be composed of the crRNA, the LbCas12a protein, DNA probe 2, the LbCas12a protease cleavage buffer and the primer pair.

[0017] The product may be a kit.

[0018] The present invention also provides a method for detecting CD71 biallelically edited cells using the CRISPR / Cas12a system for non-diagnostic purposes, the method comprising: performing PCR amplification on the genomic DNA of a test cell and a wild-type cell respectively using the primer pair to obtain PCR products of the test cell and the wild-type cell; reacting the PCR products, the crRNA, the DNA probe 1, and the LbCas12a protein in an LbCas12a protease cleavage buffer to obtain an LbCas12a product; comparing the fluorescence signals of the LbCas12a products of the test cell and the wild-type cell, wherein the test cell with a fluorescence signal of the LbCas12a product significantly lower than that of the wild-type cell is or is a candidate for a CD71 biallelically edited cell, and the test cell with a fluorescence signal of the LbCas12a product not significantly different from that of the wild-type cell is not or is not a candidate for a CD71 biallelically edited cell.

[0019] The present invention also provides a method for detecting CD71 biallelically edited cells using the CRISPR / Cas12a system for non-diagnostic purposes, the method comprising: performing PCR amplification on the genomic DNA of a test cell using the primer pair to obtain a PCR product of the test cell; reacting the PCR product, the crRNA, the DNA probe 2, and the LbCas12a protein in an LbCas12a protease cleavage buffer to obtain an LbCas12a product; detecting the LbCas12a product using a Cas12-specific nucleic acid colloidal gold test strip, wherein the test cell with no color development at the T line (test line) is or is a candidate for a CD71 biallelically edited cell, and the test cell with color development at the T line (test line) is not or is not a candidate for a CD71 biallelically edited cell.

[0020] In one embodiment of the present invention, the Cas12-specific nucleic acid colloidal gold test strip is from Guangzhou Aidy Gene Technology Co., Ltd., product number JY0301.

[0021] In the present invention, the CD71 biallelically edited cell may be a cell with biallelic editing of the third exon of CD71. The CD71 biallelically edited cell may be a cell with biallelic editing of the DNA fragment shown in SEQ ID NO.3.

[0022] Specifically, the CD71 biallelically edited cell detected in the present invention may be a cell edited using the CRISPR / Cas9 system with the target sequence of SEQ ID NO.4 as the sgRNA.

[0023] Wherein, the biallelic editing is a cell in which both alleles of CD71 in the cell are edited.

[0024] The present invention develops a product and corresponding method for screening CRISPR / Cas9-induced CD71 gene biallelically edited cells based on the CRISPR / Cas12a method. The present invention has strong specificity, a simple and efficient operation process, and is cost-effective, suitable for large-scale batch processing. By implementing the present invention, cells carrying specific biallelic editing can be efficiently screened in a short time, providing solid technical support for accelerating gene function analysis and promoting the innovation of gene editing technology.

[0025] The following further describes the present invention in detail in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is the electrophoresis result after PCR amplification of wild-type porcine ileal epithelial cells in Example 1. Note: M, GsDL1002 DNA Marker with a size of 1000 bp; WT-1 to WT-5, DNA samples after PCR amplification of wild-type porcine ileal epithelial cells.

[0027] Figure 2 It is the sequencing result of the porcine CD71 gene standard plasmid in Example 1. Note: The CD71 standard plasmid sequence is the sequencing result of pClone-EZ-TOPO-WT containing the target sequence fragment, and the selected region is the target sequence of the sgRNA.

[0028] Figure 3 It is the detection result of the fluorescence intensity of crRNA targeting the wild-type sequence of the porcine CD71 gene in Example 1. Data marked with different lowercase letters are significantly different ( P <0.05), and data marked with the same lowercase letters are not significantly different ( P >0.05).

[0029] Figure 4 It is the detection result of the crRNA colloidal gold test strip targeting the wild-type sequence of the porcine CD71 gene in Example 1.

