Compositions and methods for detecting group B streptococcus nucleic acids
By using compositions of specific amplification oligomers and detection probe oligomers, high sensitivity and specific detection to GBS are achieved, solving the problems of insufficient detection sensitivity and difficulty in identifying single gene isolation variants in the prior art.
Patent Information
- Application Number
- CN202411950136.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2019-08-09
- Publication Date
- 2025-06-06
AI Technical Summary
The prior art has problems with insufficient sensitivity and difficulty in detecting isolated variants of a single gene when detecting group B Streptococcus (GBS), especially when it encounters difficulties in identifying different serotypes of GBS.
A composition is adopted that contains a specific amplified oligomer capable of amplifying GBS SIP and CFB target nucleic acids, combined with SIP and CFB specific detection probe oligomers, and achieve high sensitivity and specific detection of GBS through in vitro nucleic acid amplification reaction and real-time detection technology.
It improves the sensitivity of GBS detection, can effectively identify different serotypes and non-hemolytic isolates of GBS, and reduces the problem of insufficient sensitivity to single gene isolation variants.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_4
Abstract
Description
[0001] This application is a divisional application of the invention application with an application date of August 9, 2019, Chinese application number 201980051387.4, and invention name “Compositions and methods for detecting group B streptococcal nucleic acids”. Background Art
[0002] Group B Streptococcus (GBS) or Streptococcus agalactiae is a Gram-positive bacterium associated with transient colonization of mucous membranes throughout the body, including the vagina, gastrointestinal tract, and urethra. GBS rarely causes disease in healthy individuals, but can cause severe disease in immunocompromised patients, elderly individuals, and newborns. Of particular concern is neonatal infection caused by vertical transmission during delivery and production. Transmission from asymptomatic colonized mothers to newborns can lead to early-onset invasive GBS disease, which is the main cause of sepsis and meningitis in newborns in the United States. Early-onset GBS disease in newborns can lead to death or long-term disability, such as mental retardation and hearing or vision loss. Buchan et al., J.Clin.Microbiol.53:443-448,2015.
[0003] Identification of GBS during routine screening has led to the administration of perinatal prophylaxis to mitigate the spread of the bacteria and reduce the likelihood of invasive disease. Implementation of this screening and prevention strategy has reduced the incidence of early-onset GBS by 60% to 86%. Lin et al., Am. J. Obstet. Gynecol. 184: 1204-1210, 2001. Since 2010, CDC guidelines have included molecular diagnostic testing as an option in parallel or in addition to culture. Current tests include Cepheid GB S LB and BD max GBS tests targeting the CFB gene.
[0004] There is a need in the art for GBS assays with improved sensitivity and / or the potential to protect against segregation variation of a single gene, including, for example, assays that can detect GBS serotypes Ia, Ib, Ic, II, III, IV, V, VI, VII, VIII, and IX (including non-hemolytic isolates). Summary of the invention
[0005] In one aspect, the present invention provides a composition for determining the presence or absence of Group B Streptococcus (GBS) in a sample. In some embodiments, the composition comprises at least one of a first amplification oligomer combination and a second amplification oligomer combination, wherein
[0006] (I) The first amplification oligomer combination comprises first and second SIP-specific amplification oligomers capable of amplifying a target region of a GBS SIP target nucleic acid, wherein the first and second SIP-specific amplification oligomers respectively comprise first (A) and second (B) SIP-specific target hybridization sequences selected from the following:
[0007] (a)(A) SEQ ID NO:3, or its RNA equivalent or DNA / RNA chimera, and
[0008] (B) SEQ ID NO:4, or its RNA equivalent or DNA / RNA chimera; and
[0009] (b) (A) SEQ ID NO:7, or its RNA equivalent or DNA / RNA chimera, and
[0010] (B) SEQ ID NO: 8, or its RNA equivalent or DNA / RNA chimera;
[0011] and
[0012] (II) the second amplification oligomer combination comprises first and second CFB-specific amplification oligomers capable of amplifying a target region of a GBS CFB target nucleic acid, wherein the first and second CFB-specific amplification oligomers respectively comprise a first (A') and a second (B') CFB-specific target hybridization sequence selected from the following:
[0013] (a) (A') a sequence of about 17 to about 24 consecutive nucleotides contained in the sequence of SEQ ID NO:26, or its RNA equivalent or DNA / RNA chimera, and (B') SEQ ID NO:13 or SEQ ID NO:15, or its RNA equivalent or DNA / RNA chimera;
[0014] (b) (A') SEQ ID NO: 16, or its RNA equivalent or DNA / RNA chimera, and
[0015] (B') SEQ ID NO: 17, or its RNA equivalent or DNA / RNA chimera;
[0016] (c) (A') SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0017] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera;
[0018] as well as
[0019] (d) (A') SEQ ID NO:20, or its RNA equivalent or DNA / RNA chimera, and
[0020] (B') SEQ ID NO:21, or its RNA equivalent or DNA / RNA chimera.
[0021] In some embodiments of the composition as described above, wherein the composition comprises the first amplification oligomer combination, the composition further comprises a SIP-specific detection probe oligomer, the SIP-specific detection probe oligomer comprising a length of about 15 to about 35 nucleotides and configured to hybridize with a target sequence contained in a SIP amplicon that can be amplified by the first and second SIP-specific amplification oligomers. In some such embodiments, the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I) (a), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 9, or its RNA equivalent or DNA / RNA chimera. In other embodiments, the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I) (b), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 11, or its RNA equivalent or DNA / RNA chimera. In some variations, the SIP-specific detection probe oligomer further comprises a detectable label, such as, for example, a fluorescent or chemiluminescent label. In some embodiments of the probe oligomer comprising a detectable label, the detectable label is a fluorescent label, and the SIP-specific detection probe oligomer further comprises a non-fluorescent quencher.
[0022] In some embodiments of the composition as described above, wherein the CFB-specific target hybridization sequence is the target hybridization sequence of (II)(a), the first CFB-specific target hybridization sequence of (II)(a) comprises at least the sequence of SEQ ID NO:28, or its RNA equivalent or DNA / RNA chimera. In some such embodiments, the first CFB-specific target hybridization sequence of (II)(a) is contained in the sequence of SEQ ID NO:27, or its RNA equivalent or DNA / RNA chimera; in some such variations, the first CFB-specific target hybridization sequence of (II)(a) is SEQ ID NO:12 or SEQ ID NO:14, or its RNA equivalent or DNA / RNA chimera. In other embodiments wherein the CFB-specific target hybridization sequence is the target hybridization sequence of (II)(a), the first CFB-specific target hybridization sequence of (II)(a) is SEQ ID NO:18, or its RNA equivalent or DNA / RNA chimera. Particularly suitable first (A') and second (B') CFB-specific target hybridization sequences of (II)(a) include
[0023] (i) (A') SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0024] (B') SEQ ID NO: 13, or its RNA equivalent or DNA / RNA chimera;
[0025] (ii) (A') SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0026] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera;
[0027] (iii) (A') SEQ ID NO: 14, or its RNA equivalent or DNA / RNA chimera, and
[0028] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera;
[0029] as well as
[0030] (iv) (A') SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0031] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera.
[0032] In some embodiments of the composition as described above, wherein the composition comprises a first amplification oligomer combination, the composition further comprises a CFB-specific detection probe oligomer, wherein the CFB-specific detection probe oligomer comprises a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained within a CFB amplicon that can be amplified by the first and second CFB-specific amplification oligomers. In some such embodiments, the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(b), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:24, or its RNA equivalent or DNA / RNA chimera; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(d), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:25, or its RNA equivalent or DNA / RNA chimera; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(a), and the CFB-specific detection probe target hybridization sequence is SEQID NO:22 or SEQ ID NO:23, or its RNA equivalent or DNA / RNA chimera; or the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(c), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:23, or its RNA equivalent or DNA / RNA chimera. In some variations, the CFB-specific detection probe oligomer further comprises a detectable label, such as, for example, a fluorescent or chemiluminescent label. In some embodiments of the probe oligomer comprising a detectable label, the detectable label is a fluorescent label, and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher.
[0033] In certain embodiments of the composition for determining the presence or absence of GBS in a sample as described above, the composition comprises both the first and second amplification oligomer combinations.
[0034] In another aspect, the present invention provides a composition for determining the presence or absence of GBS in a sample, wherein the composition comprises an amplification oligomer combination comprising a first and a second SIP-specific amplification oligomer capable of amplifying a target region of a GBS SIP target nucleic acid. Particularly suitable first and second SIP-specific amplification oligomers comprise a first (A) and a second (B) SIP-specific target hybridization sequence, respectively, selected from the following:
[0035] (a)(A) SEQ ID NO:3, or its RNA equivalent or DNA / RNA chimera, and
[0036] (B) SEQ ID NO:4, or its RNA equivalent or DNA / RNA chimera; and
[0037] (b) (A) SEQ ID NO:7, or its RNA equivalent or DNA / RNA chimera, and
[0038] (B) SEQ ID NO: 8, or its RNA equivalent or DNA / RNA chimera. In some variations, the composition further comprises a SIP-specific detection probe oligomer, the SIP-specific detection probe oligomer comprising a length of about 15 to about 35 nucleotides and a SIP-specific detection probe target hybridization sequence configured to hybridize with a target sequence contained in a SIP amplicon that can be amplified by the first and second SIP-specific amplification oligomers. In some such embodiments, the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (a), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 9, or its RNA equivalent or DNA / RNA chimera. In other embodiments, the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (b), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 11, or its RNA equivalent or DNA / RNA chimera. In some variations, the SIP-specific detection probe oligomer further comprises a detectable label, such as, for example, a fluorescent or chemiluminescent label. In some embodiments of the probe oligomer comprising a detectable label, the detectable label is a fluorescent label, and the SIP-specific detection probe oligomer further comprises a non-fluorescent quencher. In some variations of the composition described above, the composition further comprises a second amplification oligomer combination capable of amplifying a target region of a GBS CFB target nucleic acid.
[0039] In another aspect, the present invention provides a composition for determining the presence or absence of GBS in a sample, wherein the composition comprises an amplification oligomer combination comprising a first and a second CFB-specific amplification oligomer capable of amplifying a target region of a GBS CFB target nucleic acid. Particularly suitable first and second CFB-specific amplification oligomers comprise a first (A) and a second (B) CFB-specific target hybridization sequence, respectively, selected from the following:
[0040] (a)(A) a sequence of about 17 to about 24 consecutive nucleotides contained in the sequence of SEQ ID NO: 26, or its RNA equivalent or DNA / RNA chimera, and
[0041] (B) SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0042] (b) (A) SEQ ID NO: 16, or its RNA equivalent or DNA / RNA chimera, and
[0043] (B) SEQ ID NO: 17, or its RNA equivalent or DNA / RNA chimera;
[0044] (c) (A) SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0045] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0046] (d) (A) SEQ ID NO: 20, or its RNA equivalent or DNA / RNA chimera, and
[0047] (B) SEQ ID NO:21, or its RNA equivalent or DNA / RNA chimera. In certain embodiments, the first CFB-specific target hybridization sequence of (a) comprises at least the sequence of SEQ ID NO:28, or its RNA equivalent or DNA / RNA chimera. In some such embodiments, the first CFB-specific target hybridization sequence of (a) is contained in the sequence of SEQ ID NO:27, or its RNA equivalent or DNA / RNA chimera; in some such variations, the first CFB-specific target hybridization sequence of (a) is SEQ ID NO:12 or SEQ ID NO:14, or its RNA equivalent or DNA / RNA chimera. In other embodiments, the first CFB-specific target hybridization sequence of (a) is SEQ ID NO:18, or its RNA equivalent or DNA / RNA chimera. Particularly suitable first (A) and second (B) CFB-specific target hybridization sequences of (a) include
[0048] (i) (A) SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0049] (B) SEQ ID NO: 13, or its RNA equivalent or DNA / RNA chimera;
[0050] (ii) (A) SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0051] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera;
[0052] (iii) (A) SEQ ID NO: 14, or its RNA equivalent or DNA / RNA chimera, and
[0053] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0054] (iv) (A) SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0055] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera. In some variations, the composition further comprises a CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained within a CFB amplicon that can be amplified by the first and second CFB-specific amplification oligomers. In some such embodiments, the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (b), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 24, or its RNA equivalent or DNA / RNA chimera; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (d), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 25, or its RNA equivalent or DNA / RNA chimera; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (a), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 22 or SEQ ID NO: 23, or its RNA equivalent or DNA / RNA chimera; or the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (c), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 23, or its RNA equivalent or DNA / RNA chimera. In some variations, the CFB-specific detection probe oligomer further comprises a detectable label, such as, for example, a fluorescent or chemiluminescent label. In some embodiments of the probe oligomer comprising a detectable label, the detectable label is a fluorescent label, and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher. In some variations of the composition described above, the composition further comprises a second amplification oligomer combination capable of amplifying a target region of a GBS SIP target nucleic acid.
[0056] In another aspect, the present invention provides an aqueous formulation for amplifying GBS nucleic acid comprising a composition as described above and an organic buffer. In some embodiments, the aqueous formulation further comprises one or more components selected from the following: DNA polymerase, reverse transcriptase, detection probe oligomers, and extenders (e.g., trehalose, raffinose, or a combination thereof). In some embodiments, the aqueous formulation contains an inorganic salt at a concentration of 4 mM or less.
[0057] In another aspect, the present invention provides a reaction mixture for amplifying GBS nucleic acid comprising the aqueous formulation as described above.
[0058] On the other hand, the present invention provides a dry formulation for amplifying GBS nucleic acid comprising a composition as described above and an extender. In some embodiments, the extender is trehalose, raffinose, or a combination thereof. In some embodiments, the dry formulation further comprises one or more components selected from the following items: inorganic salts, DNA polymerase, reverse transcriptase, and detection probe oligomers. In some embodiments further comprising inorganic salts, the mass of the inorganic salt relative to the mass of the dry formulation is 0.249% or less. In some variations, the dry formulation is a lyophilized formulation.
[0059] In another aspect, the invention provides a reaction mixture for amplifying GBS nucleic acid, wherein the reaction mixture is reconstituted from a dry preparation as described above with water or an organic buffer. In some embodiments, the reaction mixture contains an inorganic salt, such as, for example, magnesium, potassium or sodium; in some such variations, the concentration of the inorganic salt is 4 mM or less.
[0060] In another aspect, the present invention provides a kit for determining the presence or absence of GBS in a sample. In some embodiments, the kit comprises at least one of a first amplification oligomer combination and a second amplification oligomer combination, wherein
[0061] (I) The first amplification oligomer combination comprises first and second SIP-specific amplification oligomers capable of amplifying a target region of a GBS SIP target nucleic acid, wherein the first and second SIP-specific amplification oligomers respectively comprise first (A) and second (B) SIP-specific target hybridization sequences selected from the following:
[0062] (a)(A) SEQ ID NO:3, or its RNA equivalent or DNA / RNA chimera, and
[0063] (B) SEQ ID NO:4, or its RNA equivalent or DNA / RNA chimera; and
[0064] (b) (A) SEQ ID NO:7, or its RNA equivalent or DNA / RNA chimera, and
[0065] (B) SEQ ID NO: 8, or its RNA equivalent or DNA / RNA chimera;
[0066] and
[0067] (II) the second amplification oligomer combination comprises first and second CFB-specific amplification oligomers capable of amplifying a target region of a GBS CFB target nucleic acid, wherein the first and second CFB-specific amplification oligomers respectively comprise a first (A') and a second (B') CFB-specific target hybridization sequence selected from the following:
[0068] (a)(A') is a sequence of about 17 to about 24 consecutive nucleotides contained in the sequence of SEQ ID NO: 26, or its RNA equivalent or DNA / RNA chimera, and
[0069] (B') SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0070] (b) (A') SEQ ID NO: 16, or its RNA equivalent or DNA / RNA chimera, and
[0071] (B') SEQ ID NO: 17, or its RNA equivalent or DNA / RNA chimera;
[0072] (c) (A') SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0073] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera;
[0074] as well as
[0075] (d) (A') SEQ ID NO:20, or its RNA equivalent or DNA / RNA chimera, and
[0076] (B') SEQ ID NO:21, or its RNA equivalent or DNA / RNA chimera.
[0077] In some embodiments of the kit as described above, wherein the kit comprises a first amplification oligomer combination, the kit further comprises a SIP-specific detection probe oligomer, the SIP-specific detection probe oligomer comprising a length of about 15 to about 35 nucleotides and configured to hybridize with a target sequence contained in a SIP amplicon that can be amplified by the first and second SIP-specific amplification oligomers. In some such embodiments, the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I) (a), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 9, or its RNA equivalent or DNA / RNA chimera. In other embodiments, the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I) (b), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 11, or its RNA equivalent or DNA / RNA chimera. In some variations, the SIP-specific detection probe oligomer further comprises a detectable label, such as, for example, a fluorescent or chemiluminescent label. In some embodiments of the probe oligomer comprising a detectable label, the detectable label is a fluorescent label, and the SIP-specific detection probe oligomer further comprises a non-fluorescent quencher.
[0078] In some embodiments of the kit as described above, wherein the CFB-specific target hybridization sequence is the target hybridization sequence of (II)(a), the first CFB-specific target hybridization sequence of (II)(a) comprises at least the sequence of SEQ ID NO:28, or its RNA equivalent or DNA / RNA chimera. In some such embodiments, the first CFB-specific target hybridization sequence of (II)(a) is contained in the sequence of SEQ ID NO:27, or its RNA equivalent or DNA / RNA chimera; in some such variations, the first CFB-specific target hybridization sequence of (II)(a) is SEQ ID NO:12 or SEQ ID NO:14, or its RNA equivalent or DNA / RNA chimera. In other embodiments wherein the CFB-specific target hybridization sequence is the target hybridization sequence of (II)(a), the first CFB-specific target hybridization sequence of (II)(a) is SEQ ID NO:18, or its RNA equivalent or DNA / RNA chimera. Particularly suitable first (A') and second (B') CFB-specific target hybridization sequences of (II)(a) include
[0079] (i) (A') SEQ ID NO: 12, or an RNA equivalent or DNA / RNA chimera thereof, and (B') SEQ ID NO: 13, or an RNA equivalent or DNA / RNA chimera thereof;
[0080] (ii) (A') SEQ ID NO: 12, or an RNA equivalent or DNA / RNA chimera thereof, and (B') SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0081] (iii) (A') SEQ ID NO: 14, or an RNA equivalent or DNA / RNA chimera thereof, and (B') SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof; and
[0082] (iv) (A') SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof, and (B') SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof.
