D-psicose-3-epimerase mutant and application thereof in synthesis of psicose
By performing multi-site mutation of D-psicose-3-episomerase and co-expression with glucose isomerase, the problems of low catalytic activity and poor thermal stability of existing enzymes are solved, and the production efficiency of D-psicose and the stability of enzymes are significantly improved.
Patent Information
- Application Number
- CN202510584901.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-08
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-05-08
AI Technical Summary
The existing D-psicose-3-episomerase has low catalytic activity on D-fructose and poor thermal stability, which limits its application in industrial production.
By performing multi-site mutations at positions 59, 106 and 188 of wild-type D-psicose-3-episomerase, mutants were obtained and co-expressed with glucose isomerase, thereby improving the catalytic efficiency and stability of the enzyme.
The production efficiency of D-psicose was significantly improved, and the conversion rate of 500 g/L fructose or glucose was catalyzed to 36.5% and 30.5% respectively, and the immobilized enzyme can be reused for 10 batches, and the vitality remains above 80%.
Smart Images

Figure CN120098983A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and in particular to a D-psicose-3-epimerase mutant and application thereof in synthesizing psicose. Background Art
[0002] D-psicose is a rare naturally occurring ketose with a chemical formula of C 6 H 12 O 6 , which belongs to the C3 diastereomer of D-fructose. Due to its diverse physiological properties, it has become a potential functional ingredient in the pharmaceutical, health care and food industries. D-psicose has high sweetness and low energy, and is considered to be an ideal sweetener and an effective substitute for sucrose. It has 70% of the sweetness of sucrose, but contains only about 0.2 kcal / g of calories. In addition, D-psicose can increase the water holding capacity of food through the Maillard reaction, improve its gelling properties, and produce good flavor during food processing. Therefore, D-psicose has potential commercial uses as a low-calorie sweetener in beverages, baked goods, ice cream and other typical high-calorie products. D-allulose is a new functional factor that is safe, stable and low in calories. In addition to its important application value in food, it also has a variety of unique nutritional and physiological functions: (1) It inhibits blood sugar and can be used as an auxiliary treatment, dietary supplement and sweetener for patients with type 2 diabetes; (2) It lowers blood lipids, reduces the activity of lipase, and inhibits the accumulation of intra-abdominal fat; (3) It has antioxidant activity and has strong reactive oxygen species (ROS) scavenging ability and glutathione reducing ability; (4) It has neuroprotective and anti-inflammatory effects, etc.
[0003] The production methods of D-psicose can be divided into two types: chemical synthesis and biosynthesis. The chemical synthesis method has many disadvantages, such as the difficulty in separating and purifying the product, and the generation of a variety of by-products and chemical waste. The biosynthetic method for producing D-psicose is to use specific enzymes produced by microorganisms to specifically catalyze the synthesis of D-psicose from substrates. Due to the higher substrate specificity and mild reaction conditions that provide higher sustainability, enzymatic synthesis of D-psicose has become the first choice. The D-psicose-3-epimerase family is an important biocatalyst for the bioproduction of D-psicose, which can isomerize D-fructose to D-psicose. So far, at least 20 D-psicose-3-epimerases have been screened and identified, but most of them have low catalytic activity for D-fructose and poor thermal stability. Industrial production requires higher temperatures for reaction, which greatly limits the industrial application of bioenzymatic production of D-psicose. Summary of the invention
[0004] In order to overcome the above problems, the present invention provides a D-psicose-3-epimerase mutant and application thereof in synthesizing psicose.
[0005] In order to achieve the above technical objectives, the present invention adopts the following technical solutions: In a first aspect of the present invention, a D-psicose-3-epimerase mutant is provided, which is obtained by simultaneously mutating the methionine at position 59, the phenylalanine at position 106, and the arginine at position 188 of the wild-type D-psicose-3-epimerase with an amino acid sequence as shown in SEQ ID NO.2 through multiple sites.
[0006] In one or more embodiments, the wild-type D-psicose-3-epimerase with an amino acid sequence as shown in SEQ ID NO.2 has its methionine at position 59 mutated to leucine; its phenylalanine at position 106 mutated to serine; and its arginine at position 188 mutated to proline.