[0030] Figure 5 It is the TA cloning sequencing result of 2 monoclonal cells in Example 2. A: The sequencing result of the 2-1# monoclonal cell; B: The sequencing result of the 2-3# monoclonal cell.

[0031] Figure 6Results of detecting 2 monoclonal cell lines using the fluorescence reporter system for crRNA-F1, crRNA-F2, crRNA-F4, and crRNA-F5 in Example 2. A: Detection results of the crRNA-F1 system; B: Detection results of the crRNA-F2 system; C: Detection results of the crRNA-F4 system; D: Detection results of the crRNA-F5 system. In the same figure, data labeled with different lowercase letters are significantly different ( P <0.05), and data labeled with the same lowercase letter are not significantly different ( P >0.05).

[0032] Figure 7 Results of detecting monoclonal cell lines using the fluorescence reporter system for crRNA-F5 in Example 3. Data labeled with different lowercase letters are significantly different ( P <0.05), and data labeled with the same lowercase letter are not significantly different ( P >0.05).

[0033] Figure 8 Results of detecting monoclonal cell lines using the colloidal gold test strip system for crRNA-F5 in Example 3.

[0034] Figure 9 TA cloning results of the 2-6# CD71 gene biallelically edited cells screened in Example 3. Detailed implementation method

[0035] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0036] The following examples use GraphPad Prism 9.0 statistical software to process the data. The experimental results are expressed as mean ± standard error and are tested by One-way ANOVA.

[0037] CloneSmarter TOPO Cloning Vector Kit: Product of Zhongmei Taihe Biotechnology (Beijing) Co., Ltd., catalog number C5865-50; LbCas12a protein: Product of Guangzhou Addgene Technology Co., Ltd., catalog number EDE0005; 10×LbCas12a Cleavage Buffer: Product of Guangzhou Addgene Technology Co., Ltd., catalog number EDE0005-B; Cas12 Specific Nucleic Acid Colloidal Gold Test Strip: Guangzhou Aidi Gene Technology Co., Ltd., product number JY0301.

[0038] Example 1. Establishment of PCR-CRISPR / Cas12a Nucleic Acid Detection System 1. Construction of Standard Plasmid Amplification primers were designed for the partial sequence of the third exon of the porcine CD71 gene (GenBank: NC_010455.5), and the primers are as follows: CD71-F: 5′-TGAGGATTCAAGGTAGGCT-3′ (SEQ ID NO.1); CD71-R: 5′-CTGATGCCCTTGTGGATAG-3′ (SEQ ID NO.2).

[0039] Extract the genomic DNA of wild-type (WT) porcine ileal epithelial cells (Xu Changjiang, Wang Xiaopeng, Xu Kui, Zhang Xiuling, Xiang Guangming, Zhao Haiquan, Mou Yulian, Lin Xiao, Li Kui. Construction of pAPN gene knockout IPI-2I cell line using CRISPR / Cas9 editing system. China Animal Husbandry & Veterinary Medicine, 2021, 48(7): 2282-2290.). Amplify by PCR using CD71-F and CD71-R. The length of the amplified product is 591 bp, and its sequence is: TGAGGATTCAAGGTAGGCTTCTGGGAAGAAAAGGTACCTTTGCTTTGAAAAGGTAATCGTTTAAAATAAAGTTATAATGGATTCAGTGGTTTAAAATCAACCAAGTGAGATACATTTTTTCAAATAGACTTACAACTGGATTAAAATCAGTATTTTCAAGGGTTACCTGAAAATATTAACAATTCTTATAGGAATAGATTATCAATGAAATTCTATGAGGTCAGCTCTGAAATTTTTTATCCTTAGGATTTATGATTGGCTACTTGGCCTATTGTAAACGTGTAGAATCAAAAACAGATTGTAAGACACTGGTACCAACAGAGCCTTCAGAGACAGAAGAGACAGAAACTTTCGAAGCAGAAAACTTCCCTCAAACACCTCGCTTATTTTGGGCAGACCTCAAAATACTGTTGTCAAAGGGATTGGATACCACAGACTTCACCCGCACCATCAAGTAAGCTTGCGCTACTTCACAAGTTCAACCTCAATGCCTAGCGTGTTGCTTGTTGTCAGATTTTCTTCTGCTCTGGTTTTACGTCTTAACTCCTTGTAAGTCAAGCTGAGCCCTGGTACTATCCACAAGGGCATCAG (SEQ ID NO.3).