[0083] In some embodiments of the kit as described above, wherein the kit comprises a first amplification oligomer combination, the kit further comprises a CFB-specific detection probe oligomer, the CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained within a CFB amplicon that can be amplified by the first and second CFB-specific amplification oligomers. In some such embodiments, the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(b), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:24, or its RNA equivalent or DNA / RNA chimera; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(d), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:25, or its RNA equivalent or DNA / RNA chimera; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(a), and the CFB-specific detection probe target hybridization sequence is SEQID NO:22 or SEQ ID NO:23, or its RNA equivalent or DNA / RNA chimera; or the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(c), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:23, or its RNA equivalent or DNA / RNA chimera. In some variations, the CFB-specific detection probe oligomer further comprises a detectable label, such as, for example, a fluorescent or chemiluminescent label. In some embodiments of the probe oligomer comprising a detectable label, the detectable label is a fluorescent label, and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher.
[0084] In certain embodiments of the kit for determining the presence or absence of GBS in a sample as described above, the kit comprises both the first and second amplification oligomer combination.
[0085] In another aspect, the present invention provides a kit for determining the presence or absence of GBS in a sample, wherein the kit comprises an amplification oligomer combination comprising a first and a second SIP-specific amplification oligomer capable of amplifying a target region of a GBS SIP target nucleic acid. Particularly suitable first and second SIP-specific amplification oligomers comprise a first (A) and a second (B) SIP-specific target hybridization sequence, respectively, selected from the group consisting of:
[0086] (a)(A) SEQ ID NO:3, or its RNA equivalent or DNA / RNA chimera, and
[0087] (B) SEQ ID NO:4, or its RNA equivalent or DNA / RNA chimera; and
[0088] (b) (A) SEQ ID NO:7, or its RNA equivalent or DNA / RNA chimera, and
[0089] (B) SEQ ID NO: 8, or its RNA equivalent or DNA / RNA chimera. In some variations, the kit further comprises a SIP-specific detection probe oligomer, the SIP-specific detection probe oligomer comprising a length of about 15 to about 35 nucleotides and a SIP-specific detection probe target hybridization sequence configured to hybridize with a target sequence contained in a SIP amplicon that can be amplified by the first and second SIP-specific amplification oligomers. In some such embodiments, the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (a), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 9, or its RNA equivalent or DNA / RNA chimera. In other embodiments, the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (b), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 11, or its RNA equivalent or DNA / RNA chimera. In some variations, the SIP-specific detection probe oligomer further comprises a detectable label, such as, for example, a fluorescent or chemiluminescent label. In some embodiments of the probe oligomer comprising a detectable label, the detectable label is a fluorescent label, and the SIP-specific detection probe oligomer further comprises a non-fluorescent quencher. In some variations of the kit as described above, the kit further comprises a second amplification oligomer combination capable of amplifying a target region of a GBS CFB target nucleic acid.
[0090] In another aspect, the present invention provides a kit for determining the presence or absence of GBS in a sample, wherein the kit comprises an amplification oligomer combination comprising a first and a second CFB-specific amplification oligomer capable of amplifying a target region of a GBS CFB target nucleic acid. Particularly suitable first and second CFB-specific amplification oligomers comprise a first (A) and a second (B) CFB-specific target hybridization sequence, respectively, selected from the following:
[0091] (a)(A) a sequence of about 17 to about 24 consecutive nucleotides contained in the sequence of SEQ ID NO: 26, or its RNA equivalent or DNA / RNA chimera, and
[0092] (B) SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0093] (b) (A) SEQ ID NO: 16, or its RNA equivalent or DNA / RNA chimera, and
[0094] (B) SEQ ID NO: 17, or its RNA equivalent or DNA / RNA chimera;
[0095] (c) (A) SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof; and
[0096] (d) (A) SEQ ID NO:20, or its RNA equivalent or DNA / RNA chimera, and (B) SEQ ID NO:21, or its RNA equivalent or DNA / RNA chimera. In certain embodiments, the first CFB-specific target hybridization sequence of (a) comprises at least the sequence of SEQ ID NO:28, or its RNA equivalent or DNA / RNA chimera. In some such embodiments, the first CFB-specific target hybridization sequence of (a) is contained in the sequence of SEQ ID NO:27, or its RNA equivalent or DNA / RNA chimera; in some such variations, the first CFB-specific target hybridization sequence of (a) is SEQ ID NO:12 or SEQ ID NO:14, or its RNA equivalent or DNA / RNA chimera. In other embodiments, the first CFB-specific target hybridization sequence of (a) is SEQ ID NO:18, or its RNA equivalent or DNA / RNA chimera. Particularly suitable first (A) and second (B) CFB-specific target hybridization sequences of (a) include
[0097] (i) (A) SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0098] (B) SEQ ID NO: 13, or its RNA equivalent or DNA / RNA chimera;
[0099] (ii) (A) SEQ ID NO: 12, or an RNA equivalent or DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0100] (iii) (A) SEQ ID NO: 14, or an RNA equivalent or DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof; and
[0101] (iv) (A) SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof. In some variations, the kit further comprises a CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained within a CFB amplicon amplifiable by the first and second CFB-specific amplification oligomers. In some such embodiments, the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (b), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 24, or its RNA equivalent or DNA / RNA chimera; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (d), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 25, or its RNA equivalent or DNA / RNA chimera; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (a), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 22 or SEQ ID NO: 23, or its RNA equivalent or DNA / RNA chimera; or the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (c), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 23, or its RNA equivalent or DNA / RNA chimera. In some variations, the CFB-specific detection probe oligomer further comprises a detectable label, such as, for example, a fluorescent or chemiluminescent label. In some embodiments of the probe oligomer comprising a detectable label, the detectable label is a fluorescent label, and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher. In some variations of the above kit, the kit further comprises a second amplification oligomer combination capable of amplifying a target region of a GBS SIP target nucleic acid.
[0102] In another aspect, the invention provides a method for determining the presence or absence of GBS in a sample. In some embodiments, the method comprises
[0103] (1) contacting a sample suspected of containing GBS with at least one of a first amplification oligomer combination and a second amplification oligomer combination, wherein
[0104] (I) The first amplification oligomer combination comprises first and second SIP-specific amplification oligomers for amplifying a GBS SIP target nucleic acid, wherein the first and second SIP-specific amplification oligomers respectively comprise first (A) and second (B) target region SIP-specific target hybridization sequences selected from the following:
[0105] (a)(A) SEQ ID NO:3, or its RNA equivalent or DNA / RNA chimera, and
[0106] (B) SEQ ID NO: 4, or its RNA equivalent or DNA / RNA chimera;
[0107] as well as
[0108] (b) (A) SEQ ID NO:7, or its RNA equivalent or DNA / RNA chimera, and
[0109] (B) SEQ ID NO: 8, or its RNA equivalent or DNA / RNA chimera;
[0110] and
[0111] (II) the second amplification oligomer combination comprises first and second CFB-specific amplification oligomers for amplifying a target region of a GBS CFB target nucleic acid, wherein the first and second CFB-specific amplification oligomers respectively comprise a first (A') and a second (B') CFB-specific target hybridization sequence selected from the following:
[0112] (a)(A') is a sequence of about 17 to about 24 consecutive nucleotides contained in the sequence of SEQ ID NO: 26, or its RNA equivalent or DNA / RNA chimera, and
[0113] (B') SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0114] (b) (A') SEQ ID NO: 16, or its RNA equivalent or DNA / RNA chimera, and
[0115] (B') SEQ ID NO: 17, or its RNA equivalent or DNA / RNA chimera;
[0116] (c) (A') SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0117] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera;
[0118] as well as
[0119] (d) (A') SEQ ID NO:20, or its RNA equivalent or DNA / RNA chimera, and
[0120] (B') SEQ ID NO:21, or its RNA equivalent or DNA / RNA chimera;
[0121] (2) performing an in vitro nucleic acid amplification reaction, wherein any GBS SIP and / or CFB target nucleic acid when present in the sample is used as a template to generate one or more amplicons corresponding to at least one of the SIP and CFB target regions; and
[0122] (3) detecting the presence or absence of the one or more amplicons, thereby determining the presence or absence of GBS in the sample.
[0123] In some embodiments of the method as described above, the method comprises contacting the sample with both the first and second amplification oligomer combinations. In some such embodiments, the method is a multiplexing method comprising contacting the sample with both the first and second amplification oligomer combinations within the same reaction mixture.
[0124] In some embodiments of the method as described above, wherein the method includes contacting the sample with the first amplification oligomer combination, the detection step includes contacting the in vitro nucleic acid amplification reactant with a SIP-specific detection probe oligomer, the SIP-specific detection probe oligomer comprising a length of about 15 to about 35 nucleotides and configured to hybridize with a target sequence contained in a SIP amplicon that can be amplified by the first and second SIP-specific amplification oligomers. In some such embodiments, the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I) (a), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 9, or its RNA equivalent or DNA / RNA chimera. In other embodiments, the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I) (b), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 11, or its RNA equivalent or DNA / RNA chimera. In some variations, the SIP-specific detection probe oligomer further comprises a detectable label, such as a fluorescent or chemiluminescent label. In some embodiments of the probe oligomer comprising a detectable label, the detectable label is a fluorescent label, and the SIP-specific detection probe oligomer further comprises a non-fluorescent quencher.
[0125] In some embodiments of the method as described above, wherein the CFB-specific target hybridization sequence is the target hybridization sequence of (II)(a), the first CFB-specific target hybridization sequence of (II)(a) comprises at least the sequence of SEQ ID NO:28, or its RNA equivalent or DNA / RNA chimera. In some such embodiments, the first CFB-specific target hybridization sequence of (II)(a) is contained in the sequence of SEQ ID NO:27, or its RNA equivalent or DNA / RNA chimera; in some such variations, the first CFB-specific target hybridization sequence of (II)(a) is SEQ ID NO:12 or SEQ ID NO:14, or its RNA equivalent or DNA / RNA chimera. In other embodiments in which the CFB-specific target hybridization sequence is the target hybridization sequence of (II)(a), the first CFB-specific target hybridization sequence of (II)(a) is SEQ ID NO:18, or its RNA equivalent or DNA / RNA chimera. Particularly suitable first (A') and second (B') CFB-specific target hybridization sequences of (II)(a) include
[0126] (i) (A') SEQ ID NO: 12, or an RNA equivalent or DNA / RNA chimera thereof, and (B') SEQ ID NO: 13, or an RNA equivalent or DNA / RNA chimera thereof;
[0127] (ii) (A') SEQ ID NO: 12, or an RNA equivalent or DNA / RNA chimera thereof, and (B') SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0128] (iii) (A') SEQ ID NO: 14, or an RNA equivalent or DNA / RNA chimera thereof, and (B') SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof; and
[0129] (iv) (A') SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof, and (B') SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof.
[0130] In some embodiments of the method as described above, wherein the method includes contacting the sample with the second amplification oligomer combination, the detection step includes contacting the in vitro nucleic acid amplification reactant with a CFB-specific detection probe oligomer, the CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained within a CFB amplicon that can be amplified by the first and second CFB-specific amplification oligomers. In some such embodiments, the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(b), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:24, or its RNA equivalent or DNA / RNA chimera; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(d), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:25, or its RNA equivalent or DNA / RNA chimera; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(a), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:22 or SEQ ID NO:23, or its RNA equivalent or DNA / RNA chimera; or the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(c), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:23, or its RNA equivalent or DNA / RNA chimera. In some variations, the CFB-specific detection probe oligomer further comprises a detectable label, such as, for example, a fluorescent or chemiluminescent label. In some embodiments of the probe oligomer comprising a detectable label, the detectable label is a fluorescent label, and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher.
[0131] In certain variations of the methods for determining the presence or absence of GBS in a sample as described above, the detecting step is performed in real time.
[0132] In certain variations of the methods for determining the presence or absence of GBS in a sample as described above, the in vitro nucleic acid amplification reaction is a PCR amplification reaction (eg, a real-time PCR amplification reaction).
[0133] In some embodiments of the method as described above, wherein the method comprises contacting the sample with both the first and second amplification oligomer combinations (e.g., a multiplexing method), the detection step comprises contacting the in vitro nucleic acid amplification reactants with (i) a SIP-specific detection probe oligomer and (ii) a CFB-specific detection probe oligomer, wherein the SIP-specific detection probe oligomer comprises a SIP-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize with a target sequence contained in a SIP amplicon amplifiable by the first and second SIP-specific amplification oligomers, and wherein the CFB-specific detection probe oligomer comprises a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize with a target sequence contained in a CFB amplicon amplifiable by the first and second CFB-specific amplification oligomers, wherein each of the SIP-specific detection probe oligomer and the CFB-specific detection probe oligomer comprises a fluorescent label and a non-fluorescent quencher. In some such embodiments, the in vitro nucleic acid amplification reaction is a real-time PCR amplification reaction.
[0134] In another aspect, the present invention provides a method for determining the presence or absence of GBS in a sample, wherein the method comprises
[0135] (1) contacting a sample suspected of containing GBS with an amplification oligomer combination comprising first and second SIP-specific amplification oligomers for amplifying a target region of a GBS SIP target nucleic acid, wherein the first and second SIP-specific amplification oligomers respectively comprise first (A) and second (B) SIP-specific target hybridization sequences selected from the group consisting of:
[0136] (a)(A) SEQ ID NO:3, or its RNA equivalent or DNA / RNA chimera, and
[0137] (B) SEQ ID NO:4, or its RNA equivalent or DNA / RNA chimera; and
[0138] (b) (A) SEQ ID NO:7, or its RNA equivalent or DNA / RNA chimera, and
[0139] (B) SEQ ID NO: 8, or its RNA equivalent or DNA / RNA chimera;
[0140] (2) performing an in vitro nucleic acid amplification reaction, wherein any GBS SIP target nucleic acid when present in the sample is used as a template to produce an amplicon corresponding to the SIP target region; and
[0141] (3) Detecting the presence or absence of the amplicon, thereby determining the presence or absence of GBS in the sample.
[0142] In some variations, the detection step includes contacting the in vitro nucleic acid amplification reactant with a SIP-specific detection probe oligomer, the SIP-specific detection probe oligomer comprising a length of about 15 to about 35 nucleotides and configured to hybridize with a target sequence contained in a SIP amplicon that can be amplified by the first and second SIP-specific amplification oligomers. In some such embodiments, the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (a), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 9, or its RNA equivalent or DNA / RNA chimera. In other embodiments, the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (b), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 11, or its RNA equivalent or DNA / RNA chimera. In some variations, the SIP-specific detection probe oligomer further comprises a detectable label, such as, for example, a fluorescent or chemiluminescent label. In some embodiments of the probe oligomer comprising a detectable label, the detectable label is a fluorescent label, and the SIP specific detection probe oligomer further comprises a non-fluorescent quencher. In some variations, the detection step is performed in real time. In some variations, the in vitro nucleic acid amplification reaction is a PCR amplification reaction (e.g., a real-time PCR amplification reaction). In some embodiments, the method further comprises contacting the sample with a second amplification oligomer combination, the second amplification oligomer combination comprising the first and second CFB specific amplification oligomers for amplifying the target region of the GBS CFB target nucleic acid, wherein in the amplification step, any GBS CFB target nucleic acid present in the sample is used as a template to generate an amplicon corresponding to the CFB target region, and wherein the detection step comprises detecting the presence or absence of the amplicon corresponding to the CFB target region.
[0143] In another aspect, the present invention provides a method for determining the presence or absence of GBS in a sample, wherein the method comprises
[0144] (1) contacting a sample suspected of containing GBS with an amplification oligomer combination comprising first and second CFB-specific amplification oligomers for amplifying a target region of a GBS CFB target nucleic acid, wherein the first and second CFB-specific amplification oligomers respectively comprise first (A) and second (B) CFB-specific target hybridization sequences selected from the group consisting of:
[0145] (a)(A) a sequence of about 17 to about 24 consecutive nucleotides contained in the sequence of SEQ ID NO: 26, or its RNA equivalent or DNA / RNA chimera, and
[0146] (B) SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0147] (b) (A) SEQ ID NO: 16, or its RNA equivalent or DNA / RNA chimera, and
[0148] (B) SEQ ID NO: 17, or its RNA equivalent or DNA / RNA chimera;
[0149] (c) (A) SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0150] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0151] (d) (A) SEQ ID NO: 20, or its RNA equivalent or DNA / RNA chimera, and
[0152] (B) SEQ ID NO: 21, or its RNA equivalent or DNA / RNA chimera;
[0153] (2) performing an in vitro nucleic acid amplification reaction, wherein any GBS CFB target nucleic acid when present in the sample is used as a template to generate amplicons corresponding to the CFB target region; and
[0154] (3) Detecting the presence or absence of the amplicon, thereby determining the presence or absence of GBS in the sample.
[0155] In certain embodiments, the first CFB-specific target hybridization sequence of (a) comprises at least the sequence of SEQ ID NO:28, or its RNA equivalent or DNA / RNA chimera. In some such embodiments, the first CFB-specific target hybridization sequence of (a) is contained in the sequence of SEQ ID NO:27, or its RNA equivalent or DNA / RNA chimera; in some such variations, the first CFB-specific target hybridization sequence of (a) is SEQ ID NO:12 or SEQ ID NO:14, or its RNA equivalent or DNA / RNA chimera. In other embodiments, the first CFB-specific target hybridization sequence of (a) is SEQID NO:18, or its RNA equivalent or DNA / RNA chimera. Particularly suitable first (A) and second (B) CFB-specific target hybridization sequences of (a) include
[0156] (i) (A) SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0157] (B) SEQ ID NO: 13, or its RNA equivalent or DNA / RNA chimera;
[0158] (ii) (A) SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0159] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera;
[0160] (iii) (A) SEQ ID NO: 14, or its RNA equivalent or DNA / RNA chimera, and
[0161] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0162] (iv) (A) SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0163] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera.