[0007] The second aspect of the present invention provides a gene encoding the D-psicose-3-epimerase mutant described in the first aspect.
[0008] The third aspect of the present invention provides an expression cassette comprising the gene described in the second aspect.
[0009] The fourth aspect of the present invention provides a recombinant expression vector comprising the gene described in the second aspect.
[0010] The fifth aspect of the present invention provides a recombinant bacterium comprising the gene described in the second aspect.
[0011] The sixth aspect of the present invention provides a transgenic cell line comprising the gene described in the second aspect.
[0012] The seventh aspect of the present invention provides use of the D-psicose-3-epimerase mutant described in the first aspect, the encoding gene described in the second aspect, or the recombinant bacteria described in the fifth aspect in catalytic synthesis of D-psicose.
[0013] An eighth aspect of the present invention provides a method for synthesizing D-psicose, comprising: The method comprises the following steps: using wet bacteria obtained by induction culture of genetically engineered bacteria of a D-psicose-3-epimerase mutant, or a crude enzyme solution extracted by ultrasonic crushing of the wet bacteria, or an immobilized enzyme as a catalyst, using fructose as a substrate, and using purified water as a reaction medium to form a reaction system, and reacting to obtain D-psicose; The genetically engineered bacteria are constructed by introducing the D-psicose-3-epimerase mutant described in the first aspect into a host bacterium.
[0014] In one or more embodiments, the amount of the catalyst is 5-25 g / L based on the total weight of the wet bacteria or the immobilized enzyme, and the final concentration of the substrate fructose is 450-550 g / L, preferably 500 g / L.
[0015] A ninth aspect of the present invention provides a method for synthesizing D-psicose, comprising: The method comprises using wet bacteria obtained by induction culture of genetically engineered bacteria containing a D-psicose-3-epimerase mutant and glucose isomerase, or a crude enzyme solution extracted by ultrasonic crushing of wet bacteria, or an immobilized enzyme as a catalyst, glucose as a substrate, and pure water as a reaction medium to form a reaction system, and reacting to obtain D-psicose; The genetically engineered bacteria are constructed by introducing the co-expression combined enzyme plasmid of the D-psicose-3-epimerase mutant and glucose isomerase described in the first aspect into a host bacteria.
[0016] In one or more embodiments, the amount of the catalyst is 5-25 g / L based on the total weight of the wet bacteria or the immobilized enzyme, and the final concentration of the substrate glucose is 450-550 g / L, preferably 500 g / L.
[0017] The beneficial effects of the present invention are: The present invention is derived from thermorubibril ( Brevibacillus thermoruber The D-psicose-3-epimerase mutant was obtained by simultaneous mutation of the 59th, 106th, and 188th positions of the wild-type D-psicose-3-epimerase of 1000 μg / L of cellulose, which significantly improved its efficiency in producing D-psicose from fructose. The conversion rate reached 36.5% after catalyzing 500 g / L fructose to produce D-psicose for 4 h. The strain co-expressing the enzyme Spytag+BtDAE-GtXI+SpyCatcher was constructed by coupling glucose isomerase, which improved the efficiency of intermediate transfer and the stability of the enzyme. The conversion rate reached 30.5% after catalyzing 500 g / L glucose to produce D-psicose for 6 h. Moreover, the activity of the immobilized enzyme can be maintained at 80% after repeated use for 10 batches. Therefore, it has great application value in the field of D-psicose production. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.
[0019] Figure 1 for E. coliReaction process diagram of the synthesis of D-psicose from fructose catalyzed by K12 MG1655 / pET28a-BtDAE-M59L-F106S-R188P; Figure 2 Map was constructed for the pETduet-Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher plasmid; Figure 3 for E. coli Reaction process diagram of the synthesis of D-psicose from glucose catalyzed by K12 MG1655 / pETduet-Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher. DETAILED DESCRIPTION
[0020] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.
[0021] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.
[0022] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.
[0023] The culture medium formula used in the following examples is as follows: LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, solvent is water, pH 7.4.
[0024] LB plate: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 18 g / L agar, solvent is water, pH 7.4.