[0040] After the PCR reaction, perform agarose gel electrophoresis. The result after electrophoresis shows that the target fragment is obtained, as Figure 1 shown. Then purify the PCR product by gel extraction. Connect the product after gel extraction and purification to the pClone-EZ-TOPO vector (Sino-US Taihe Biotechnology (Beijing) Co., Ltd., C5865-50) through TA cloning. After verification by sequencing, the recombinant plasmid with the correct sequence obtained is the porcine CD71 gene standard plasmid pClone-EZ-TOPO-WT. Part of the results of plasmid sequencing are asFigure 2 as shown

[0041] 2. crRNA Target Design According to the DNA sequence within 40 bp upstream and downstream of the sgRNA (AGGTCTGCCCAAAATAAGCG (SEQ ID NO.4)) of the third exon of the porcine CD71 gene, search for the PAM sequence marked by TTN or TTTN, and extend 20 bp - 25 bp downstream of the PAM sequence as the candidate target sites recognized by the CRISPR / Cas12a system. Then, design 6 candidate target sites according to rules such as sequence GC content and sequence complementarity, and name them crRNA-T1 to crRNA-T6 respectively. The sequences of the candidate target sites are shown in Table 1.

[0042] Table 1 Sequences of Candidate Target Sites

[0043] 3. Preparation of Specific crRNA In Vitro Transcription Templates According to the sequences of the candidate target sites, add the T7 promoter sequence (TAATACGACTCACTATAGGG) and the crRNA repeat region template sequence (TAATTTCTACTAAGTGTAGAT) respectively to form the positive-strand DNA crRNA-T7-F1 to crRNA-T7-F6 of the specific crRNA in vitro transcription templates. Obtain their complementary negative-strand DNA crRNA-T7-R1 to crRNA-T7-R6 according to the positive-strand DNA. As shown in Table 2, the bold part is the T7 promoter sequence, and the boxed part is the crRNA repeat region template.

[0044] Table 2 Positive and Negative Strand DNA Sequences of Specific crRNA In Vitro Transcription Templates

[0045] Synthesize each single-stranded DNA in Table 2 respectively, and prepare the specific crRNA in vitro transcription templates by annealing. Obtain the specific crRNA in vitro transcription templates crRNA-T7-1, crRNA-T7-2, crRNA-T7-3, crRNA-T7-4, crRNA-T7-5, and crRNA-T7-6 with crRNA-T7-F1 and crRNA-T7-R1, crRNA-T7-F2 and crRNA-T7-R2, crRNA-T7-F3 and crRNA-T7-R3, crRNA-T7-F4 and crRNA-T7-R4, crRNA-T7-F5 and crRNA-T7-R5, crRNA-T7-F6 and crRNA-T7-R6 respectively.

[0046] 4. In vitro transcription of specific crRNA Using the T7 in vitro transcription kit (Invitrogen, AM1354), prepare the in vitro transcription system for specific crRNA as shown in Table 3.

[0047] Table 3 In vitro transcription system for specific crRNA

[0048] Incubate the transcription system overnight in a 37°C incubator. Recover the crRNA using the RNA purification and recovery kit (Invitrogen, 12183018A). The crRNAs obtained from the in vitro transcription templates crRNA-T7-1, crRNA-T7-2, crRNA-T7-3, crRNA-T7-4, crRNA-T7-5, and crRNA-T7-6 of specific crRNA are crRNA-F1, crRNA-F2, crRNA-F3, crRNA-F4, crRNA-F5, and crRNA-F6, respectively, and the sequences are shown in Table 4.