[0164] In some variations, the detecting step includes contacting the in vitro nucleic acid amplification reactants with a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained within a CFB amplicon that can be amplified by the first and second CFB-specific amplification oligomers. In some such embodiments, the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (b), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 24, or its RNA equivalent or DNA / RNA chimera; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (d), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 25, or its RNA equivalent or DNA / RNA chimera; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (a), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 22 or SEQ ID NO: 23, or its RNA equivalent or DNA / RNA chimera; or the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (c), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 23, or its RNA equivalent or DNA / RNA chimera. In some variations, the CFB-specific detection probe oligomer further comprises a detectable label, such as, for example, a fluorescent or chemiluminescent label. In some embodiments of the probe oligomer comprising a detectable label, the detectable label is a fluorescent label, and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher. In certain variations, the detection step is performed in real time. In certain variations, the in vitro nucleic acid amplification reaction is a PCR amplification reaction (e.g., a real-time PCR amplification reaction). In some embodiments, the method further comprises contacting the sample with a second amplification oligomer combination, the second amplification oligomer combination comprising a first and a second SIP-specific amplification oligomer for amplifying a target region of a GBS SIP target nucleic acid, wherein in the amplification step, any GBS SIP target nucleic acid present in the sample is used as a template to generate an amplicon corresponding to the SIP target region, and wherein the detection step comprises detecting the presence or absence of the amplicon corresponding to the SIP target region.
[0165] In some embodiments of the method for determining the presence or absence of GBS in a sample as described above, the method determines the presence or absence of any of GBS serotypes Ia, Ib, Ic, II, III, IV, V, VI, VII, VIII, and IX. In some such embodiments, the method further determines the presence or absence of a non-hemolytic strain of GBS.
[0166] In another aspect, the present invention provides a detection probe oligomer. In some embodiments, the detection probe oligomer is a SIP-specific detection probe oligomer, the SIP-specific detection probe oligomer comprising a SIP-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize with a target sequence contained in a SIP amplicon amplifiable by a first amplification oligomer combination, the first amplification oligomer combination comprising first and second SIP-specific amplification oligomers capable of amplifying a target region of a GBS SIP target nucleic acid, wherein the first and second SIP-specific amplification oligomers respectively comprise a first (A) and a second (B) SIP-specific target hybridization sequence selected from the following:
[0167] (a)(A) SEQ ID NO:3, or its RNA equivalent or DNA / RNA chimera, and
[0168] (B) SEQ ID NO:4, or its RNA equivalent or DNA / RNA chimera; and
[0169] (b) (A) SEQ ID NO: 7, or its RNA equivalent or DNA / RNA chimera, and (B) SEQ ID NO: 8, or its RNA equivalent or DNA / RNA chimera. In some embodiments of the SIP-specific detection probe oligomer as described above, the SIP-specific detection probe target hybridization sequence is selected from (a) SEQ ID NO: 9, or its RNA equivalent or DNA / RNA chimera; and (b) SEQ ID NO: 11, or its RNA equivalent or DNA / RNA chimera. In some variations, the SIP-specific detection probe oligomer further comprises a detectable label, such as, for example, a fluorescent or chemiluminescent label. In some embodiments of the probe oligomer comprising a detectable label, the detectable label is a fluorescent label, and the SIP-specific detection probe oligomer further comprises a non-fluorescent quencher.
[0170] In other embodiments, the detection probe oligomer is a CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained within a CFB amplicon amplifiable by a second amplification oligomer combination, the second amplification oligomer combination comprising first and second CFB-specific amplification oligomers capable of amplifying a target region of a GBS CFB target nucleic acid, wherein the first and second CFB-specific amplification oligomers respectively comprise a first (A') and a second (B') CFB-specific target hybridization sequence selected from the following:
[0171] (a)(A') is a sequence of about 17 to about 24 consecutive nucleotides contained in the sequence of SEQ ID NO: 26, or its RNA equivalent or DNA / RNA chimera, and
[0172] (B') SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0173] (b) (A') SEQ ID NO: 16, or its RNA equivalent or DNA / RNA chimera, and
[0174] (B') SEQ ID NO: 17, or its RNA equivalent or DNA / RNA chimera;
[0175] (c) (A') SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0176] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0177] (d) (A') SEQ ID NO:20, or its RNA equivalent or DNA / RNA chimera, and
[0178] (B') SEQ ID NO: 21, or its RNA equivalent or DNA / RNA chimera. In some embodiments of the CFB-specific detection probe oligomer as described above, the CFB-specific detection probe target hybridization sequence is selected from (a) SEQ ID NO: 24, or its RNA equivalent or DNA / RNA chimera; (b) SEQ ID NO: 25, or its RNA equivalent or DNA / RNA chimera; (c) SEQ ID NO: 22, or its RNA equivalent or DNA / RNA chimera; and (d) SEQ ID NO: 23, or its RNA equivalent or DNA / RNA chimera. In some variations, the CFB-specific detection probe oligomer further comprises a detectable label, such as, for example, a fluorescent or chemiluminescent label. In some embodiments of the probe oligomer comprising a detectable label, the detectable label is a fluorescent label, and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher.
[0179] In another aspect, the present invention provides a composition comprising the SIP-specific detection probe oligomer and the CFB-specific detection probe oligomer as described above.
[0180] In another aspect, the present invention provides an aqueous formulation for detecting GBS nucleic acid, the aqueous formulation comprising (1) a SIP-specific detection probe oligomer and / or a CFB-specific detection probe oligomer as described above and (2) an organic buffer. In some embodiments, the aqueous formulation further comprises one or more components selected from the following: a surfactant (e.g., polyethylene glycol mono[4-(1,1,3,3-tetramethylbutyl)phenyl]ether, polysorbate 20, or a combination thereof), a DNA polymerase, a reverse transcriptase, at least one amplification oligomer, and an extender (e.g., trehalose, raffinose, or a combination thereof). In certain variations comprising a surfactant, the surfactant is a non-linear surfactant, such as, for example, polysorbate 20. In some embodiments, the aqueous formulation contains an inorganic salt at a concentration of 4 mM or less. In a related aspect, the present invention provides a reaction mixture for detecting GBS comprising the aqueous formulation as described above.
[0181] In another aspect, the present invention provides a dry formulation for detecting GBS nucleic acid, the dry formulation comprising (1) a SIP-specific detection probe oligomer and / or a CFB-specific detection probe oligomer as described above and (2) an extender. In some embodiments, the extender is trehalose, raffinose, or a combination thereof. In some embodiments, the dry formulation further comprises one or more components selected from the following: an inorganic salt, a DNA polymerase, a reverse transcriptase, at least one amplification oligomer, and a surfactant (e.g., polyethylene glycol mono[4-(1,1,3,3-tetramethylbutyl)phenyl]ether, polysorbate 20, or a combination thereof). In some embodiments further comprising an inorganic salt, the mass of the inorganic salt relative to the mass of the dry formulation is 0.249% or less. In certain variations comprising a surfactant, the surfactant is a nonlinear surfactant, such as, for example, polysorbate 20. In certain variations, the dry formulation is a lyophilized formulation. In a related aspect, the present invention provides a reaction mixture for detecting GBS, wherein the reaction mixture is reconstituted from the dry formulation as described above with water and an organic buffer. In some embodiments, the reaction mixture contains an inorganic salt, such as, for example, magnesium, potassium, or sodium; in some such variations, the concentration of the inorganic salt is 4 mM or less.
[0182] These and other aspects of the invention will become apparent upon reference to the following detailed description of the invention.
[0183] definition
[0184] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those of ordinary skill in the art to which the method and composition belong. General definitions can be found in technical books related to the field of molecular biology, such as Dictionary of Microbiology and Molecular Biology, 2nd edition (Singleton et al., 1994, John Wiley & Sons, New York, New York) or The Harper Collins Dictionary of Biology (Hale and Marham, 1991, Harper Perennial, New York, New York). As used herein, unless otherwise indicated, the following terms and phrases have the meanings assigned to them.
[0185] Unless the context clearly indicates otherwise, the terms "a", "an", and "the" include plural indicators. For example, as used herein, "nucleic acid" is understood to mean one or more nucleic acids. Thus, the terms "a" (or "an"), "one or more", and "at least one" are used interchangeably herein.
[0186] It should be understood that there is an implicit "about" before the temperature, concentration, time, etc. discussed in the present disclosure, so that slight and insubstantial deviations are within the scope of the present teachings herein. Generally, the term "about" indicates an insubstantial change in the amount of a component of a composition, which does not have any significant effect on the activity or stability of the composition. In the absence of explicit exclusions (such as "excluding the endpoints"), all ranges should be interpreted as covering the endpoints; thus, for example, "within 10-15" includes values 10 and 15. Moreover, the use of "comprise, comprises, comprising", "contain, contains, containing" and "include, includes and including" is not restrictive. It should be understood that the general description and detailed description above are only exemplary and explanatory, and are not limitations on the present teachings. In the event that any material incorporated by reference is inconsistent with the explicit content of the present disclosure, the explicit content shall prevail.
[0187] Unless otherwise indicated, embodiments in the specification that recite "comprising" various components are also contemplated as "consisting of" or "consisting essentially of" the recited components; embodiments in the specification that recite "consisting of" various components are also contemplated as "comprising" or "consisting essentially of" the recited components; and embodiments in the specification that recite "consisting essentially of" various components are also contemplated as "consisting of" or "comprising" the recited components (this interchangeability does not apply to the use of these terms in the claims). "Consisting essentially of" means that additional component(s), composition(s), or method step(s) that do not materially alter the basic and novel characteristics of the compositions and methods described herein may be included in those compositions or methods. Such characteristics include the ability to detect a Group B Streptococcus (GBS) nucleic acid sequence present in a sample with specificity to distinguish GBS nucleic acid from other known pathogens, optionally with sensitivity to detect bacteria present in a sample at a concentration of about 100 CFU / ml, optionally within about 60 minutes, and / or when a cyclic amplification reaction is used, within about 40 cycles from the start of the amplification reaction.
[0188] "Sample" includes any specimen that may contain GBS or its components (such as nucleic acids or nucleic acid fragments). Samples include "biological samples", which include any tissue or material from a living or dead person that may contain GBS or target nucleic acids derived therefrom, including, for example, vaginal swab samples, cervical brush samples, respiratory tissue or exudates such as bronchoscopy, bronchoalveolar lavage (BAL) or lung biopsy, sputum, saliva, peripheral blood, plasma, serum, lymph nodes, gastrointestinal tissue, feces, urine, semen or other body fluids or substances. Biological samples can be treated to physically or mechanically disrupt tissue or cell structures, thereby releasing intracellular components into a solution, which can further contain enzymes, buffers, salts, detergents, etc., which are used to prepare biological samples for analysis using standard methods. In addition, samples can include processed samples, such as samples obtained by passing the sample through or through a filtration device, or subsequent centrifugation, or by adhering to a culture medium, matrix or support.
[0189] "Nucleic acid" and "polynucleotide" refer to polymeric compounds containing nucleosides or nucleoside analogs that link nitrogen-containing heterocyclic bases or base analogs together to form polynucleotides, including conventional RNA, DNA, mixed RNA-DNA, and polymers as analogs thereof. The nucleic acid "backbone" can be composed of a variety of connections, including one or more sugar-phosphodiester connections, peptide-nucleic acid bonds ("peptide nucleic acids" or PNAs; PCT Publication No. WO 95 / 32305), phosphorothioate connections, methylphosphonate connections, or combinations thereof. The sugar portion of the nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions (e.g., 2'methoxy or 2'halide substitutions). The nitrogen-containing base can be a conventional base (A, G, C, T, U), an analog thereof (e.g., inosine or others; see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11th ed., 1992), a derivative of a purine or pyrimidine (e.g., N 4 -methyl deoxyguanosine, deaza or aza purine, deaza or aza pyrimidine, a pyrimidine base having a substituent at the 5- or 6-position, a purine base having a substituent at the 2-, 6- or 8-position, 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine and O 4-alkyl-pyrimidine; U.S. Pat. No. 5,378,825 and PCT Publication No. WO 93 / 13121). Nucleic acids may contain one or more "abasic" residues, in which the backbone does not contain a nitrogenous base for one or more positions of the polymer (U.S. Pat. No. 5,585,481). Nucleic acids may contain only conventional RNA or DNA sugars, bases, and linkages, or may contain both conventional components and substituents (e.g., conventional bases with 2' methoxy linkages, or polymers containing conventional bases and one or more base analogs). Nucleic acids include "locked nucleic acids" (LNA), which are analogs containing one or more LNA nucleotide monomers having a bicyclic furanose unit locked in an RNA-mimicking sugar conformation to enhance hybridization affinity for complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). Embodiments of oligomers that may affect the stability of the hybrid complex include PNA oligomers, oligomers including 2'-methoxy or 2'-fluoro substituted RNA, or oligomers that affect the overall charge, charge density, or spatial association of the hybrid complex, including oligomers containing charged connections (e.g., phosphorothioate) or neutral groups (e.g., methylphosphonate). Unless otherwise indicated, 5-methylcytosine can be used in combination with any of the aforementioned backbones / sugars / connections (including RNA or DNA backbones) (or mixtures thereof). It should be understood that when referring to the length range of oligonucleotides, amplicons, or other nucleic acids, the range includes all integers (e.g., a length of 19-25 consecutive nucleotides includes 19, 20, 21, 22, 23, 24, and 25).
[0190] As used herein, a "nucleotide" is a subunit of a nucleic acid consisting of a phosphate group, a 5-carbon sugar, and a nitrogenous base (also referred to herein as a "nucleobase"). The 5-carbon sugar present in RNA is ribose. In DNA, the 5-carbon sugar is 2'-deoxyribose. The term also includes analogs of such subunits, such as a methoxy group at the 2' position of ribose (also referred to herein as "2'-O-Me" or "2'-methoxy").
[0191] "RNA and DNA equivalents" means RNA and DNA molecules that have substantially the same complementary base pair hybridization properties. RNA and DNA equivalents have different sugar moieties (i.e., ribose versus deoxyribose) and may differ in the presence of uracil in RNA and thymine in DNA. Differences between RNA and DNA equivalents do not result in differences in homology because these equivalents have the same degree of complementarity to a particular sequence. "DNA / RNA chimera" means a nucleic acid that contains both DNA and RNA nucleotides. Unless the context clearly indicates otherwise, reference to GBS nucleic acids includes GBS RNA and DNA equivalents and DNA / RNA chimeras thereof.
[0192] As used herein, "target nucleic acid" is a nucleic acid comprising a target sequence to be amplified. The target nucleic acid can be DNA or RNA, and can be single-stranded or double-stranded. In addition to the target sequence, the target nucleic acid may also contain other sequences that may not be amplified.
[0193] As used herein, the term "target sequence" refers to a specific nucleotide sequence of a target nucleic acid to be amplified and / or detected."Target sequence" includes a composite sequence of oligonucleotides (e.g., primer oligonucleotides and / or promoter oligonucleotides) and their complexes during an amplification process (e.g., PCR, TMA). In the case where the target nucleic acid is initially single-stranded, the term "target sequence" will also refer to a sequence complementary to the "target sequence" present in the target nucleic acid. In the case where the target nucleic acid is initially double-stranded, the term "target sequence" refers to both sense (+) strands and antisense (-) strands.
[0194] "Target hybridization sequence" or "target-specific sequence" is used herein to refer to the portion of an oligomer that is configured to hybridize to a target nucleic acid sequence. Preferably, the target hybridization sequence is configured to specifically hybridize to a target nucleic acid sequence. Target hybridization sequences can be 100% complementary to the portion of the target sequence to which they are configured to hybridize, but this is not necessarily the case. Target hybridization sequences can also contain insertions, deletions and / or substitutions of nucleotide residues relative to the target sequence. For example, it may occur that the complementarity of a target hybridization sequence to a target sequence is less than 100%, for example, when the target nucleic acid is a variety of strains within a species, such as is the case for an oligomer configured to hybridize to a variety of GBS serotypes. It should be understood that there are other reasons for configuring a target hybridization sequence to have less than 100% complementarity with a target nucleic acid.
[0195] The term "targeting sequence" as used herein with respect to a region of a GBS nucleic acid refers to a process in which an oligonucleotide hybridizes to a target sequence in a manner that allows amplification and detection as described herein. In a preferred embodiment, the oligonucleotide is complementary to the targeted GBS nucleic acid sequence and contains no mismatches. In another preferred embodiment, the oligonucleotide is complementary to the targeted GBS nucleic acid sequence but contains 1, 2, 3, 4 or 5 mismatches. Preferably, the oligomer hybridizes specifically to the target sequence.
[0196] The term "configured to" refers to the actual arrangement of the polynucleotide sequence configuration of the reference oligonucleotide target hybridization sequence. For example, an amplification oligomer configured to produce a specified amplicon from a target sequence has a polynucleotide sequence that hybridizes with the target sequence and can be used in an amplification reaction to produce an amplicon. For example, an oligonucleotide configured to specifically hybridize with a target sequence has a polynucleotide sequence that specifically hybridizes with a reference sequence under stringent hybridization conditions.