[0025] High performance liquid chromatography (HPLC) was used to detect the concentration of the product D-psicose. The analysis method was as follows: chromatographic column model: calcium type cation chromatographic column; mobile phase was water, injection volume was 10 μL, differential detector, detection time was: 25 min, flow rate: 0.6 mL / min; column temperature: 80 ℃.
[0026] Sample treatment: Take 100 μL of the sample after the reaction is completed, dilute it 10 times with aqueous solution, filter it through a 0.22 μm filter membrane, and perform HPLC detection.
[0027] Example 1 Construction of expression vector and engineering bacteria: Through library mining, a strain from Bacillus thermorubrum ( Brevibacillus thermoruber ) with NCBI accession number WP_035300654.1, and was commissioned to Nanjing GenScript Biotechnology Co., Ltd. for full gene synthesis. The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.
[0028] Primers F1, R1, F2 and R2 were designed based on the nucleotide sequence shown in SEQ ID NO.1 and the pET-28a vector sequence (the F1 nucleotide sequence is shown in SEQ ID NO.3, the R1 nucleotide sequence is shown in SEQ ID NO.4, the F2 nucleotide sequence is shown in SEQ ID NO.5, and the R2 nucleotide sequence is shown in SEQ ID NO.6).
[0029] F1: 5'-ctttaagaaggagatataccATGAAATGGTCTATGTGCACGACT-3'; R1: 5'-tggtggtggtggtgctcgagTTATTCCGTTGGTGCGATCG-3'; F2: 5'-CTCGAGCACCACCACCACC-3'; R2: 5'-GGTATATCTCCTTCTTAAAGTTAAACAAAAT-3'; The pET-28a plasmid was used as the expression vector to construct Escherichia coli E. coli K12 MG1655 / pET28a-BtDAE.
[0030] Construction of expression plasmid: Under the priming of primers F1 / R1 and F2 / R2, the target gene was used as a template and amplified using high-fidelity Pfu DNA polymerase to obtain the D-psicose-3-epimerase gene sequence with homologous arms. The pET-28a plasmid was used as a template and amplified using high-fidelity Pfu DNA polymerase to obtain the linearized vector sequence. The target gene and the linearized vector were homologously recombined using homologous recombinase to construct plasmid pET28a-BtDAE.
[0031] Preparation of competent cells: Obtain glycerol tubes stored in a -80 ℃ freezer. E. coli K12 MG1655 strain was streaked on an antibiotic-free LB plate and cultured at 37 °C for 10 h to obtain a single colony; a single colony on the LB plate was picked and inoculated into a test tube containing 5 mL of LB medium and cultured at 37 °C and 180 rpm for 9 h; 200 μL of bacterial solution was taken from the test tube and inoculated into 50 mL of LB medium and cultured at 37 °C and 180 rpm to obtain an OD 600 to 0.4-0.6; precool the bacterial solution on ice, transfer the bacterial solution to a sterilized centrifuge tube, place on ice for 10 min, and centrifuge at 4°C and 5000 rpm for 10 min; pour out the supernatant, paying attention to prevent contamination, and replace with precooled 0.1 mol / L CaCl 2 The precipitated cells were resuspended in water and placed on ice for 30 min; centrifuged at 4 °C and 5000 rpm for 10 min, the supernatant was discarded, and the supernatant was washed with pre-cooled 0.1 mol / L CaCl containing 15% glycerol. 2 Resuspend the precipitated cells in aqueous solution, take 100 μL of the resuspended cells and dispense them into sterile 1.5 mL centrifuge tubes, store them in a -80 ℃ refrigerator, and take them out when needed.
[0032] Construction of recombinant E. coli: First, store at -80 ℃ E. coli K12 MG1655 competent cells were placed in an ice bath at 0°C for 10 min, then 5 µL of homologous recombination products were added in a clean bench, placed in an ice bath at 0°C for 30 min, heat-shocked in a 42°C water bath for 90 s, placed in an ice bath at 0°C for 2 min, and 600 µL of LB medium were added. The cells were cultured at 37°C and 200 rpm for 1 h. The cells were spread on an LB plate containing 50 μg / mL kanamycin resistance and cultured at 37°C for 8-12 h. Clones were randomly selected and plasmids were extracted for sequencing and identification. Recombinant Escherichia coli containing the recombinant plasmid were screened and obtained. E. coli K12 MG1655 / pET28a-BtDAE.