[0049] Table 4 crRNA sequences

[0050] 5. Establishment of the PCR-CRISPR / Cas12a nucleic acid detection system (1)CRISPR / Cas12a fluorescence detection The CRISPR / Cas12a fluorescence detection system is shown in Table 5.

[0051] Table 5 CRISPR / Cas12a fluorescence detection system

[0052] Among them, the DNA probe is a single-stranded DNA probe double-labeled with 6-FAM group and BHQ1 group, which is 6-FAM-TTATT-BHQ1.

[0053] The PCR product is obtained by PCR amplification using the standard plasmid pClone-EZ-TOPO-WT as the DNA template and the CD71-F and CD71-R primers.

[0054] Prepare the detection systems for crRNA-F1, crRNA-F2, crRNA-F3, crRNA-F4, crRNA-F5, and crRNA-F6 according to the above system. Set up four technical replicates for each detection system, and use the system without crRNA as the negative control (NC).

[0055] The prepared detection system was reacted in a fluorescence quantitative PCR instrument (Thermo Scientific, QuantStudio™ 5), with the reaction temperature set at 37°C and the program set to detect the fluorescence intensity every 30 seconds for a total of 120 times.

[0056] The results are as Figure 3 shown. Compared with NC, the fluorescence intensities of the crRNA-F1, crRNA-F2, crRNA-F3, crRNA-F4, and crRNA-F5 groups were all significantly increased ( P < 0.05), indicating that they all had a targeted cleavage effect on the wild-type sequence of the CD71 gene; crRNA-F6 only produced a low fluorescence signal and had no significant difference from NC ( P > 0.05), indicating that it had no targeted cleavage effect on the wild-type sequence of the CD71 gene. In comparison, the fluorescence intensity of crRNA-F3 was significantly lower than ( P < 0.05) that of crRNA-F1, crRNA-F2, crRNA-F4, and crRNA-F5.

[0057] (2) CRISPR / Cas12a colloidal gold test strip detection The CRISPR / Cas12a colloidal gold test strip detection system is shown in Table 6.

[0058] Table 6 CRISPR / Cas12a colloidal gold test strip detection system

[0059] Among them, the colloidal gold probe is a single-stranded colloidal gold probe double-labeled with Biotin group and 6-FAM group, which is 6-FAM-TTTTTTTATTTTTTT (SEQ ID NO.9)-C6Biotin.

[0060] The PCR product was obtained by PCR amplification using the standard plasmid pClone-EZ-TOPO-WT as the DNA template and the CD71-F and CD71-R primers.

[0061] The crRNA-F1, crRNA-F2, crRNA-F3, crRNA-F4, crRNA-F5, and crRNA-F6 detection systems (denoted as WT in the figure) were prepared according to the above system. Four technical replicates were set up for each detection system, and the system without crRNA was used as the negative control (NC).

[0062] The prepared detection system was placed in a PCR instrument (BIO-RAD, C1000 Touch TMReact at 37 °C for 30 min to obtain the reaction product. Then insert the binding pad end of the test strip into the reaction product in the reaction tube, and read the test result after the entire judgment area is wetted.

[0063] The results are as Figure 4 shown. Compared with NC, crRNA-F1, crRNA-F2, crRNA-F3, crRNA-F4, and crRNA-F5 can all specifically recognize the wild-type sequence of the CD71 gene, that is, the T line of the test strip shows color, presenting a positive result; while crRNA-F6 cannot specifically recognize the wild-type sequence of the CD71 gene, and only the C line of the test strip shows color, presenting a negative result. NC only has the C line showing color, presenting a negative result.

[0064] Based on the above fluorescence intensity detection results and test strip detection results, the crRNA-F1, crRNA-F2, crRNA-F4, and crRNA-F5 systems are selected for subsequent detection.

[0065] Example 2. Detection and analysis of monoclonal cell samples of the CRISPR / Cas12a nucleic acid detection system for CD71 gene biallelic editing cells Use the PCR-CRISPR / Cas12a detection system constructed by the present invention to screen for cells with CD71 gene biallelic editing in monoclonal cell samples.