[0197] As used herein, the term "configured to specifically hybridize with..." means that the target hybridization region of the amplification oligonucleotide, detection probe, or other oligonucleotide is designed to have a polynucleotide sequence having a sequence that can target a reference GBS target region. Such an oligonucleotide is not limited to targeting only this sequence, but can be used as a composition for targeting a GBS target nucleic acid, can be used in a kit for targeting a GBS target nucleic acid, or in a method for targeting a GBS target nucleic acid. The oligonucleotide is designed to be used as a component of an assay for amplifying and detecting GBS from a sample, and is therefore designed to target GBS in the presence of other nucleic acids that are commonly found in the test sample. As understood in the art, "specifically hybridizing with..." does not mean exclusively hybridizing with..., as some low levels of hybridization with non-target nucleic acids may occur. Specifically, "specifically hybridizing with..." means that the oligonucleotide is configured to hybridize primarily with the target in the assay so that accurate detection of the target nucleic acid in the sample can be determined.
[0198] As used herein, the term "region" refers to a portion of a nucleic acid, wherein the portion is smaller than the entire nucleic acid. For example, when the nucleic acid in question is an oligonucleotide promoter primer, the term "region" can be used to refer to a smaller promoter portion. Similarly, and also by way of example only, when the nucleic acid is a GBS target nucleic acid, the term "region" can be used to refer to a smaller region of the nucleic acid, wherein the smaller region is targeted by one or more oligonucleotides of the present disclosure. As another non-limiting example, when the nucleic acid in question is an amplicon, the term region can be used to refer to a smaller nucleotide sequence identified for hybridization by a target hybridization sequence of a probe.
[0199] "Oligomer", "oligonucleotide" or "oligonucleotide" refers to a nucleic acid generally less than 1,000 nucleotides (nt), including those within a size range of about 2 to 5 nt at a lower limit and about 500 to 900 nt at an upper limit. Some specific embodiments are oligomers within a size range of about 5 to 15, 16, 17, 18, 19 or 20 nt at a lower limit and about 50 to 600 nt at an upper limit, and other specific embodiments are within a size range of about 10 to 20 nt at a lower limit and about 22 to 100 nt at an upper limit. Oligomers can be purified from naturally occurring sources, but can be synthesized using any well-known enzyme or chemical method. The term oligonucleotide does not represent any specific function of an agent; more precisely, it is generally used to cover all such agents described herein. Oligonucleotides can perform a variety of different functions. For example, if it is specific for the complementary strand and can hybridize therewith and can be further extended in the presence of a nucleic acid polymerase, it can be used as a primer; if it contains a sequence recognized by an RNA polymerase and allows transcription, it can be used as a primer and provide a promoter (e.g., a T7 primer); and if it can hybridize with a target nucleic acid or an amplicon thereof and further provide a detectable portion (e.g., an acridinium ester compound), it can be used to detect a target nucleic acid. Oligomers can be referred to by functional names (e.g., capture probes, primers, or promoter primers), but those skilled in the art will understand that such terms refer to oligomers.
[0200] As used herein, an oligonucleotide that "substantially corresponds" to a specified reference nucleic acid sequence means that the oligonucleotide is sufficiently similar to the reference nucleic acid sequence so that the oligonucleotide has similar hybridization properties to the reference nucleic acid sequence, i.e., it will hybridize to the same target nucleic acid sequence under stringent hybridization conditions. It will be understood by those skilled in the art that a "substantially corresponding oligonucleotide" can be different from the reference sequence and still hybridize to the same target nucleic acid sequence. It should also be understood that, unless the context clearly indicates otherwise, the first nucleic acid corresponding to the second nucleic acid includes its RNA or DNA equivalent and its DNA / RNA chimera, and includes its complement. This variation of nucleic acid can be stated in terms of the percentage of identical bases within the sequence or the percentage of perfectly complementary bases between the probe or primer and its target sequence; therefore, in certain embodiments, if these percentages of base identity or complementarity are 100% to about 80%, preferably 100% to about 85%, or more preferably 100% to about 90% or 100% to about 95%, then the oligonucleotide "substantially corresponds" to the reference nucleic acid sequence. This variation of nucleic acid can also be described by the number of core base substitutions or the number of mismatches in the sequence relative to the reference sequence nucleic acid sequence; therefore, in certain embodiments, if the core base substitution or mismatch number is at most four, preferably at most three, or more preferably at most two or at most one substitution or mismatch (that is, zero to four, preferably zero to three, or more preferably zero to two or zero to one, including end values), the oligonucleotide is "substantially corresponding" to the reference nucleic acid sequence. Similarly, the region of nucleic acid or amplified nucleic acid can be referred to as corresponding to the reference nucleic acid sequence in this article. It will be appreciated by those skilled in the art that various modifications may be required to the hybridization conditions to allow hybridization with a specific target sequence under various complementarity percentages without causing unacceptable levels of non-specific hybridization.
[0201] As used herein, the phrase "or its complement, or its RNA equivalent or DNA / RNA chimera" with respect to a DNA sequence includes (in addition to the reference DNA sequence) the complement of the DNA sequence, the RNA equivalent of the reference DNA sequence, the RNA equivalent of the complement of the reference DNA sequence, the DNA / RNA chimera of the reference DNA sequence, and the DNA / RNA chimera of the complement of the reference DNA sequence. Similarly, the phrase "or its complement, or its DNA equivalent or DNA / RNA chimera" with respect to an RNA sequence includes (in addition to the reference RNA sequence) the complement of the RNA sequence, the DNA equivalent of the reference RNA sequence, the DNA equivalent of the complement of the reference RNA sequence, the DNA / RNA chimera of the reference RNA sequence, and the DNA / RNA chimera of the complement of the reference RNA sequence.
[0202] An "amplification oligonucleotide" or "amplification oligomer" is an oligonucleotide that hybridizes to a target nucleic acid or its complement and participates in a nucleic acid amplification reaction (e.g., acts as a primer or promoter primer). A specific amplification oligomer contains at least about 10 consecutive bases that are complementary to a region of a target nucleic acid sequence or its complementary strand, and optionally at least 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive bases. The consecutive bases may be at least about 80%, at least about 90%, or completely complementary to the target sequence to which the amplification oligomer is bound. Those skilled in the art will appreciate that the recited range includes all integers and rational numbers within the range (e.g., 92% or 98.377%). A specific amplification oligomer is about 10 to about 60 bases long and may optionally contain modified nucleotides.
[0203] A "primer" is an oligomer that hybridizes to a template nucleic acid and has a 3' end that is extended by polymerization. A primer may optionally be modified, for example by including a 5' region that is not complementary to the target sequence. Such modifications may include functional additions such as tags, promoters, or other non-target specific sequences that are used or can be used to manipulate or amplify the primer or target oligonucleotide.
[0204] In the context of transcription-mediated amplification, primers modified with 5' promoter sequences are referred to herein as "promoter primers". One of ordinary skill in the art of molecular biology or biochemistry will understand that an oligomer useful as a primer can be modified to include a 5' promoter sequence and then used as a promoter-primer, and similarly, any promoter-primer can act as a primer with or without its 5' promoter sequence. A promoter-primer modified to incorporate a capped 3' end is referred to herein as a "promoter provider", which is capable of hybridizing to a target nucleic acid and providing an upstream promoter sequence for initiating transcription, but does not provide a primer for oligonucleotide extension.
[0205] As used herein, "non-target specific sequence" or "non-target hybridizing sequence" refers to a region of an oligomer sequence, wherein the region does not stably hybridize to a target sequence under standard hybridization conditions. Oligomers with non-target specificity include, but are not limited to, promoter primers and molecular beacons.
[0206] "Nucleic acid amplification" refers to any in vitro procedure that produces multiple copies of a target nucleic acid sequence or its complement, or a fragment thereof (ie, an amplified sequence containing less than the entire target nucleic acid). Examples of nucleic acid amplification procedures include transcription-related methods such as transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA) and other methods (e.g., U.S. Pat. Nos. 5,399,491, 5,554,516, 5,437,990, 5,130,238, 4,868,105 and 5,124,246), replicase-mediated amplification (e.g., U.S. Pat. No. 4,786,600), polymerase chain reaction (PCR) (e.g., U.S. Pat. Nos. 4,683,195, 4,683,202 and 4,800,159), ligase chain reaction (LCR) (e.g., European Patent No. 0320308), helicase-dependent amplification (e.g., U.S. Pat. No. 7,282,328) and strand displacement amplification (SDA) (e.g., U.S. Pat. No. 5,422,252). Amplification can be linear or exponential. Replicase-mediated amplification uses self-replicating RNA molecules and replicase such as QB replicase. PCR amplification uses DNA polymerase, primers and thermal cycling steps to synthesize multiple copies of two complementary chains of DNA or cDNA. LCR amplification uses at least four separate oligonucleotides to amplify the target and its complementary chain by using multiple cycles of hybridization, connection and denaturation. Helicase-dependent amplification uses a helicase to separate the two chains of the DNA duplex, producing a single-stranded template, after which a sequence-specific primer hybridizes with the template and is extended by a DNA polymerase to amplify the target sequence. SDA uses a primer containing a recognition site for a restriction endonuclease, which causes a nick in one chain of a semi-modified DNA duplex containing the target sequence, and then amplifies in a series of primer extension and chain displacement steps. Specific embodiments use PCR or TMA, but it is clear to those of ordinary skill in the art that the oligomers disclosed herein can be easily used as primers in other amplification methods.
[0207] Transcription-dependent amplification uses a DNA polymerase, an RNA polymerase, deoxyribonucleoside triphosphates, ribonucleoside triphosphates, a promoter-containing oligonucleotide (and optionally may include other oligonucleotides) to ultimately produce multiple RNA transcripts from a nucleic acid template (described in detail in, e.g., U.S. Pat. Nos. 5,399,491 and 5,554,516 to Kacian et al.; U.S. Pat. No. 5,437,990 to Burg et al.; PCT Publication Nos. WO 88 / 01302 and WO 88 / 10315 (Gingeras et al.); U.S. Pat. No. 5,130,238 to Malek et al.; U.S. Pat. Nos. 4,868,105 and 5,124,246 to Urdea et al.; PCT Publication No. WO 94 / 03472 (McDonough et al.); and PCT Publication No. WO 94 / 03473 (McDonough et al.). 95 / 03430 (Ryder et al.) Methods using TMA have been described in detail previously (eg, US Pat. Nos. 5,399,491 and 5,554,516).
[0208] In cyclic amplification methods for real-time detection of amplicons, the term "threshold cycle" (Ct) is a measure of the time of appearance of a signal associated with target amplification, and is typically 10 times the standard deviation of a standardized reporter signal. Once the amplification reaches the "threshold cycle," a positive amplification product of the sequence to which the probe is bound is generally considered to be present. The identity of the amplification product can then be determined by methods known to those skilled in the art, such as gel electrophoresis, nucleic acid sequencing, and other such analytical procedures.
[0209] "Amplicon" or "amplification product" means a nucleic acid molecule produced in a nucleic acid amplification reaction and derived from a target nucleic acid. An amplicon or amplification product contains a target nucleic acid sequence that may have the same or opposite sense as the target nucleic acid.
[0210] As used herein, the term "relative fluorescence unit" ("RFU") is a unit of measurement of fluorescence intensity. RFU varies with the characteristics of the detection means used for the measurement and can be used as a measure of relative intensity between a sample and a control.
[0211] "Detection probe oligomer", "detection probe" or "probe" refers to an oligomer that specifically hybridizes with a target sequence (including amplified sequences) to detect a target nucleic acid under conditions that promote nucleic acid hybridization. Detection can be direct (i.e., the probe hybridizes directly with the target) or indirect (i.e., the probe hybridizes with an intermediate structure that connects the probe to the target). The detection probe can be DNA, RNA, an analog thereof, or a combination thereof (e.g., a DNA / RNA chimera), and they can be labeled or unlabeled. The detection probe may further comprise alternating backbone connections, such as 2'-O-methyl connections. The target sequence of a probe generally refers to a specific sequence within a larger sequence to which the probe specifically hybridizes. The detection probe may comprise one or more target-specific sequences and one or more non-target-specific sequences. Such non-target-specific sequences may include sequences that give a desired secondary or tertiary structure (e.g., a hairpin structure), which can be used to facilitate detection and / or amplification (see, e.g., U.S. Patent Nos. 5,118,801, 5,312,728, 6,835,542, and 6,849,412). Probes of defined sequence can be produced by techniques known to those of ordinary skill in the art, such as by chemical synthesis, and by in vitro or in vivo expression from recombinant nucleic acid molecules.
[0212] "Hybridization" or "hybridize" means the ability of two completely or partially complementary nucleic acid chains to gather together in parallel or antiparallel orientations to form a stable structure with a double-stranded region under specified hybridization assay conditions. The two component chains of this double-stranded structure (sometimes referred to as a hybrid) are held together by hydrogen bonds. Although these hydrogen bonds are most commonly formed between nucleotides containing the bases adenine and thymine or uracil (A and T or U) or cytosine and guanine (C and G) on a single nucleic acid chain, base pairing can also be formed between bases that are not members of these "canonical" pairs. Non-canonical base pairing is well known in the art. See, for example, RLP Adams et al., The Biochemistry of the Nucleic Acids (11th edition 1992).
[0213] "Preferential hybridization" means that under stringent hybridization conditions, amplification or detection probe oligomers can be hybridized with their target nucleic acid to form stable oligomers: target hybrids, but do not form a sufficient number of stable oligomers: non-target hybrids. Amplification and detection oligomers that are preferentially hybridized with target nucleic acids can be used to amplify and detect target nucleic acids but do not amplify and detect non-targeted organisms, especially organisms that are closely related in phylogeny. Therefore, compared with non-target nucleic acids, the degree of hybridization of oligomers and target nucleic acids is large enough to enable those of ordinary skill in the art to appropriately and accurately amplify nucleic acids derived from specified targets and / or detect the presence (or absence) of nucleic acids derived from specified targets. Typically, reducing the degree of complementarity between an oligonucleotide sequence and its target sequence will reduce the degree of hybridization or the rate of an oligonucleotide with its target region. However, comprising one or more non-complementary nucleosides or core bases can promote the ability of oligonucleotides to distinguish non-target organisms.
[0214] Preferential hybridization can be measured using techniques known in the art and described herein (such as in the Examples provided below). In some embodiments, there is at least a 10-fold difference, at least a 100-fold difference, or at least a 1,000-fold difference between the target hybridization signal and the non-target hybridization signal in the test sample. In some embodiments, the non-target hybridization signal in the test sample does not exceed the background signal level.
[0215] "Stringent hybridization conditions" or "stringent conditions" means conditions that allow an oligomer to preferentially hybridize to a target nucleic acid over nucleic acids derived from closely related non-target nucleic acids. Although the definition of stringent hybridization conditions does not vary, the actual reaction environment that can be used for stringent hybridization may vary depending on factors including the GC content and length of the oligomer, the degree of similarity between the oligomer sequence and non-target nucleic acid sequences that may be present in the test sample, and the target sequence. Hybridization conditions include temperature and hybridization reagents or solutions and composition. Exemplary hybridization assay conditions for amplifying and / or detecting target nucleic acids derived from one or more GBS serotypes using the oligomers of the present disclosure correspond to a temperature of about 60°C when the salt concentration (such as a monovalent salt such as KCl) is in the range of about 0.6-0.9M. Other acceptable stringent hybridization conditions are readily determined by those of ordinary skill in the art.
[0216] "Assay conditions" means conditions that allow stable hybridization of an oligonucleotide to a target nucleic acid. Assay conditions do not require preferential hybridization of an oligonucleotide to a target nucleic acid.
[0217] "Label" or "detectable label" refers to a part or compound that is directly or indirectly joined to a probe that is detected or causes a detectable signal. Direct joining can use covalent bonds or non-covalent interactions (e.g., hydrogen bonds, hydrophobic or ionic interactions, and chelates or coordination complexes), while indirect joining can use a bridge portion or joint (e.g., via antibodies or one or more other oligonucleotides) that amplifies detectable signals. Any detectable portion can be used, such as radionuclides, ligands (such as biotin or avidin), enzymes, enzyme substrates, reactive groups, chromophores (such as dyes or particles (e.g., latex or metal beads)) that impart detectable colors, luminescent compounds (e.g., bioluminescent, phosphorescent or chemiluminescent compounds) and fluorescent compounds (i.e., fluorophores). Embodiments of fluorophores include those that absorb light in the range of about 495nm to 650nm and emit light in the range of about 520nm to 670nm, including those referred to as FAM TM 、TET TM 、CAL FLUOR TM (orange or red) and QUASAR TM Fluorophores can be used in conjunction with quencher molecules, which absorb light when in close proximity to the fluorophore to reduce background fluorescence. Such quenchers are well known in the art and include, for example, BLACKHOLE QUENCHER TM (or BHQ TM ) or TAMRA TMCompounds. Specific embodiments include "homogeneous detectable labels" detectable in a homogeneous system, wherein the bound labeled probes in the mixture exhibit a detectable change compared to the unbound labeled probes, which allows the label to be detected without physically removing the hybridized labeled probes from the unhybridized labeled probes (e.g., U.S. Pat. Nos. 5,283,174, 5,656,207, and 5,658,737). Specific homogeneous detectable labels include chemiluminescent compounds, including acridinium ester ("AE") compounds, such as well-known standard AE or AE derivatives (U.S. Pat. Nos. 5,656,207, 5,658,737, and 5,639,604). Methods for synthesizing labels, attaching labels to nucleic acids, and detecting signals from labels are well known (e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989) in Chapter 10, and U.S. Pat. Nos. 5,658,737, 5,656,207, 5,547,842, 5,283,174, and 4,581,333, and European Patent Application 0 747 706). Specific methods for attaching AE compounds to nucleic acids are known (e.g., U.S. Pat. No. 5,585,481 and U.S. Pat. No. 5,639,604, see col. 10, line 6 to col. 11, line 3, and Example 8). Specific AE label locations are in the central region of the probe and near the region near the A / T base pairs, at the 3' or 5' end of the probe, or at or near a mismatch site with a known sequence that the probe should not detect compared to the desired target sequence. Other detectably labeled probes include TaqMan TM Probes, Molecular Torches and Molecular Beacons. TaqMan TM The probe includes a donor and an acceptor label, wherein fluorescence is detected after enzymatic degradation of the probe during amplification to release the fluorophore from the presence of a quencher. Molecular torches and molecular beacons exist in open and closed configurations, wherein the closed configuration quenches the fluorophore and the open position separates the fluorophore from the quencher to allow fluorescence to be generated. Hybridization with the target opens the otherwise closed probe.