[0033] Example 2 Inducible expression of D-psicose-3-epimerase: Wet cells containing D-psicose-3-epimerase gene: The recombinant Escherichia coli obtained in Example 1 E. coli K12 MG1655 / pET28a-BtDAE was inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance and cultured at 37°C, 200 rpm for 12 h. Then, it was inoculated into fresh LB liquid medium containing 50 μg / mL kanamycin resistance at a 1% (v / v) inoculum and cultured at 37°C, 200 rpm until the bacterial OD 600When the p-value reached 0.6-0.8, isopropyl-β-D-thiogalactopyranoside (IPTG) was added at a final concentration of 0.1 mM, and the mixture was induced and cultured at 25 °C for 16 h. The mixture was centrifuged at 4 °C and 8000 rpm for 20 min, the supernatant was discarded, and the precipitate was collected to obtain the wet cells of the recombinant strain pET28a-BtDAE containing D-psicose-3-epimerase.
[0034] Example 3 Construction of D-psicose-3-epimerase gene mutation library: Constructed with Example 2 E. coli K12 MG1655 / pET28a-BtDAE was the starting strain.
[0035] The modification was carried out through the directed evolution theory method, and the crystal structure of D-psicose-3-epimerase was obtained based on homology modeling. According to the calculation of protein folding free energy, the stability-enhancing sites T14S, T34G, M59L, F106S, L139T, V151T, R188P, D207R and N220Y were selected for site-directed mutagenesis.
[0036] The mutation PCR system (100 μL) was as follows: 25 μL 2× Phanta Max buffer, 1 μL dNTPs, 1 μL each of the mutation upper and lower primers, 1 μL template (starting strain), 0.5 μL Pfu DNA polymerase, supplemented with ddH 2 O to 50 μL. PCR conditions were: 95℃ pre-denaturation for 3 min, 30 cycles of: 95℃ 15 s, 60℃ 15 s, 72℃ 7 min20 s, and final extension at 72℃ for 10 min. PCR results were verified by DNA agarose gel electrophoresis, PCR products were digested with DpnI enzyme template, 37℃, 1 hour, 200 rpm, 65℃, 1 minute inactivation, PCR products were heat-shock transformed, and Escherichia coli were cultured. E. coli K12 MG1655 was activated and cultured at 37°C and 200 rpm for 1 hour, then spread on LB plates containing 50 μg / mL kanamycin resistance and cultured inverted at 37°C overnight.
[0037] Table 1 Primer design for site-directed mutagenesis of D-psicose-3-epimerase
[0038] After DNA sequencing, the DNA sequencing results of the site-directed mutations T14S, T34G, M59L, F106S, L139T, V151T, R188P, D207R, N220Y, M59L+F106S, M59L+R188P, F106S+R188P and M59L+F106S+R188P were completely consistent with the expected designed mutations.
[0039] Example 4 Screening of D-psicose-3-epimerase gene mutation library: A single clone was picked from the plate obtained in Example 3 and inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance, and cultured at 37°C, 200 rpm for 12 h. Then, it was inoculated into fresh LB liquid medium containing 50 μg / mL kanamycin resistance at a 1% (v / v) inoculation amount and cultured at 37°C, 200 rpm until the bacterial OD reached 0. 600 When the p-value reaches 0.6-0.8, add isopropyl-β-D-thiogalactopyranoside (IPTG) with a final concentration of 0.1 mM, induce and culture at 25°C for 16 h, centrifuge at 4°C and 8000 rpm for 20 min, discard the supernatant, and collect the precipitate to obtain the wet cells containing the D-psicose-3-isomerase gene mutation library.
[0040] 1. Initial screening: Prepare the reaction solution (200 μL): final concentration of 300 g / L substrate fructose, final concentration of 1 mM Mn 2+ The catalyst dosage was 5 g / L based on the total weight of wet bacteria, and the reaction liquid was composed of pure water as the reaction medium. Reaction conditions: 65 °C, 500 rpm in the reactor for 1 hour, after the reaction, 20 μL of the sample was taken after the reaction was completed, diluted 20 times, filtered through a 0.22 μm filter membrane, and HPLC detection was performed. The test results are shown in Table 2.