[0066] Preparation of 2 monoclonal cell lines: The monoclonal cells are gene-edited cells obtained by CRISPR / Cas9 gene editing of porcine ileal epithelial cells (IPI-2I), and the target of sgRNA is AGGTCTGCCCAAAATAAGCG (SEQ ID NO.4). Sequence the obtained monoclonal cells to obtain the cell genotypes.

[0067] Using the lysates of the obtained 2 monoclonal cell lines (2-1# and 2-3#) as templates, perform PCR amplification with CD71-F and CD71-R primers. After TA cloning the obtained PCR products, ligate them to the pClone-EZ-TOPO vector. Through sequencing, the results are shown in Figure 5 , where 2-1# is a wild-type cell and 2-3# is a CD71 gene biallelic editing cell.

[0068] According to the "CRISPR / Cas12a fluorescence detection" method in step 5 of Example 1, use four different nucleic acid detection systems of crRNA-F1, crRNA-F2, crRNA-F4, and crRNA-F5 to detect the fluorescence intensity of the PCR products of the above 2 monoclonal cell lines with known genotypes.

[0069] The experimental results are asFigure 6 As shown in the figure, by analyzing the fluorescence signal intensities of four crRNA nucleic acid detection systems, the results showed that there were no significant differences in the fluorescence intensities of the crRNA-F1, crRNA-F2, and crRNA-F4 groups in the CD71 gene biallelic editing cells (2-3#) compared with the wild-type cells (2-1#) ( P >0.05), indicating that these detection systems could not effectively distinguish wild-type cells from biallelic editing cells. In contrast, when the crRNA-F5 detection system detected the 2-3# monoclonal cells, its fluorescence signal intensity was significantly lower than that of 2-1# ( P <0.05), which indicated that this detection system had a high specificity for the target DNA sequence, could identify biallelic editing cells, and produce specific low fluorescence signals. Therefore, crRNA-F5 was selected for subsequent detection in this study.

[0070] Example 3 Application of the crRNA-F5 Nucleic Acid Detection System in the Detection and Analysis of Monoclonal Cell Samples Cas9 / sgRNA Editing of the CD71 Gene: Using porcine ileal epithelial cells (IPI-2I) as materials, the CD71 gene was genetically edited by the CRISPR / Cas9 technology to obtain monoclonal cells. The target site of the sgRNA was AGGTCTGCCCAAAATAAGCG (SEQ ID NO.4).

[0071] Using the lysate of the obtained monoclonal cell sample as a template, PCR amplification was performed using the CD71-F and CD71-R primers. According to the "CRISPR / Cas12a Fluorescence Detection System" in step 5 of Example 1, the PCR products of each monoclonal cell were detected for fluorescence signals by crRNA-F5.

[0072] The results were as Figure 7 shown. Compared with other monoclonal cells, the fluorescence intensity of 2-6# was significantly reduced ( P <0.05); and compared with NC, there was no significant difference in the fluorescence intensity of 2-6# ( P >0.05), indicating that 2-6# was a CD71 gene biallelic editing cell sample.

[0073] Using the PCR products of the above monoclonal cell samples as the detection template, according to the "CRISPR / Cas12a Colloidal Gold Test Strip Detection" method in step 5 of Example 1, the crRNA-F5 nucleic acid detection system was used for colloidal gold test strip detection and analysis.

[0074] The results were as Figure 8As shown, crRNA-F5 can specifically recognize the sample containing the wild-type sequence of the CD71 gene, making the T line of the test strip show color, presenting a positive result; while for the CD71 gene biallelic editing sample and the control group without crRNA, only the C line shows color, presenting a negative result. The colloidal gold test strip detection results indicate that 2-6# are CD71 gene biallelic editing cells.

[0075] In summary, both the fluorescence intensity detection results and the colloidal gold test strip detection results show that the 2-6# monoclonal cells are biallelic editing cells.