[0218] If the sequences allow stable hybridization of two nucleic acid sequences (e.g., stable hybrids of probe and target sequences), they are "sufficiently complementary", but the sequences need not be completely complementary. That is, a "sufficiently complementary" sequence hybridizes to another sequence by hydrogen bonding between a subset of complementary nucleotides using standard base pairing (e.g., G:C, A:T, or A:U), but the two sequences may contain one or more non-complementary residues (including abasic positions), as long as the entire sequence forms a stable hybrid complex under appropriate hybridization conditions. Sufficiently complementary sequences can be at least about 80%, at least about 90%, or completely complementary in the sequences that hybridize together. Appropriate hybridization conditions are well known to those skilled in the art and can be predicted based on sequence composition or can be determined empirically using routine testing (e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd edition at §§1.90-1.91, 7.37-7.57, 9.47-9.51, and 11.47-11.57, in particular §§9.50-9.51, 11.12-11.13, 11.45-11.47, and 11.55-11.57).
[0219] The "non-extendable" oligomer contains a blocking moiety at or near its 3' end to prevent extension. In some embodiments, the blocking group near the 3' end is within five residues of the 3' end and is large enough to limit the binding of the polymerase to the oligomer, and other embodiments contain a blocking group covalently attached to the 3' end. Many different chemical groups can be used to block the 3' end, such as alkyl groups, non-nucleotide linkers, alkane-diol dideoxynucleotide residues and cordycepin. Other examples of blocking moieties include 3'-deoxynucleotides (e.g., 2', 3'-dideoxynucleotides); 3'-phosphorylated nucleotides; fluorophores, quenchers or other labels that interfere with extension; inverted nucleotides (e.g., connected to the previous nucleotide by a 3' to 3' phosphodiester, optionally with an exposed 5'-OH or phosphate); or proteins or peptides that bind to the oligonucleotide to prevent further extension of the nascent nucleic acid chain by the polymerase. The non-extendable oligonucleotides of the present disclosure may be at least 10 bases in length, and may be up to 15, 20, 25, 30, 35, 40, 50 or more nucleotides in length.Non-extendable oligonucleotides comprising a detectable label may be used as probes.
[0220] In particular, in the claims, reference to "the sequence of SEQ ID NO:X" refers to the base sequence of the corresponding sequence listing entry, and does not require the identity of the backbone (e.g., RNA, 2'-O-Me RNA or DNA) or base modifications (e.g., methylation of cytosine residues), unless the context clearly indicates otherwise.
[0221] "Sample preparation" refers to any step or method of treating a sample for subsequent amplification and / or detection of GBS nucleic acids present in the sample. The sample can be a complex mixture of components, wherein the target nucleic acid is a minority component. Sample preparation can include any known method of concentrating components (such as microorganisms or nucleic acids) from a larger sample volume, such as by filtering airborne or waterborne particles from a larger volume sample or by using standard microbiology to separate microorganisms from a sample. Sample preparation can include physical destruction and / or chemical lysis of cell components to release intracellular components into a substantially aqueous or organic phase, and such as by using filtration, centrifugation or adsorption to remove debris. Sample preparation can include the use of nucleic acid oligonucleotides, which selectively or non-specifically capture target nucleic acids and separate them from other sample components (e.g., as described in U.S. Patent No. 6,110,678 and International Patent Application Publication No. WO 2008 / 016988, each document is incorporated herein by reference).
[0222] "Separation" or "purification" means removing or separating one or more components of a sample from other sample components. Sample components include target nucleic acids, usually in an overall aqueous solution phase, which may also include cell fragments, proteins, carbohydrates, lipids, and other nucleic acids. "Separation" or "purification" does not imply any degree of purification. Typically, separation or purification removes at least 70%, or at least 80%, or at least 95% of the target nucleic acid from other sample components.
[0223] As used herein, the term "non-linear surfactant" means a surfactant having a branched structure. The non-linear surfactant may contain one or more ring structures, which may be, for example, in the main chain and / or one or more branches. Exemplary non-linear surfactants include polysorbate 20, polysorbate 40, polysorbate 60, and digitonin. In some variations, the non-linear surfactant is non-ionic.
[0224] In the context of amplification and / or detection systems, the term "specificity" is used herein to refer to a characteristic of a system that describes its ability to distinguish between target and non-target sequences based on sequence and assay conditions. In the context of nucleic acid amplification, specificity generally refers to the ratio of the number of specific amplicons produced to the number of byproducts (e.g., signal-to-noise ratio). In the context of detection, specificity generally refers to the ratio of the signal generated from a target nucleic acid to the signal generated from a non-target nucleic acid.
[0225] The term "sensitivity" is used herein to refer to the accuracy with which a nucleic acid amplification reaction can be detected or quantified. The sensitivity of an amplification reaction is generally a measure of the minimum number of copies of a target nucleic acid that can be reliably detected in an amplification system, and will depend, for example, on the specificity of the detection assay and amplification reaction employed, such as the ratio of specific amplicon to byproducts. DETAILED DESCRIPTION
[0226] The present invention provides compositions, kits and methods for amplifying and detecting group B streptococcus (GBS; Streptococcus agalactiae) nucleic acids from samples. Preferably, the sample is a biological sample. The compositions, kits and methods provide oligonucleotide sequences that recognize target sequences of the GBS genome, the target sequences including target sequences of GBS serotypes Ia, Ib, Ic, II, III, IV, V, VI, VII, VIII and IX, or their complementary sequences. Such oligonucleotides can be used as amplification oligonucleotides, which can include primers, promoter primers, blocked oligonucleotides and promoter provider oligonucleotides, the functions of which have been previously described (see, e.g., U.S. Patent Nos. 4,683,195; 4,683,202; 4,800,159; 5,399,491; 5,554,516; 5,824,518; and 7,374,885; each of which is incorporated herein by reference). Other oligonucleotides can be used as amplified sequences for detecting GBS, or as probes for capturing GBS target nucleic acids.
[0227] The method provides sensitive and specific detection of GBS nucleic acid. The method includes performing nucleic acid amplification of a GBS target region and detecting the amplified product by, for example, specifically hybridizing the amplified product with a nucleic acid detection probe that provides a signal for indicating the presence of GBS in the sample. The amplification step includes contacting the sample with one or more amplification oligomers that are specific for a target sequence in a GBS target nucleic acid to produce an amplified product when a GBS nucleic acid is present in the sample. Amplification synthesizes additional copies of the target sequence or its complement by using at least one nucleic acid polymerase and an amplification oligomer to produce a copy from a template strand (e.g., by extending the sequence from a primer using a template strand). One embodiment for detecting the amplified product uses a hybridization step, the hybridization step including contacting the amplified product with at least one detection probe oligomer, the at least one detection probe oligomer being specific to a sequence amplified by a selected amplification oligomer (e.g., a sequence contained in the target sequence flanked by a pair of selected amplification oligomers).
[0228] Preferred compositions of the invention are configured to specifically hybridize with all GBS serotypes Ia, Ib, Ic, II, III, IV, V, VI, VII, VIII, and IX, while having minimal cross-reactivity with other non-GBS nucleic acids suspected to be in the sample (e.g., other bacterial pathogens). In certain variations, the compositions of the invention further allow for detection of sequences on non-hemolytic strains of GBS. In some aspects, the compositions of the invention are configured to specifically hybridize with GBS nucleic acids, while having minimal cross-reactivity with one or more non-GBS pathogens listed in any one of Tables 9-11, 15, 16, 20, and 22 (see Examples below). In one aspect, the compositions of the invention are part of a multiplex system that further includes components and methods for detecting one or more of these non-GBS pathogens.
[0229] In certain aspects of the present invention, a composition comprising at least two amplification oligomers is provided for determining the presence or absence of GBS in a sample. Typically, the composition comprises at least two amplification oligomers for amplifying a target region of a GBS target nucleic acid corresponding to a sequence of SEQ ID NO: 1 (SIP gene) or SEQ ID NO: 2 (CFB gene). In such embodiments, at least one amplification oligomer comprises a target hybridization sequence in a sense orientation ("sense THS"), and at least one amplification oligomer comprises a target hybridization sequence in an antisense orientation ("antisense THS"), wherein the sense THS and the antisense THS are each configured to specifically hybridize with a GBS target sequence corresponding to a sequence contained within SEQ ID NO: 1 or SEQ ID NO: 2, and wherein the target hybridization sequence is selected so that the GBS sequence targeted by the antisense THS is located downstream of the GBS sequence targeted by the sense THS (i.e., the positions of the at least two amplification oligomers are such that they flank the amplification target region).
[0230] In some variations, the composition comprises (i) a SIP-specific amplification oligomer comprising a SIP-specific target hybridization sequence substantially corresponding to or identical to the sequence shown in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:8, or a complement thereof, or an RNA equivalent or DNA / RNA chimera thereof. In some variations, the composition comprises (ii) a CFB-specific amplification oligomer comprising a CFB-specific target hybridization sequence having about 17 to about 24 consecutive nucleotides and substantially corresponding to or identical to a sequence contained in the sequence of SEQ ID NO:26, or its complement, or its RNA equivalent, or its DNA / RNA chimera; in some such embodiments, the CFB-specific target hybridization sequence includes a sequence substantially corresponding to or identical to a sequence of SEQ ID NO:28 or SEQ ID NO:27, or its complement, or its RNA equivalent, or its DNA / RNA chimera (e.g., a sequence substantially corresponding to or identical to a sequence shown in SEQ ID NO:12 or SEQ ID NO:14, or its complement, or its RNA equivalent, or its DNA / RNA chimera), or a sequence substantially corresponding to or identical to a sequence shown in SEQ ID NO:18, or its complement, or its RNA equivalent, or its DNA / RNA chimera. In some variations, the composition comprises (iii) a CFB-specific amplification oligomer comprising a CFB-specific target hybridization sequence that substantially corresponds to or is identical to the sequence set forth in SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 20, or SEQ ID NO: 21, or a complement thereof, or an RNA equivalent or DNA / RNA chimera thereof. In variations comprising a SIP-specific or CFB-specific amplification oligomer as described above in (i), (ii), or (iii), the oligomer combination comprises at least one amplification oligomer comprising a SIP-specific or CFB-specific target hybridization sequence having a polarity opposite (sense to antisense, or vice versa) to the target hybridization sequence of the oligomer of (i), (ii), or (iii), such that at least two amplification oligomers flank the target region to be amplified. In certain embodiments, the composition is provided in the form of an aqueous or dry formulation for amplifying GBS nucleic acid, or a reaction mixture comprising or reconstituted from such a formulation.
[0231] In a more specific embodiment of the present invention, a composition for determining the presence or absence of GBS in a sample includes (1) at least one amplification oligomer, the at least one amplification oligomer comprising a SIP-specific or CFB-specific target hybridization region substantially corresponding to at least one sense oligomer sequence depicted in Table 1 below; and (2) at least one amplification oligomer, the at least one amplification oligomer comprising a SIP-specific or CFB-specific target hybridization region substantially corresponding to at least one antisense oligomer sequence depicted in Table 1. In some such embodiments, the composition includes the first SIP-specific amplification oligomer and the first CFB-specific amplification oligomer of (1) above, and the second SIP-specific and second CFB-specific amplification oligomers of (2) above. In a specific variation, one or more sense and / or antisense target hybridization sequences of the amplification oligomer combination comprise or consist of one or more sense and / or antisense sequences selected from Table 1.
[0232] Table 1: Exemplary sense and antisense amplification oligomer target hybridization sequences for amplifying GBS SIP or CFB target regions
[0233]
[0234] 1 The sense / antisense names of these sequences are for exemplary purposes only. Such names do not necessarily limit the sequences to the accompanying names.
[0235] In certain variations, the composition for determining the presence or absence of GBS in a sample as described herein further comprises at least one detection probe oligomer configured to specifically hybridize to a GBS SIP or CFB target sequence that can be amplified using the first and second amplification oligomers (e.g., a SIP or CFB target sequence contained within SEQ ID NO: 1 or SEQ ID NO: 2, or its complement, flanked by the target hybridization sequences of the first and second amplification oligomers). Particularly suitable SIP-specific detection probe oligomers include, for example, oligomers comprising a SIP-specific target hybridization sequence that substantially corresponds to or is identical to the sequence shown in SEQ ID NO: 9 or SEQ ID NO: 11, or its complement, or its RNA equivalent or DNA / RNA chimera. Particularly suitable CFB-specific detection probe oligomers include, for example, oligomers comprising a CFB-specific target hybridization sequence that substantially corresponds to or is identical to the sequence shown in SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, or its complement, or its RNA equivalent or DNA / RNA chimera. The detection probe oligomer may contain a 2'-methoxy backbone at one or more junctions in the nucleic acid backbone. In some variations, the composition comprises at least two detection probe oligomers. In certain embodiments, the detection probe oligomer is provided in the form of an aqueous or dry formulation for detecting GBS nucleic acid or a reaction mixture comprising or reconstituted from such a formulation.
[0236] Typically, the detection probe oligomer according to the present invention further comprises a label. Particularly suitable labels include compounds that emit detectable light signals, such as fluorophores or luminescent (e.g., chemiluminescent) compounds that can be detected in homogeneous mixtures. There may be more than one label and more than one type of label on a particular probe, or detection may rely on the use of a probe mixture, wherein each probe is labeled with a compound that produces a detectable signal (see, e.g., U.S. Patent Nos. 6,180,340 and 6,350,579, each of which is incorporated herein by reference). Labels can be attached to probes by various means (including covalent bonding, chelation, and ionic interactions), but preferably labels are covalently attached. For example, in some embodiments, the detection probe has an attached chemiluminescent label, such as an acridinium ester (AE) compound (see, e.g., U.S. Patent Nos. 5,185,439; 5,639,604; 5,585,481 and 5,656,744; each of which is incorporated herein by reference). Typically a label, such as, for example, a fluorescent or chemiluminescent label, is attached to the probe via a non-nucleotidic linker (see, e.g., U.S. Pat. Nos. 5,585,481; 5,656,744; and 5,639,604, particularly at column 10, line 6 to column 11, line 3, and Example 8; each of which is incorporated herein by reference).
[0237] In some embodiments, the probe (e.g., comprising a fluorescent label) further comprises a second label that interacts with the first label. For example, the second label can be a quencher. Detection probes that simultaneously comprise a fluorescent label and a quencher are particularly useful in fluorescence resonance energy transfer (FRET) assays. Specific variations of such detection probes include, for example, TaqMan TM Detection probes (Roche Molecular Diagnostics) and "molecular beacons" (see, eg, Tyagi et al., Nature Biotechnol. 16:49-53, 1998; US Pat. Nos. 5,118,801 and 5,312,728; each of which is incorporated herein by reference). TaqMan TM The probe (or a similar dual-labeled linear probe comprising both a fluorescent label and a quencher) can be used in an assay in which hybridization of the probe to a target or amplicon followed by nucleic acid degradation by a polymerase comprising 5'-3' exonuclease activity results in release of the fluorescent label and thereby increased fluorescence, or fluorescence that is dissociated from interaction with a second label.
[0238] In some applications, detection probes that exhibit at least some degree of self-complementarity are used to facilitate detection of probe: target duplexes in a test sample without first removing unhybridized probe prior to detection. Specific embodiments of such detection probes include, for example, probes that form a conformation maintained by intramolecular hybridization (such as a conformation commonly referred to as a hairpin). Suitable hairpin probes include "molecular torches" (see, e.g., U.S. Pat. Nos. 6,849,412; 6,835,542; 6,534,274; and 6,361,945) and "molecular beacons" (see, e.g., U.S. Pat. Nos. 5,118,801 and 5,312,728). A molecular torch includes distinct regions of complementarity (referred to as a "target binding domain" and a "target closure domain") that are separated by a junction region (e.g., -(CH 2 CH 2 O) 3 -linker) and hybridize to each other under predetermined hybridization assay conditions. When exposed to an appropriate target or denaturing conditions, the two complementary regions of the molecular torch (which may be fully or partially complementary) melt, thereby making the target binding domain available for hybridization with the target sequence when the predetermined hybridization assay conditions are restored. The molecular torch is designed so that the target binding domain favors hybridization with the target sequence compared to the target closing domain. The target binding domain and target closing domain of the molecular torch include interacting labels (e.g., fluorescent / quenchers) that are positioned so that a different signal is generated when the molecular torch self-hybridizes relative to when the molecular torch hybridizes with the target nucleic acid, thereby allowing detection of probe:target duplexes in the test sample in the presence of unhybridized probes with active labels associated therewith.
[0239] In other embodiments, the detection probe is a linear oligomer that does not substantially form a conformation maintained by an intramolecular bond. In a specific variation, the linear detection probe oligomer comprises a chemiluminescent compound as a label (e.g., an acridinium ester (AE) compound). In other embodiments, the linear detection probe oligomer comprises a fluorophore as a label. In some embodiments of the linear detection probe oligomer comprising a fluorophore, the oligomer further comprises a quenching moiety (e.g., a TaqMan probe).
[0240] Without attempting to distinguish between FRET and non-FRET pairs, examples of interactive donor / acceptor label pairs that can be used in conjunction with the present disclosure include fluorescein / tetramethylrhodamine, IAEDANS / fluororescein, EDANS / DABCYL, coumarin / DABCYL, fluorescein / fluorescein, BODIPY FL / BODIPY FL, fluorescein / DABCYL, lucifer yellow / DABCYL, BODIPY / DABCYL, eosin / DABCYL, erythrosine / DABCYL, tetramethylrhodamine / DABCYL, Texas red / DABCYL, CY5 / BH1, CY5 / BH2, CY3 / BH1, CY3 / BH2, and fluorescein / QSY7 dyes. One of ordinary skill in the art will appreciate that when the donor and acceptor dyes are different, energy transfer can be detected by the appearance of sensitized fluorescence of the acceptor or by quenching donor fluorescence. Non-fluorescent acceptors (such as DABCYL and QSY7 dyes) advantageously eliminate the potential problem of background fluorescence caused by direct (i.e., non-sensitized) acceptor excitation. Exemplary fluorophore moieties that can be used as one member of a donor-acceptor pair include fluorescein, ROX, and CY dyes (such as CY5). Exemplary quencher moieties that can be used as the other member of a donor-acceptor pair include DABCYL and BLACK HOLE QUENCHER moieties, which can be obtained from Biosearch Technologies, Inc. (Novato, California).