[0041] Table 2 Results of initial screening reactions
[0042] 2. Rescreening: The strains obtained in the initial screening were rescreened, and the rescreening reaction solution (10 mL) was prepared: the final concentration of substrate fructose was 300 g / L, the final concentration of Mn was 1 mM 2+ The catalyst dosage was 5 g / L based on the total weight of wet cells, and the reaction liquid was composed of pure water as the reaction medium. Reaction conditions: 65 °C, 500 rpm in the reactor for 1 hour, after the reaction, 20 μL of the sample was taken, diluted 20 times, filtered through a 0.22 μm filter membrane, and HPLC detection was performed. The test results are shown in Table 3.
[0043] The test results are shown in Table 3.
[0044] Table 3 Rescreening reaction results
[0045] Example 5 Application of D-psicose-3-epimerase in catalytic synthesis of D-psicose: The recombinant D-psicose-3-epimerase mutant with the highest activity obtained in Example 4 E. coli K12MG1655 / pET28a-BtDAE-M59L-F106S-R188P was inoculated into LB liquid medium containing kanamycin at a final concentration of 50 μg / mL, and cultured at 37 °C for 9 hours. As a seed solution, it was inoculated into a 5 L fermenter containing 3 L fermentation medium at a volume concentration of 3.5%. Add the prepared culture medium, seal the air outlet and air inlet, install and seal, open the inoculation port, and put it into the autoclave together with the prepared lactose inducer for sterilization at 115 °C for 30 min. Screw the sterilized fermenter with the inoculation port and install it on the operating system, pass condensed water and air (the air inlet pipe must be installed with a sterilization film), insert the air outlet below the liquid level of the conical flask, and when the autoclave drops to 37 °C, put the fire ring on the inoculation port and inoculate the cultured seed solution into the fermenter. Culture at 37 °C and 500 rpm for about 3~4 hours, and the strain density OD 600 After the fermentation tank temperature was lowered to 25 °C, lactose with a final concentration of 16 g / L was added as an inducer, and then cultured at 25 °C and 500 rpm for 12 h. The fermented broth was centrifuged at 8000 rpm for 10 min to obtain the mutant containing D-psicose-3-isomerase. E. coli Wet bacteria of K12MG1655 / pET28a-BtDAE-M59L-F106S-R188P.
[0046] The fermentation tank culture medium consists of: 45 g of tryptone, 36 g of yeast extract, 30 g of sodium chloride, 4.08 g of potassium dihydrogen phosphate, 45 g of glycerol, 6.84 g of dipotassium hydrogen phosphate trihydrate, 15 g of ammonium sulfate, 1.125 g of magnesium sulfate, and 4 g of defoaming agent, and distilled water is added to make the volume to 3 L for dissolution.
[0047] The catalyst dosage was 15 g / L based on the total weight of wet bacteria, the final concentration was 500 g / L substrate fructose, and the final concentration was 1 mM Mn 2+, pure water was used as the reaction medium and the total volume of the reaction liquid was 1 L. Reaction conditions: 65 °C, 500 rpm for 4 hours. After the reaction, 20 μL of the sample was taken, diluted 50 times, filtered through a 0.22 μm filter membrane, and tested by HPLC. The reaction progress curve is shown in Figure 1 As shown, after the reaction, the concentration of D-psicose was 182.5 g / L and the conversion rate was 36.5%.
[0048] Example 6 Construction of a strain co-expressing D-psicose-3-epimerase and glucose isomerase and its application in catalytic synthesis of D-psicose: By constructing a co-expression strain of the recombinant D-psicose-3-epimerase with the highest activity obtained in Example 4 and glucose isomerase, glucose can be used as a substrate to catalyze the synthesis of D-psicose. In the co-expression of D-psicose-3-epimerase and glucose isomerase, the N-terminus of D-psicose-3-epimerase is connected to the SpyTag tag through a linker, and the C-terminus of glucose isomerase is connected to the SpyCatcher tag through a linker. The SpyTag and SpyCatcher tags will specifically bind, wherein the SpyTag nucleotide sequence is shown in SEQ ID NO.7, the SpyCatcher nucleotide sequence is shown in SEQ ID NO.8, and the amino acid sequence of the Linker is GGGGSGGGGSGGGGS. Construction of the enzyme-binding plasmid pETDuet-Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher (see the plasmid map) Figure 2 ), improve the intermediate transfer efficiency and enzyme stability, thereby improving the synthesis efficiency of D-psicose.