[0076] To verify whether the method for rapidly detecting CRISPR / Cas9-induced biallelic editing cells proposed by the present invention is accurate, the PCR product of the 2-6# monoclonal cells was subjected to TA cloning, and then ligated to the pClone-EZ-TOPO vector for sequencing.

[0077] The sequencing results are as Figure 9 shown. The selected 2-6# cells are cells with biallelic editing of the CD71 gene at the Cas9 / sgRNA target site. This result is completely consistent with the screening result obtained by the crRNA-F5 nucleic acid detection system. This sequencing result proves the accuracy, reliability and practicability of crRNA-F5 in specifically screening CD71 gene biallelic editing samples.

[0078] The above has described the present invention in detail. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although the present invention gives specific embodiments, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by using conventional techniques known in the art that are outside the scope disclosed in this application. Some basic features can be applied according to the scope of the following appended claims.

Claims

1. A product for detecting CD71 biallelic edited cells using the CRISPR / Cas12a system, comprising crRNA, the target sequence of which is SEQ ID NO.

5.

2. The product according to claim 1, characterized in that: The crRNA is a single-stranded RNA shown in SEQ ID NO.

8.

3. The product according to claim 1 or 2, characterized in that: The product further contains DNA probe 1 or DNA probe 2, wherein the DNA probe 1 is a single-stranded DNA with a fluorescent group and a quenching group labeled at both ends, respectively, and the sequence of the DNA probe 1 is TTATT; The DNA probe 2 is a single-stranded DNA with a Biotin group and a 6-FAM group labeled at both ends, respectively, and its sequence is shown in SEQ ID NO.

9.

4. The product according to any one of claims 1 to 3, characterized in that: The product also contains LbCas12a protein and LbCas12a protease cleavage buffer.

5. The product according to any one of claims 1 to 4, characterized in that: The product also contains a primer pair, which consists of two single-stranded DNAs shown in SEQ ID NO.1 and SEQ ID NO.

2.

6. The product according to any one of claims 1 to 5, characterized in that: The CD71 biallelic gene-edited cells are cells with biallelic gene-edited CD71 exon 3.

7. A method for detecting CD71 biallelic edited cells using the CRISPR / Cas12a system, comprising: Using the primers described in claim 5, PCR amplification is performed on the genomic DNA of the test cell and the wild-type cell to obtain PCR products of the test cell and the wild-type cell; The PCR product, the crRNA described in claim 1 or 2, the DNA probe 1 described in claim 3, and the LbCas12a protein described in claim 4 are reacted in an LbCas12a protease cleavage buffer to obtain an LbCas12a product; the fluorescence signals of the LbCas12a products of the cells to be tested and the wild-type cells are compared, and the cells to be tested whose fluorescence signals of the LbCas12a products are lower than those of the wild-type cells are or are candidates for CD71 biallelic edited cells, and the cells to be tested whose fluorescence signals of the LbCas12a products are no different from those of the wild-type cells are not or are not candidates for CD71 biallelic edited cells.

8. The method according to claim 7, characterized in that: The CD71 biallelic gene-edited cells are cells with biallelic gene-edited CD71 exon 3.

9. A method for detecting CD71 biallelic edited cells using the CRISPR / Cas12a system, comprising: Using the primers described in claim 5 to perform PCR amplification on the genomic DNA of the cells to be tested to obtain PCR products of the cells to be tested; The PCR product, the crRNA described in claim 1 or 2, the DNA probe 2 described in claim 3, and the LbCas12a protein described in claim 4 are reacted in an LbCas12a protease cleavage buffer to obtain an LbCas12a product; the LbCas12a product is detected using a Cas12-specific nucleic acid colloidal gold detection test strip, and the cells to be tested whose T line is not colored are or are candidates for CD71 biallelic edited cells, and the cells to be tested whose T line is colored are not or are not candidates for CD71 biallelic edited cells.

10. The method according to claim 9, characterized in that: The CD71 biallelic gene-edited cells are cells with biallelic gene-edited CD71 exon 3.

Images