[0241] In some embodiments, the labeled oligomer (e.g., detection probe) is non-extendable. For example, the labeled oligomer can be made non-extendable by 3'-phosphorylation, having a 3'-terminal 3'-deoxynucleotide (e.g., a terminal 2', 3'-dideoxynucleotide), having a 3'-terminal inverted nucleotide (e.g., wherein the last nucleotide is inverted so that it is joined to the penultimate nucleotide by a 3' to 3' phosphodiester connection or its analog (e.g., phosphorothioate), or having an attached fluorophore, quencher, or other label that interferes with extension (possibly but not necessarily attached via the 3' position of the terminal nucleotide). In some embodiments, the 3'-terminal nucleotide is not methylated.
[0242] The present invention also provides compositions comprising one or more detection probe oligomers as described herein.
[0243] In some aspects, the present invention provides methods using oligomers or oligomer combinations as described herein. Any method disclosed herein should also be understood as a disclosure of the corresponding use of the materials involved in the method for the purpose of the method. Any oligomer comprising a GBS SIP or CFB target hybridization sequence and any combination (e.g., kits and compositions) comprising such oligomers should be understood to also be disclosed for use in detecting or quantifying GBS, and in preparing compositions for detecting or quantifying GBS.
[0244] Broadly speaking, the method may include one or more of the following components: target capture, in which GBS nucleic acid (e.g., from a sample, such as a clinical sample) is annealed to a capture oligomer; separation, such as washing, to remove material not associated with the capture oligomer; amplification; and amplicon detection (e.g., amplicon quantification), which can be performed in real time with amplification. Certain embodiments relate to each of the foregoing steps. Certain embodiments relate to exponential amplification, optionally with a preceding linear amplification step. Certain embodiments relate to exponential amplification and amplicon detection. Certain embodiments relate to any two components listed above. Certain embodiments relate to any two components listed adjacently above, such as washing and amplification, or amplification and detection.
[0245] In some embodiments, the present invention provides a method for determining the presence or absence of Group B Streptococcus (GBS) in a sample using a combination of oligomers as described herein. This method generally includes (1) contacting the sample with at least two amplification oligomers for amplifying a GBS SIP or CFB nucleic acid target region corresponding to a SIP or CFB target nucleic acid, wherein the at least two amplification oligomers are as described above; (2) performing an in vitro nucleic acid amplification reaction, wherein any GBS SIP or CFB target nucleic acid present in the sample is used as a template to produce an amplification product; and (3) detecting the presence or absence of the amplification product, thereby determining the presence or absence of GBS in the sample. The detection method according to the present invention generally further includes the following steps: obtaining a sample to be contacted with the at least two amplification oligomers. In certain embodiments, "obtaining" a sample to be used in steps (1)-(3) includes, for example, receiving a sample at a test facility or other location where one or more steps of the method are performed, and / or retrieving a sample from a location within a facility where one or more steps of the method are performed (e.g., from a storage or other storage location).
[0246] Amplifying a GBS target sequence utilizes an in vitro amplification reaction using at least two amplification oligomers flanking the target region to be amplified. In specific embodiments, the target region to be amplified is a GBS SIP target region substantially corresponding to from about nucleotide position 56 to about nucleotide position 189 or from about nucleotide position 349 to about nucleotide position 489 of SEQ ID NO:1. Particularly suitable oligomer combinations for amplifying these GBS SIP target regions are described herein. For example, in some embodiments, the amplification oligomer combination for amplifying a SIP target region comprises a first and a second SIP-specific amplification oligomer, wherein the first and second SIP-specific amplification oligomers respectively comprise (A) a first SIP-specific target hybridization sequence that is SEQ ID NO:3 or a sequence substantially corresponding to SEQ ID NO:3, or an RNA equivalent thereof or a DNA / RNA chimera, and (B) a second SIP-specific target hybridization sequence that is SEQ ID NO:4 or a sequence substantially corresponding to SEQ ID NO:4, or an RNA equivalent thereof or a DNA / RNA chimera. In other embodiments, the amplification oligomer combination for amplifying the SIP target region comprises a first and a second SIP-specific amplification oligomer, wherein the first and second SIP-specific amplification oligomers respectively comprise (A) a first SIP-specific target hybridization sequence which is SEQ ID NO:7 or a sequence substantially corresponding to SEQ ID NO:7, or its RNA equivalent or DNA / RNA chimera, and (B) a second SIP-specific target hybridization sequence which is SEQ ID NO:8 or a sequence substantially corresponding to SEQ ID NO:8, or its RNA equivalent or DNA / RNA chimera.
[0247] In other embodiments, the target region to be amplified is a GBS CFB target region that corresponds substantially to from about nucleotide position 38 to about nucleotide position 151, from about nucleotide position 22 to about nucleotide position 151, from about nucleotide position 192 to about nucleotide position 329, or from about nucleotide position 585 to about nucleotide position 716 of SEQ ID NO: 2. Particularly suitable oligomer combinations for amplifying these GBS CFB target regions are described herein. For example, in some embodiments, the amplification oligomer combination for amplifying the CFB target region comprises a first and a second CFB-specific amplification oligomer, wherein the first and the second CFB-specific amplification oligomers respectively comprise (A) a first CFB-specific target hybridization sequence that is about 17 to about 24 consecutive nucleotides and substantially corresponds to or is identical to a sequence contained in a sequence of SEQ ID NO:26, or its RNA equivalent or DNA / RNA chimera, and (B) a second CFB-specific target hybridization sequence that is SEQ ID NO:13 or SEQ ID NO:15 or a sequence substantially corresponding to SEQ ID NO:13 or SEQ ID NO:15, or its RNA equivalent or DNA / RNA chimera; in a more specific variation of this first CFB-specific target hybridization sequence of (A), the CFB-specific target hybridization sequence is selected from (i) a sequence substantially corresponding to or is identical to a sequence of SEQ ID NO:28 or SEQ ID NO:27, or its RNA equivalent or DNA / RNA chimera (e.g., a sequence of SEQ ID NO:12 or SEQ ID NO:14 or a sequence substantially corresponding to SEQ ID NO:12 or SEQ ID NO:15). NO:14, or a sequence substantially corresponding to its RNA equivalent or DNA / RNA chimera), and (ii) a sequence that is SEQ ID NO:18, or a sequence substantially corresponding to SEQ ID NO:18, its RNA equivalent or DNA / RNA chimera. In other embodiments, the amplification oligomer combination for amplifying the CFB target region includes a first and a second CFB-specific amplification oligomer, wherein the first and second CFB-specific amplification oligomers respectively contain (A) a first CFB-specific target hybridization sequence that is SEQ ID NO:16, or a sequence substantially corresponding to SEQ ID NO:16, or an RNA equivalent or DNA / RNA chimera thereof, and (B) a second CFB-specific target hybridization sequence that is SEQ ID NO:17, or a sequence substantially corresponding to SEQ ID NO:17, or an RNA equivalent or DNA / RNA chimera thereof.In other embodiments, the amplification oligomer combination for amplifying the CFB target region includes a first and a second CFB-specific amplification oligomer, and the first and second CFB-specific amplification oligomers respectively contain (A) a first CFB-specific target hybridization sequence that is SEQ ID NO: 18 or a sequence substantially corresponding to SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and (B) a second CFB-specific target hybridization sequence that is SEQ ID NO: 15 or a sequence substantially corresponding to SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera. In other embodiments, the amplification oligomer combination for amplifying the CFB target region includes a first and a second CFB-specific amplification oligomer, and the first and second CFB-specific amplification oligomers respectively contain (A) a first CFB-specific target hybridization sequence that is SEQ ID NO: 20 or a sequence substantially corresponding to SEQ ID NO: 20, or its RNA equivalent or DNA / RNA chimera, and (B) a second CFB-specific target hybridization sequence that is SEQ ID NO: 21 or a sequence substantially corresponding to SEQ ID NO: 21, or its RNA equivalent or DNA / RNA chimera.
[0248] The detection method according to the present disclosure may further include the following steps: obtaining a sample to be subjected to the subsequent steps of the method. In certain embodiments, "obtaining" a sample to be used includes, for example, receiving the sample at a testing facility or other location where one or more steps of the method are performed, and / or retrieving the sample from a location within the facility where one or more steps of the method are performed (e.g., from a storage or other storage location).
[0249] In certain embodiments, the method further comprises purifying the GBS target nucleic acid from other components in the sample, for example, prior to amplification (e.g., prior to the capture step). Such purification may include methods for separating and / or concentrating organisms contained in the sample from other sample components, or removing or degrading non-nucleic acid sample components, such as proteins, carbohydrates, salts, lipids, etc. In some embodiments, the DNA in the sample is degraded, for example, using a DNase, and optionally removing or inactivating the DNase or removing the degraded DNA.
[0250] In certain embodiments, purifying the target nucleic acid comprises capturing the target nucleic acid to separate the target nucleic acid from other sample components specifically or non-specifically. Non-specific target capture methods may involve selectively precipitating nucleic acids from a substantially aqueous mixture; adhering the nucleic acid to a support, washing the support to remove other sample components; or other means of physically separating nucleic acids from a mixture containing GBS nucleic acid and other sample components.
[0251] Target capture typically occurs in a solution phase mixture containing one or more capture probe oligomers that hybridize to a GBS SIP or CFB target sequence under hybridization conditions. For embodiments comprising a capture probe tail, the GBS target: capture probe complex is captured by adjusting the hybridization conditions such that the capture probe tail hybridizes to an immobilized probe. Certain embodiments use a particulate solid support, such as paramagnetic beads.
[0252] Separation can be performed after capture, wherein, for example, the complex on the solid support is separated from other sample components. Separation can be accomplished by any appropriate technique, for example, washing the support associated with the GBS SIP or CFB target sequence one or more times (e.g., twice or three times) to remove other sample components and / or unbound oligomers. In some embodiments using a particulate solid support (such as paramagnetic beads), the particles associated with the GBS target can be suspended in a wash solution and in some embodiments retrieved from the wash solution by utilizing magnetic attraction. In order to limit the number of operational steps, the GBS SIP or CFB target nucleic acid can be amplified by simply mixing the GBS target sequence in the complex on the support with the amplification oligomer and proceeding with the amplification step.
[0253] Exponential amplification of GBS target sequences utilizes an in vitro amplification reaction using at least two amplification oligomers flanking the target region to be amplified. In some embodiments, at least a first and a second oligomer as described herein are provided. In some embodiments, a plurality of oligomer pairs are provided; in some such variations, the plurality of oligomer pairs include oligomer pairs configured to hybridize with at least two GBS target nucleic acids (e.g., at least one oligomer pair is configured to hybridize with a SIP target nucleic acid and at least one oligomer pair is configured to hybridize with a CFB target nucleic acid). The amplification reaction can be cyclic or isothermal. Suitable amplification methods include, for example, replicase-mediated amplification, polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), and transcription-mediated or transcription-associated amplification (TMA).
[0254] Any of a variety of known techniques can be used to perform a detection step to detect signals specifically associated with the amplified target sequence, such as by hybridizing the amplified product with a labeled detection probe and detecting the signal generated by the labeled probe (in some embodiments, including the label released from the probe after hybridization). In some embodiments, as described above, the labeled probe comprises a second part, such as a quencher or other parts that interact with the first label. The detection step can also provide additional information about the amplified sequence (such as all or part of its nucleic acid base sequence). Detection can be performed after the amplification reaction is completed, or it can be performed simultaneously with the amplification target region, such as in real time. In one embodiment, the detection step allows homogeneous detection, for example, detection of hybridization probes without removing unhybridized probes from the mixture (see, for example, U.S. Patent Nos. 5,639,604 and 5,283,174). In some embodiments, nucleic acids are associated with surfaces that cause physical changes (such as detectable electrical changes). The amplified nucleic acid can be detected by concentrating the amplified nucleic acid in or on a matrix and detecting the nucleic acid or a dye associated therewith (e.g., an intercalator such as ethidium bromide or cyber green), or detecting the increase of a dye associated with the nucleic acid in the solution phase. Other detection methods can use a nucleic acid detection probe configured to specifically hybridize with a sequence in the amplified product and detect the presence of a probe: product complex, or by using a probe complex that can amplify a detectable signal associated with the amplified product (e.g., U.S. Patent Nos. 5,424,413, 5,451,503 and 5,849,481; each document is incorporated herein by reference). A probe that is directly or indirectly labeled and specifically associated with the amplified product provides a detectable signal indicating the presence of a target nucleic acid in a sample. In particular, the amplified product will contain a target sequence in a GBS SIP or CFB gene or a target sequence complementary to a sequence in a GBS SIP or CFB gene, and the probe will bind directly or indirectly to a sequence contained in the amplified product to indicate the presence of GBS nucleic acid in the test sample.
[0255] In the embodiment of detecting the product of amplification when the amplification step is close to the end or the end, a linear detection probe can be used to provide a signal indicating the hybridization of the probe with the amplified product. An example of such detection is to use a luminescent label probe hybridized with a target nucleic acid. The luminescent label is then hydrolyzed from the unhybridized probe. Detection is performed using a photometer by chemiluminescence. (See, for example, International Patent Application Publication No. U.S. Patent No. WO 89 / 002476, which is incorporated herein by reference). In other embodiments using real-time detection, the detection probe can be a hairpin probe labeled with a reporter portion, such as a molecular beacon, a molecular torch or a hybridization switch probe (e.g., a double-labeled hairpin probe comprising both a fluorescent label and a quenching portion), and the reporter portion is detected when the probe is combined with the amplified product. In other embodiments for real-time detection, the detection probe is a linear oligomer, such as an oligomer (e.g., TaqMan probe) labeled with a fluorophore and a quenching portion. Such probes can include target hybridization sequences and non-target hybridization sequences. Various forms of such probes have been described previously (see, e.g., U.S. Pat. Nos. 5,210,015, 5,487,972, 5,118,801, 5,312,728, 5,925,517, 6,150,097, 6,849,412, 6,835,542, 6,534,274, and 6,361,945; and U.S. Patent Application Publication Nos. 20060068417A1 and 20060194240A1; each of which is incorporated herein by reference).
[0256] The assay for detecting GBS nucleic acid can optionally include a non-GBS internal control (IC) nucleic acid that is amplified and detected in the same assay reaction mixture using amplification and detection oligos that are specific for the IC sequence. The IC nucleic acid sequence can be, for example, a DNA plasmid, an RNA template sequence (e.g., an in vitro transcript), or a synthetic nucleic acid that is spiked into the sample. Alternatively, the IC nucleic acid sequence can be a cellular component that can be from an exogenous cell source or an endogenous cell source relative to the sample. In these cases, the internal control nucleic acid is co-amplified with the GBS nucleic acid in the amplification reaction mixture. The internal control amplification product and the GBS target sequence amplification product can be detected independently.
[0257] In certain embodiments, amplification and detection of the signal from the amplified IC sequence demonstrates that the assay reagents, conditions, and conduct of the assay steps are appropriate for use in the assay if no signal is obtained for the expected target GBS nucleic acid (e.g., a sample that tests negative for GBS). When quantitative results are desired, the IC may also be used as an internal standard for the assay, i.e., the signal obtained from the IC amplification and detection is used to set the parameters used in the algorithm that quantifies the amount of GBS nucleic acid in the sample based on the signal obtained for the amplified GBS target sequence. The IC may also be used to monitor the integrity of one or more steps in the assay. Primers and probes for the IC target sequence are configured and synthesized using any well-known method, provided that the primers and probes function to amplify the IC target sequence and detect the amplified IC sequence using substantially the same assay conditions as used to amplify and detect the GBS target sequence. In preferred embodiments that include a purification step based on target capture, it is preferred that a target capture probe specific for the IC target be included in the target capture step of the assay so that the IC is treated in the assay in a manner similar to that in all assay steps for the expected GBS analyte.
[0258] The present invention also provides a formulation for determining the presence or absence of GBS in a sample. In some embodiments, the formulation is an aqueous formulation comprising (1) at least two SIP-specific or CFB-specific amplification oligomers as described herein for amplifying a SIP or CFB target region and (2) an organic buffer. The aqueous formulation for amplifying GBS nucleic acid may include one or more additional components, such as, for example, a DNA polymerase, a reverse transcriptase, or a detection probe oligomer. In some embodiments, the formulation is an aqueous formulation comprising (1) a SIP-specific and / or CFB-specific detection probe oligomer as described herein and (2) an organic buffer. The aqueous formulation comprising one or more detection probe oligomers may include one or more additional components, such as, for example, a surfactant, a DNA polymerase, a reverse transcriptase, or at least one amplification oligomer. Particularly suitable surfactants include, for example, polyethylene glycol mono[4-(1,1,3,3-tetramethylbutyl)phenyl]ether and polyoxyethylene sorbitan fatty acid esters (e.g., polysorbate 20, polysorbate 40, or polysorbate 60). In some embodiments, the surfactant in the aqueous detection probe formulation is a non-linear surfactant, such as, for example, polyoxyethylene sorbitan fatty acid esters (e.g., polysorbate 20, polysorbate 40, or polysorbate 60) or digitonin. The aqueous formulation described above for amplifying or detecting GBS nucleic acid may further comprise an extender, such as, for example, trehalose, raffinose, or a combination thereof. In some embodiments, the aqueous formulation described above contains an inorganic salt, such as, for example, magnesium, potassium, or sodium; in some such variations, the concentration of the inorganic salt is 4 mM or less. A particularly suitable organic buffer for the aqueous formulation described above is Tris (2-amino-2-(hydroxymethyl)-1,3-propanediol).