[0049] SEQ ID NO.7:ATGGCTCACATAGTAATGGTTGATGCATATAAGCCGACCAAG; SEQ ID NO.8: GTTGATACCCTGAGCGGCCTGTCTAGCGAACAGGGTCAAAGCGGCGACATGACCATTGAAGAGGACAGCGCAACCCATATCAAATTCAGCAAACGTGATGAAGACGGTAAGGAGTTGGCGGGTGCGACGATGGAGTTGCGCGACAGCAGCGGTAAGACCATCTCCACCT GGATTAGCGATGGCCAAGTGAAAGATTTTTATCTGTACCCGGGTAAATACACCTTCGTGGAGACAGCGGCACCGGATGGTTATGAAGTTGCTACTGCGATTACCTTTACGGTGAATGAACAAGGCCAGGTTACCGTCAACGGCAAGGCTACGAAAGGTGACGCCCACATCTGA.
[0050] Glucose isomerase from Bacillus stearothermophilus ( Geobacillus thermoleovorans ) glucose isomerase, NCBI accession number is WP_138187043.1, and Nanjing GenScript Biotechnology Co., Ltd. was commissioned to perform full gene synthesis. The nucleotide sequence is shown in SEQ ID NO.9, and the amino acid sequence is shown in SEQ ID NO.10.
[0051] Primers were designed based on the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.7 and the pET-Duet vector sequence. Spytag+Lingker+BtDAE-M59L-F106S-R188P was constructed into the first cloning site of the pET-Duet vector between the NcoI-NotI restriction sites by homologous recombination, and GtXI+Lingker+SpyCatcher was constructed into the second cloning site of the pET-Duet vector between the NdeI-XhoI restriction sites. The specific construction process was referred to Example 1, and finally a co-expression strain was obtained. E. coli K12 MG1655 / pETDuet-Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher.
[0052] The fermentation process of the co-expression strain is similar to Example 5, and the resistance is ampicillin resistance. The co-expression strain is obtained by fermentation. E. coliK12 MG1655 / pETDuet-Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher wet bacteria, catalyst dosage is 15 g / L based on the total weight of wet bacteria, final concentration is 500 g / L substrate glucose, final concentration is 1 mM Mn 2+ and Co 2+ , pure water was used as the reaction medium, and the total volume of the reaction solution was 1 L. Reaction conditions: 65 °C, 500 rpm for 4 hours. After the reaction, 20 μL of the sample was taken, diluted 50 times, filtered through a 0.22 μm filter membrane, and tested by HPLC. The reaction progress curve is shown in Figure 3 As shown, after the reaction, the concentration of D-psicose was 152.5 g / L and the conversion rate was 30.5%.
[0053] Example 6 Immobilization of D-psicose-3-epimerase and conjugated enzyme and its application in catalytic synthesis of D-psicose: Will E. coli K12 MG1655 / pET28a-BtDAE-M59L-F106S-R188P or E. coli K12 MG1655 / pETDuet-Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher wet bacteria were ultrasonically disrupted to obtain crude enzyme solution, and an appropriate amount of diatomaceous earth was added (the mass ratio of the added amount to the wet bacteria was 5:1, and the mixture was stirred for 10-15 min, and then 0.15% polyethyleneimine by volume was added for flocculation for 20-30 min, and finally 0.5% glutaraldehyde by volume was added for covalent cross-linking for 1 h, and then washed with pure water 3-5 times to obtain immobilized BtDAE-M59L-F106S-R188P and Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher.