[0259] In a related aspect, for long-term storage, the aqueous formulation as described herein is aliquoted into, for example, vials, ampoules or other containers, and can be dried (e.g., lyophilized) according to procedures known in the art. The dried product is typically presented in the form of a powder or cake. The container is then sealed. Methods for preparing such dried formulations from aqueous formulations and dried formulations prepared by such methods are additional aspects of the present invention. On yet another hand, the present invention provides a dry formulation that can be reconstituted into an aqueous formulation as described herein. In addition to one or more amplification oligomers and / or detection probes as described herein, dry formulations for amplifying or detecting GBS nucleic acids typically also contain an extender, such as trehalose, raffinose or a combination thereof. In some embodiments further comprising an inorganic salt, the percentage of the mass of the inorganic salt relative to the mass of the dry formulation is 0.249% or less, 0.222% or less or 0.195% or less. Methods of preparing dry formulations from lyophilized formulations as described herein are also encompassed by the present invention; such methods generally comprise dissolving the dry formulation in a suitable diluent (eg, an organic buffer or water) to provide a reconstituted formulation.
[0260] The present invention also provides a reaction mixture for determining the presence or absence of a GBS target nucleic acid in a sample. The reaction mixture according to the present disclosure comprises one or both of the following: (1) an oligomer combination for amplifying a GBSSIP and / or CFB target nucleic acid as described herein and (2) one or more detection probe oligomers for determining the presence or absence of a GBS SIP and / or CFB amplification product as described herein. The reaction mixture may further comprise a variety of optional components, such as capture probes, for example, poly-(k) capture probes as described in US2013 / 0209992, which are incorporated herein by reference. For an amplification reaction mixture, the reaction mixture will typically comprise other reagents suitable for in vitro amplification, such as buffers, saline solutions, appropriate nucleotide triphosphates (e.g., dATP, dCTP, dGTP, and dTTP; and / or ATP, CTP, GTP, and UTP) and / or enzymes (e.g., thermostable DNA polymerases or reverse transcriptases and / or RNA polymerases), and will typically comprise test sample components, in which a GBS target nucleic acid may or may not be present. The reaction mixture may contain amplification oligomers for only one target region of the GBS genome, or it may contain amplification oligomers for multiple GBS target regions (e.g., both the SIP target region and the CFB target region). In addition, for reaction mixtures containing detection probes and amplification oligomer combinations, the selection of amplification oligomers and detection probe oligomers for the reaction mixture is linked by a common target region (i.e., the reaction mixture will contain probes that bind to sequences that can be amplified by the amplification oligomer combination of the reaction mixture). In some embodiments, the reaction mixture contains an aqueous formulation as described above. In some embodiments, the reaction mixture is reconstituted from a dry formulation as described above with water or an organic buffer.
[0261] The present invention also provides a kit for implementing the methods described herein. The kit according to the present disclosure comprises one or both of: (1) an oligomer combination for amplifying GBS SIP and / or CFB target nucleic acids as described herein and (2) one or more detection probe oligomers for determining the presence or absence of GBS SIP and / or CFB amplification products as described herein. In some embodiments, any oligomer combination described herein is present in the kit. The kit may further comprise a variety of optional components, such as, for example, a capture probe, for example, a poly-(k) capture probe as described in US2013 / 0209992. Other reagents that may be present in the kit include reagents suitable for in vitro amplification, such as, for example, buffers, saline solutions, appropriate nucleotide triphosphates (e.g., dATP, dCTP, dGTP, dTTP; and / or ATP, CTP, GTP, and UTP) and / or enzymes (e.g., thermostable DNA polymerases or reverse transcriptases and / or RNA polymerases). The oligomers as described herein can be packaged in a variety of different embodiments, and those skilled in the art will appreciate that the present disclosure encompasses many different kit configurations. For example, the kit may contain amplification oligos for only one target region of the GBS genome, or it may include amplification oligos for multiple GBS target regions (e.g., both the SIP target region and the CFB target region). In addition, for kits containing detection probes and amplification oligomer combinations, the selection of amplification oligos and detection probe oligos for the kit are linked by a common target region (i.e., the kit will contain probes that bind to sequences that can be amplified by the amplification oligomer combination of the kit). In certain embodiments, the kit further comprises a set of instructions for practicing the methods according to the present disclosure, wherein the instructions may be associated with a package insert and / or packaging of the kit or its components.
[0262] The present invention is further illustrated by the following non-limiting examples.
[0263] Example 1
[0264] Seventeen primer and probe combinations as shown in Table 2 were evaluated for in vitro Streptococcus agalactiae (GBS) detection.
[0265] Table 2: Primer and probe combinations
[0266]
[0267] Materials and methods. As input material, undefined GBS serotypes from clinical cultures were used. They were extracted in multiple replicates using the MagNAPure 96 system (Roche). After extraction, the concentration of DNA was determined by OD 260 / 280 measurement. PCR was performed on an Applied Biosystems (ABI) 7500 Fast Real-Time The PCR profile used is as follows:
[0268] Table 3: PCR profile
[0269]
[0270] All samples were tested without adding internal controls to the samples. One concentration of GBS target nucleic acid was used (1000 copies / μl in PCR) and tested in quadruplicate. The concentration of primers was fixed at 600 nM and the probe concentration was 200 nM.
[0271] Results. The Ct and number of positive reactions for different primer / probe combinations are shown in Table 4. The reported Ct is the cycle at which the relative fluorescence unit (RFU) signal exceeds the set RFU threshold.
[0272] Table 4
[0273] combination Ct(average) Number of positive 1 24.81 4 / 4 2 / 0 / 4 3 25.66 4 / 4 4 25.69 4 / 4 5 27.51 4 / 4 6 24.72 4 / 4 7 26.79 3 / 4 8 24.96 4 / 4 9 27.62 4 / 4 10 25.25 4 / 4 11 27.60 3 / 4 12 25.50 4 / 4 13 19.92 3 / 4 14 27.65 4 / 4 15 26.03 3 / 4 16 25.62 4 / 4 17 24.95 4 / 4
[0274] For each target gene, two combinations of primers and probes were selected based on this data for further evaluation. For CFB, combinations 12 and 17 showed the lowest Ct with the highest RFU. For SIP, combinations 1 and 3 were selected. These combinations were tested for lower concentrations of GBS target nucleic acid, allowing for better discrimination. The results shown in Table 5 were obtained at 1, 10, and 100 copies / μl in the test PCR.
[0275] Table 5
[0276]
[0277]
[0278] Combinations 1, 3, 12 and 17 were also tested at different primer / probe concentrations (600 / 200 nM, 400 / 150 nM and 300 / 100 nM) for 1 and 10 copies / μl. Table 6 shows the results obtained using these different concentrations.
[0279] Table 6
[0280]
[0281] Conclusion. Based on the results summarized above, primer / probe combinations 3 and 17 (for SIP and CFB target genes, respectively) were selected to further evaluate sensitivity and specificity. These primer combinations were able to detect five (5) theoretical copies at a Ct of 36-37 in each PCR reaction.
[0282] Example 2
[0283] For the detection of the internal control, two primer and probe combinations were evaluated: the SD-PLP / GIC combination and the new GIC combination with the primer and probe sequences shown in Table 7. The first step was to examine which oligonucleotide set and at which concentration gave the best results when using Cy5 as the fluorophore. The second step focused on using 705 dye selection concentration. In the automated PANTHER FUSION system Traditionally, Cy5 dye produces low signals and should be detected using QUASAR705 dye. Because the signal of Cy5 is different from that produced by QUASAR705, the concentrations of primers and probes were re-evaluated.
[0284] Table 7: Internal control primers and probes
[0285] name Sequence (5'-3') SD-PLP-Forward ACAGACAATGGCAGCAATTTCACCAG(SEQ ID NO:29) SD-PLP-Reverse CTCTTCTTTGTCTCTAATTGACC(SEQ ID NO:30) GIC Probe AAACATCGCAAGTGCCACAAGCTT(SEQ ID NO:31) New GIC-3_F TGGTAGCAGTTCATGTAGCCA(SEQ ID NO:32) New GIC-3_R CTGGCCATCTTCCTGCTAAT(SEQ ID NO:33) New GIC-3_P TTCCTGCCCTGTTTCTGCTGGA(SEQ ID NO:34)
[0286] KINGFISHER TM After extraction, initial testing of primers and probes was performed on an ABI 7500 fast real-time PCR system. Three different primer / probe concentrations were used: 600 / 200nM, 400 / 150nM, and 300 / 100nM. In addition, the IC oligonucleotides were tested in combination with the SIP oligonucleotides when GBS targets (serotypes II and IV: strains obtained from CHU de Liège) were present. The second step of the IC test was performed on a BioRad CFX-96qPCR device capable of detecting both Cy5 and QUASAR705. Initially, the QUASAR705 combination was tested in comparison with the Cy5 combination to determine the final concentrations of primers and probes.
[0287] Data from initial testing showed that the new GIC combination provided a higher signal compared to the SD-PLP / GIC combination. The new GIC combination (300 / 100nM) was further tested in the presence of SIP primers (600 / 200nM) and different GBS types (10^6, 10^5, 10^4 dilutions of serotypes II and IV). Data from this test showed that the presence of IC primers and probes had no significant effect on GBS detection. Likewise, the IC signal was not affected by the presence of higher concentrations of GBS. Based on the data, a combination of the SIP combination (FAM) at 600 / 200nM and the IC new GIC combination (Cy5) at 300 / 100nM was selected.
[0288] Comparison between Cy5 and QUSAR705 dyes was performed on a BioRad CFX-96. The data showed good agreement between the two conditions. The new-GIC QUASAR705 combination at 400 / 150 nM was used for further testing on GBS strains.
[0289] In the following experiments, SIP (600 / 200 nM) and new GIC (400 / 150 nM) oligonucleotides were tested on serial dilutions of different GBS serotypes (clinical cultures collected at Liège University Hospital Center, Sart-Tilman University Area, building B 35, B-4000 Liège, Belgium). Table 8 below reports the ct values for both the SIP target and the new GIC target and shows an overall low standard deviation between different serotypes and different dilutions.
[0290] Table 8
[0291]
[0292]
[0293] Example 3
[0294] This example describes the evaluation of the specificity and sensitivity of primer / probe combination 3 targeting the GBS SIP gene.
[0295] At KINGFISHER TM After extraction in the system, different samples were tested using the SIP + New GIC (Cy5) mix on an ABI 7500 Fast Real-Time PCR System. The PCR profile shown in Table 3 above was used.
[0296] For specificity, the cross-reactivity of the strains shown in Table 9 was evaluated.
[0297] Table 9
[0298]
[0299]
[0300]
[0301] For inclusion, the GBS serotypes shown in Table 10 were tested.
[0302] Table 10
[0303]
[0304]
[0305] All GBS serotypes to be detected were initially tested at a given stock concentration. Thereafter, strains were also tested at lower concentrations (down to 100 CFU / mL).
[0306] Table 11 below shows the specificity data obtained on the ABI 7500FAST system. All bacteria tested showed no interaction with the SIP primers and probe. The effectiveness of the PCR was evaluated by a positive control that provided a positive signal.
[0307] Table 11
[0308]
[0309] The initial set tested at high concentrations on the ABI 7500 FAST system gave the results shown in Table 12.
[0310] Table 12
[0311]
[0312]
[0313] Table 13 below shows the data obtained when GBS strains were tested at lower concentrations (100 CFU / ml in the sample).
[0314] Table 13
[0315] Serotype concentration Mean Ct + / - standard deviation Serotype Ia 100 CFU / ml in sample 38.6+ / -1.9 Serotype Ib 100 CFU / ml in sample 38.1+ / -1.4 Serotype Ic 100 CFU / ml in sample 37.7+ / -0.4 Serotype III 100 CFU / ml in sample 37.9+ / -0.6 Serotype IV 100 CFU / ml in sample 38.1+ / -1.6
[0316] These serotypes (Ia, Ib, Ic, III, IV) are further used to test PCR efficiency. For this reason, the serial dilutions of these serotypes (ranging from 10^6CFU / ml to 10^1CFU / ml) are prepared and extracted on MagNAPure 96 system (Roche), and PCR is performed on ABI 7500 fast system. Data show that the expected slope is about -3.3 between different serotypes, and the efficiency is between 92% and 98%. Further, data confirm that all serotypes are detected at 100CFU / ml in the sample.
[0317] Example 4
[0318] This example describes the automatic PANTHER Systematic evaluation of the specificity of primer / probe combination 3 targeting the GBSSIP gene.
[0319] To evaluate specificity, the GBS strains shown in Table 15 below were tested directly on the PANTHER FUSION system without the addition of additional STM or Lim broth. The cassette used contained the SIP oligonucleotide and the Cy5 oligonucleotide for IC detection.
[0320] Table 15
[0321]
[0322]
[0323] All GBS serotypes (53 to 58) were detected in the FAM channel, while other strains (59-66) were negative and only provided IC signals in the RED647 channel. This confirmed the specificity of the SIP oligonucleotides for the tested strains.
[0324] Additionally, other potential cross-reactive bacteria and the remaining GBS serotypes as shown in Table 16 were also tested using the same cassette (SIP+IC(Cy5)) and tested on the PANTHER FUSION system.
[0325] Table 16
[0326]
[0327]
[0328] Strains 38 to 43 returned positive signals in the FAM channel, while the other strains returned IC signals only in the RED channel.
[0329] Example 5
[0330] The performance of primer / probe combination 3 targeting only the GBS SIP gene was compared to the performance of primer / probe combinations 3 and 17 targeting both the SIP and CFB genes, respectively (as a multiplexed reaction). TM After extraction in the system, different concentrations of GBS primers / probes were tested on GBS strains spiked in sample transport medium (STM) at 3000 CFU / PCR using the ABI 7500 Fast Real-Time PCR System. Nucleic acid isolation, amplification, and detection reactions were generally performed as described above. No significant difference in Ct values was observed between the SIP primer / probe set alone and the SIP / CFB primer / probe set, while higher endpoint fluorescence levels were found using the multiplexed SIP / CFB primer / probe set relative to the SIP primer / probe set alone.
[0331] Example 6
[0332] A pilot study was conducted to use probit analysis ( 17 software) to determine the limit of detection (LoD) of multiplexed SIP / CFB primer / probe combinations 3 and 17 against GBS serotype III (from ATCC).
[0333] Starting from a previous GBS culture (stock in specimen transport medium (STM)), GBS strain serotype III was serially diluted in Lis broth at the following eight concentrations (based on plating): 20,000.0, 10,000.0, 5,000.0, 2,500.0, 1,250.0, 625.0, 312.5, and 156.3 CFU / mL.
[0334] The eight dilutions were added to the corresponding sample tubes as follows: 250.0 μL of sample was added to 750.0 μL of transfer solution (the transfer solution was a mixture of STM + target capture oligonucleotide (TCO) at 1667 pmol / 750 μL STM). Since a final 1:4 dilution occurred in the sample tubes, the final concentrations were 5,000.0, 2,500.0, 1,250.0, 625.0, 312.5, 156.3, 78.1, and 39.1 CFU / mL.
[0335] Each dilution was tested in 20 extraction replicates and one PCR replicate in PANTHER Positive controls (mixture of GBS SIP and CFB plasmids at 141 and 78 1 c / μL in STM) and negative controls (Lim broth) were also tested in one or two extraction replicates and one PCR replicate, respectively.
[0336] use 17 software, and a probit analysis was performed based on the concentrations tested, the number of positive calls obtained for each concentration, and the number of trials.
[0337] Three distribution modes (lognormal, Weibull and loglogistic) were compared and the one that gave the best P value, i.e., the regression table was close to 0.000 and the goodness of fit test was closest to 1.000, was selected as summarized in Table 17 below. Based on this table, the LoD was determined using the Weibull distribution mode.
[0338] Table 17
[0339]
[0340] The results obtained on the PANTHER FUSION system are summarized below in Table 18. The last dilution was eliminated from the statistical analysis.
[0341] Table 18
[0342]
[0343] Discovery of the LoD for GBS serotype III 95% It was 1,294 CFU / mL in LB, ie, 324 CFU / mL in the test sample.
[0344] Example 7
[0345] The sensitivity and inclusiveness of the assay using SIP primer / probe combination 3 multiplexed with CFB primer / probe combination 17 were evaluated for GBS serotypes Ia, Ib, Ic, II, III, IV, V, VI, VII, VIII, and IX by testing serial dilutions of cell lysates in Lim broth-negative clinical matrices. In addition, a non-hemolytic (NH) strain was evaluated. Probit regression analysis was used to determine the PANTHER The GBS assay has a 95% detection limit for each serotype, and the predicted detection limit was confirmed for 12 GBS serotypes. Cross-reactivity and interference of microorganisms were evaluated using 45 bacterial or fungal species in the presence and absence of GBS serotype III at 3 times the LoD. A method comparison study was conducted, testing Lim broth enriched samples (n=255) collected from antenatal women receiving standard care GBS culture screening from two different hospitals. For the PANTHER FUSION GBS assay, sensitivity and specificity relative to culture were determined. Samples with inconsistent results were tested using the BDMaxGBS assay. All tests were performed on the PANTHER FUSION system.
[0346] Sensitivity and inclusiveness of the analysis. A detection panel was created by spiking a lysate stock solution with a known CFU / mL concentration into a Lim broth enrichment matrix. Three PANTHER FUSION systems were used to test each detection panel in 30 replicates with each of three assay reagent batches. The 50% and 95% predicted LoDs (shown in Table 19 below) for each strain and reagent batch were estimated by probability unit analysis. The LoD is reported in Table 19 as CFU / mL in a Lim broth sample (counter-calculated from the CFU / mL in the PANTHER FUSION test sample, which was a 1:4 dilution in a sample transport medium (STM)). Confirmation testing of the predicted detection limit was performed, and ≥95% positive was observed for all serotypes.