[0054] The catalyst dosage was 25 g / L based on the total weight of the immobilized enzyme, the final concentration was 500 g / L of substrate fructose or glucose, and the final concentration was 1 mM Mn 2+ or 1 mM Mn 2+ and Co 2+, pure water was used as the reaction medium to form a total reaction liquid volume of 1 L. Reaction conditions: 70 ℃, 500 rpm for 4-6 hours. After the reaction, 20 μL of the sample was taken, diluted 50 times, filtered through a 0.22 μm filter membrane, and HPLC detection was performed. The conversion rate of immobilized BtDAE-M59L-F106S-R188P after 4 h reaction can reach 35.8%, and the enzyme activity can still be maintained above 80% after 10 batches of reaction. The conversion rate of immobilized Spytag-BtDAE-M59L-F106S-R188P-GtXI-SpyCatcher after 6 h reaction can reach 29.5%, and the enzyme activity can still be maintained above 80% after 10 batches of reaction.
[0055] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.
Claims
1. A D-psicose-3-epimerase mutant, characterized in that: The enzyme is obtained by simultaneously mutating the 59th methionine, the 106th phenylalanine and the 188th arginine of the wild-type D-psicose-3-isomerase with an amino acid sequence as shown in SEQ ID NO.2 through multiple sites.
2. The D-psicose-3-epimerase mutant according to claim 1, wherein The amino acid sequence of the wild-type D-psicose-3-epimerase shown in SEQ ID NO.2 has a mutation of methionine at position 59 to leucine; a mutation of phenylalanine at position 106 to serine; and a mutation of arginine at position 188 to proline.
3. A gene encoding the D-psicose-3-epimerase mutant according to claim 1 or 2.
4. An expression cassette, characterized in that Comprising the gene according to claim 3.
5. A recombinant expression vector, characterized in that: Comprising the gene according to claim 3.
6. A recombinant bacterium, characterized in that: Comprising the gene according to claim 3.
7. A transgenic cell line, characterized in that Comprising the gene according to claim 3.
8. Use of the D-psicose-3-epimerase mutant according to claim 1 or 2, the encoding gene according to claim 3, or the recombinant bacterium according to claim 6 in catalytic synthesis of D-psicose.
9. A method for synthesizing D-psicose, characterized in that: include: The method comprises the following steps: using wet bacteria obtained by induction culture of genetically engineered bacteria of a D-psicose-3-epimerase mutant, or a crude enzyme solution extracted by ultrasonic crushing of the wet bacteria, or an immobilized enzyme as a catalyst, using fructose as a substrate, and using purified water as a reaction medium to form a reaction system, and reacting to obtain D-psicose; Wherein, the genetically engineered bacteria is constructed by introducing the D-psicose-3-epimerase mutant described in claim 1 or 2 into a host bacteria; The dosage of the catalyst is 5-25 g / L based on the total weight of the wet bacteria or the immobilized enzyme, and the final concentration of the substrate fructose is 450-550 g / L.
10. A method for synthesizing D-psicose, characterized in that: include: The method comprises using wet bacteria obtained by induction culture of genetically engineered bacteria containing a D-psicose-3-epimerase mutant and glucose isomerase, or a crude enzyme solution extracted by ultrasonic crushing of wet bacteria, or an immobilized enzyme as a catalyst, glucose as a substrate, and pure water as a reaction medium to form a reaction system, and reacting to obtain D-psicose; Wherein, the genetically engineered bacteria is constructed by introducing the co-expression combined enzyme plasmid of the D-psicose-3-epimerase mutant and glucose isomerase as described in claim 1 or 2 into the host bacteria; The amount of catalyst used is 5-25 g / L based on the total weight of wet bacteria or immobilized enzyme, and the final concentration of substrate glucose is 450-550 g / L.
Citation Information
Patent Citations
D-psicose 3-epimerase mutant and application thereof
CN119331861A
A Genus of Epimerase Enzymes for Conversion of Fructose to Allulose at High Temperature and Low pH
US20180112244A1
Allulose 3-epimerase mutant, engineered bacterium expressing same, and immobilized enzyme and immobilization method thereof
US20220340944A1
Cited By
D-psicose-3-epimerase mutant, host cell and application of D-psicose-3-epimerase mutant in synthesis of psicose
CN121065159A