[0347] Table 19
[0348]
[0349] Microbial Cross-Reactivity and Interference. The bacterial and fungal species shown in Table 20 below were introduced into negative Lim broth matrix at a concentration of 1e6 CFU / mL in the test sample. The test panels were tested with and without GBS serotype III at 3 times the estimated LoD. Each test panel was tested in triplicate with one assay reagent lot. No cross-reactivity was observed in the test panels without the GBS target. No interference was observed in the test panels containing the GBS target.
[0350] Table 20: Organisms tested
[0351] Acinetobacter lwoffii Proteus vulgaris Actinomyces ilmanii Pseudomonas aeruginosa Alcaligenes faecalis Staphylococcus aureus Bifidobacterium adolescentis Staphylococcus epidermidis Campylobacter jejuni Streptococcus pyogenes Candida albicans Streptococcus anginosus Clostridium difficile Streptococcus bovis Corynebacterium genitalium Streptococcus garrisonii Cryptococcus neoformans Streptococcus mitis Enterobacter cloacae Streptococcus mutans Enterococcus faecalis Oral Streptococcus Escherichia coli Streptococcus parasanguinis Fusobacterium necleatum Streptococcus pneumoniae Gardnerella vaginalis Streptococcus oligoacidioides Haemophilus ducreyi Streptococcus canis Klebsiella pneumoniae Streptococcus hamsteris Lactobacillus acidophilus Streptococcus crista Lactobacillus crispatus Streptococcus pubescens Listeria monocytogenes Streptococcus dysagalactiae Neisseria gonorrhoeae Streptococcus equi Peptostreptococcus Streptococcus ratus Prevolella bivia Streptococcus costellatus Propionibacterium acnes
[0352] Comparison of methods. A total of 255 vaginal rectal swabs were collected from prenatal women according to CDC recommended guidelines. Each sample was enriched in Lim broth medium at 35°C-37°C for 18 to 24 hours. Each sample was evaluated using a reference culture and tested in the PANTHER FUSION GBS assay. Clinical sensitivity and specificity were determined based on the reference culture results. The results are summarized in Table 21 below. The sensitivity and specificity of the PANTHER FUSION GBS assay were 100% and 98.6%, respectively. There were three culture-negative PANTHER FUSION GBS assay-positive samples, and repeated PANTHERFUSION GBS assay tests of all of the samples produced positive results. A second molecular test method, the BDMax GBS assay, was used to analyze the inconsistent samples, and GBS was detected in all three samples.
[0353] Table 21
[0354]
[0355]
[0356] Conclusion. Preliminary analytical studies demonstrated that the assay has consistent detection of GBS among the serotypes evaluated, and comparison with culture methods showed that the test has high sensitivity and specificity.
[0357] Example 8
[0358] This example describes the automated PANTHER Evaluation of the specificity of the assay using SIP primer / probe combination 3 multiplexed with CFB primer / probe combination 17 on the BIOMED system.
[0359] A 124-organism test panel was selected that represented microorganisms commonly found in the vaginal / anal flora or belonged to the same family / genus as the GBS selected for assay-specific testing, consisting of 104 bacterial, 12 viral, 4 yeast / fungal, and 4 protozoan / parasite strains. The assay-specific test panels are detailed in Table 22. Of the 124 selected organisms, 14 were unavailable for testing at the time of the study. Potential cross-reactivity with GBS assay primers and probes for these 14 unavailable organisms was assessed by BLAST analysis, where no alignments were identified.
[0360] Assay specificity was assessed using the following two methods:
[0361] (1) Cross-reactivity (exclusivity): testing whether these organisms cross-react with GBS assay primers and probes and induce false-positive results in confirmed GBS-negative samples;
[0362] (2) Microbial interference: testing whether these organisms would interfere with normal GBS detection in GBS-positive samples at concentrations near the LoD.
[0363] A pool of five (5) microorganisms was prepared at high concentration (minimum 10 for bacteria and yeast) 6 CFU / mL and for viruses or equivalent minimum 10 5 PFU / mL) were diluted in sample transport medium (STM). The pool composition is detailed in Table 22. For cross-reactivity (exclusivity) evaluation, these microbial pools were added to clinical negative Lim broth base samples (GBS negative samples). For microbial interference evaluation, these microbial pools were added to clinical negative Lim broth base samples (GBS positive samples) spiked with GBS serotype III at 3 times the LoD.
[0364] For each microbial pool to be evaluated, the PANTHER FUSION GBS assay was tested on three replicates of GBS-positive and GBS-negative samples and the data reported.
[0365] Acceptance criteria:
[0366] (1) Three replicates of clinically negative Lim broth-based samples (GBS-negative samples) must be reported as negative for one or more microorganisms (pool) considered non-cross-reactive;
[0367] (2) For one or more microorganisms (pools) that are considered non-interfering, GBS
[0368] Three replicates of serotype III positive samples (GBS positive samples) must be reported as positive.
[0369] Table 22: Analytical Specificity Panel
[0370]
[0371]
[0372]
[0373]
[0374] Results. The run was effective, and an internal control (IC) was detected in each reaction, resulting in a 0% invalid run rate and a 0% IC inefficiency, respectively. All GBS-negative samples tested for cross-reactivity evaluation using GBS primers and probes on the PANTHER FUSION system gave negative, effective results, while all GBS-positive samples tested for microbial interference evaluation using the PANTHER FUSION GBS assay gave GBS-positive results. The results are reported in Table 23 below.
[0375] Table 23: Assay-specific results
[0376]
[0377]
[0378] sequence
[0379] Table 24: Exemplary oligo sequences, reference sequences and regions
[0380]
[0381]
[0382]
[0383] It will be understood from the above that although specific embodiments of the present invention have been described herein for illustrative purposes, various modifications may be made without departing from the spirit and scope of the present invention. Therefore, the present invention is not limited except as set forth in the appended claims. All publications, patents and patent applications cited herein are hereby incorporated herein by reference in their entirety for all purposes.
[0384] The present disclosure relates to the following embodiments:
[0385] 1. A composition for determining the presence or absence of Group B Streptococcus (GBS) in a sample, the composition comprising:
[0386] (I) at least one of a first amplification oligomer combination and a second amplification oligomer combination, wherein
[0387] The first amplification oligomer combination comprises first and second SIP-specific amplification oligomers capable of amplifying a target region of a GBS SIP target nucleic acid, wherein the first and second SIP-specific amplification oligomers respectively comprise first (A) and second (B) SIP-specific target hybridization sequences selected from the group consisting of:
[0388] (a)(A) SEQ ID NO:3, or its RNA equivalent or DNA / RNA chimera, and
[0389] (B) SEQ ID NO:4, or its RNA equivalent or DNA / RNA chimera; and
[0390] (b) (A) SEQ ID NO:7, or its RNA equivalent or DNA / RNA chimera, and
[0391] (B) SEQ ID NO: 8, or its RNA equivalent or DNA / RNA chimera; and
[0392] (II) the second amplification oligomer combination comprises first and second CFB-specific amplification oligomers capable of amplifying a target region of a GBS CFB target nucleic acid, wherein the first and second CFB-specific amplification oligomers respectively comprise a first (A') and a second (B') CFB-specific target hybridization sequence selected from the following:
[0393] (a)(A') is a sequence of about 17 to about 24 consecutive nucleotides contained in the sequence of SEQ ID NO: 26, or its RNA equivalent or DNA / RNA chimera, and
[0394] (B') SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0395] (b) (A') SEQ ID NO: 16, or its RNA equivalent or DNA / RNA chimera, and
[0396] (B') SEQ ID NO: 17, or its RNA equivalent or DNA / RNA chimera;
[0397] (c) (A') SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0398] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0399] (d) (A') SEQ ID NO:20, or its RNA equivalent or DNA / RNA chimera, and
[0400] (B') SEQ ID NO:21, or its RNA equivalent or DNA / RNA chimera.
[0401] 2. The composition according to item 1, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I)(a).
[0402] 3. A composition according to item 1, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I)(b).
[0403] 4. A composition according to any one of items 1-3, wherein if the composition comprises the first amplification oligomer combination, the composition further comprises a SIP-specific detection probe oligomer, the SIP-specific detection probe oligomer comprising a SIP-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained in a SIP amplicon that can be amplified by the first and second SIP-specific amplification oligomers.
[0404] 5. A composition according to item 4, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I)(a), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 9, or its RNA equivalent or DNA / RNA chimera.
[0405] 6. A composition according to item 4, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I)(b), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 11, or its RNA equivalent or DNA / RNA chimera.
[0406] 7. The composition according to any one of items 4 to 6, wherein the SIP-specific detection probe oligomer further comprises a detectable label.
[0407] 8. A composition according to item 7, wherein the detectable label is a fluorescent or chemiluminescent label.
[0408] 9. The composition according to item 7, wherein the detectable label is a fluorescent label, and the SIP-specific detection probe oligomer further comprises a non-fluorescent quencher.
[0409] 10. The composition according to any one of items 1-9, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(b).
[0410] 11. A composition according to any one of items 1-9, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(d).
[0411] 12. The composition according to any one of items 1-9, wherein the CFB-specific target hybridization sequence is the target hybridization sequence of (II)(a).
[0412] 13. A composition according to item 12, wherein the first CFB-specific target hybridization sequence of (II)(a) comprises at least the sequence of SEQ ID NO: 28, or its RNA equivalent or DNA / RNA chimera.
[0413] 14. A composition according to item 13, wherein the first CFB-specific target hybridization sequence of (II)(a) is contained in the sequence of SEQ ID NO: 27, or its RNA equivalent or DNA / RNA chimera.
[0414] 15. A composition according to item 14, wherein the first CFB-specific target hybridization sequence of (II)(a) is SEQ ID NO: 12 or SEQ ID NO: 14, or an RNA equivalent or DNA / RNA chimera thereof.
[0415] 16. A composition according to item 12, wherein the first CFB-specific target hybridization sequence of (II)(a) is SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera.
[0416] 17. A composition according to item 12, wherein the first (A') and second (B') CFB-specific target hybridization sequences of (II)(a) are selected from
[0417] (i) (A') SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0418] (B') SEQ ID NO: 13, or its RNA equivalent or DNA / RNA chimera;
[0419] (ii) (A') SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0420] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera;
[0421] (iii) (A') SEQ ID NO: 14, or its RNA equivalent or DNA / RNA chimera, and
[0422] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0423] (iv) (A') SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0424] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera.
[0425] 18. A composition according to any one of items 1-9, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(c).
[0426] 19. A composition according to any one of items 1-18, wherein if the composition comprises the second amplification oligomer combination, the composition further comprises a CFB-specific detection probe oligomer, wherein the CFB-specific detection probe oligomer comprises a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and being configured to hybridize to a target sequence contained in a CFB amplicon that can be amplified by the first and second CFB-specific amplification oligomers.
[0427] 20. A composition according to item 19, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(b), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 24, or its RNA equivalent or DNA / RNA chimera.
[0428] 21. A composition according to item 19, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(d), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 25, or its RNA equivalent or DNA / RNA chimera.
[0429] 22. A composition according to item 19, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(a), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:22 or SEQ ID NO:23, or its RNA equivalent or DNA / RNA chimera.
[0430] 23. A composition according to item 19, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(c), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 23, or its RNA equivalent or DNA / RNA chimera.
[0431] 24. A composition according to any one of items 19-23, wherein the CFB-specific detection probe oligomer further comprises a detectable label.
[0432] 25. A composition according to item 24, wherein the detectable label is a fluorescent or chemiluminescent label.
[0433] 26. A composition according to item 24, wherein the detectable label is a fluorescent label and the detection probe oligomer further comprises a non-fluorescent quencher.
[0434] 27. A composition according to any one of items 1-26, wherein the composition comprises both the first and second amplification oligomer combinations.
[0435] 28. A composition for determining the presence or absence of Group B Streptococcus (GBS) in a sample, the composition comprising:
[0436] An amplification oligomer combination comprising first and second SIP-specific amplification oligomers capable of amplifying a target region of a GBS SIP target nucleic acid, wherein the first and second SIP-specific amplification oligomers respectively comprise a first (A) and a second (B) SIP-specific target hybridization sequence selected from the group consisting of:
[0437] (a)(A) SEQ ID NO:3, or its RNA equivalent or DNA / RNA chimera, and
[0438] (B) SEQ ID NO:4, or its RNA equivalent or DNA / RNA chimera; and
[0439] (b) (A) SEQ ID NO:7, or its RNA equivalent or DNA / RNA chimera, and
[0440] (B) SEQ ID NO: 8, or its RNA equivalent or DNA / RNA chimera.
[0441] 29. A composition according to item 28, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (a).
[0442] 30. The composition of item 28, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (b).
[0443] 31. A composition according to any one of items 28-30, wherein the composition further comprises a SIP-specific detection probe oligomer, wherein the SIP-specific detection probe oligomer comprises a SIP-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained in a SIP amplicon that can be amplified by the first and second SIP-specific amplification oligomers.
[0444] 32. A composition according to item 31, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (a), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 9, or its RNA equivalent or DNA / RNA chimera.
[0445] 33. A composition according to item 32, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (b), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 11, or its RNA equivalent or DNA / RNA chimera.
[0446] 34. A composition according to any one of items 31-33, wherein the detection probe oligomer further comprises a detectable label.
[0447] 35. A composition according to item 34, wherein the detectable label is a fluorescent or chemiluminescent label.
[0448] 36. A composition according to item 34, wherein the detectable label is a fluorescent label and the detection probe oligomer further comprises a non-fluorescent quencher.
[0449] 37. The composition of any one of items 28-36, further comprising a second amplification oligomer combination capable of amplifying a target region of a GBS CFB target nucleic acid.
[0450] 38. A composition for determining the presence or absence of Group B Streptococcus (GBS) in a sample, the composition comprising:
[0451] An amplification oligomer combination comprising first and second CFB-specific amplification oligomers capable of amplifying a target region of a GBS CFB target nucleic acid, wherein the first and second CFB-specific amplification oligomers respectively comprise a first (A) and a second (B) CFB-specific target hybridization sequence selected from the group consisting of:
[0452] (a)(A) a sequence of about 17 to about 24 consecutive nucleotides contained in the sequence of SEQ ID NO: 26, or its RNA equivalent or DNA / RNA chimera, and
[0453] (B) SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0454] (b) (A) SEQ ID NO: 16, or its RNA equivalent or DNA / RNA chimera, and
[0455] (B) SEQ ID NO: 17, or its RNA equivalent or DNA / RNA chimera;
[0456] (c) (A) SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0457] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0458] (d) (A) SEQ ID NO: 20, or its RNA equivalent or DNA / RNA chimera, and
[0459] (B) SEQ ID NO: 21, or its RNA equivalent or DNA / RNA chimera.
[0460] 39. A composition according to item 38, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (b).
[0461] 40. A composition according to item 38, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (d).
[0462] 41. A composition according to item 38, wherein the CFB-specific target hybridization sequence is the target hybridization sequence of (a).
[0463] 42. A composition according to item 41, wherein the first CFB-specific target hybridization sequence of (a) comprises at least the sequence of SEQ ID NO: 28, or its RNA equivalent or DNA / RNA chimera.
[0464] 43. A composition according to item 42, wherein the first CFB-specific target hybridization sequence of (a) is contained in the sequence of SEQ ID NO: 27, or its RNA equivalent or DNA / RNA chimera.
[0465] 44. A composition according to item 43, wherein the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 12 or SEQ ID NO: 14, or an RNA equivalent or DNA / RNA chimera thereof.
[0466] 45. A composition according to item 41, wherein the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera.
[0467] 46. A composition according to item 41, wherein the first (A) and second (B) CFB-specific target hybridization sequences of (a) are selected from
[0468] (i) (A) SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0469] (B) SEQ ID NO: 13, or its RNA equivalent or DNA / RNA chimera;
[0470] (ii) (A) SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0471] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera;
[0472] (iii) (A) SEQ ID NO: 14, or its RNA equivalent or DNA / RNA chimera, and
[0473] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0474] (iv) (A) SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0475] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera.
[0476] 47. A composition according to item 38, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (c).
[0477] 48. A composition according to any one of items 38-47, wherein the composition further comprises a CFB-specific detection probe oligomer, wherein the CFB-specific detection probe oligomer comprises a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained in a CFB amplicon that can be amplified by the first and second CFB-specific amplification oligomers.
[0478] 49. A composition according to item 48, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (b), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 24, or its RNA equivalent or DNA / RNA chimera.
[0479] 50. A composition according to item 48, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (d), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 25, or its RNA equivalent or DNA / RNA chimera.
[0480] 51. A composition according to item 48, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (a), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:22 or SEQ ID NO:23, or its RNA equivalent or DNA / RNA chimera.
[0481] 52. A composition according to item 48, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (c), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 23, or its RNA equivalent or DNA / RNA chimera.
[0482] 53. A composition according to any one of items 48-52, wherein the detection probe oligomer further comprises a detectable label.
[0483] 54. A composition according to item 53, wherein the detectable label is a fluorescent or chemiluminescent label.
[0484] 55. A composition according to item 53, wherein the detectable label is a fluorescent label and the detection probe oligomer further comprises a non-fluorescent quencher.
[0485] 56. A composition according to any one of items 38-55, further comprising a second amplification oligomer combination capable of amplifying a target region of a GBSSIP target nucleic acid.
[0486] 57. A kit for determining the presence or absence of Group B Streptococcus (GBS) in a sample, the kit comprising:
[0487] (I) at least one of a first amplification oligomer combination and a second amplification oligomer combination, wherein
[0488] The first amplification oligomer combination comprises first and second SIP-specific amplification oligomers capable of amplifying a target region of a GBS SIP target nucleic acid, wherein the first and second SIP-specific amplification oligomers respectively comprise first (A) and second (B) SIP-specific target hybridization sequences selected from the group consisting of:
[0489] (a)(A) SEQ ID NO:3, or its RNA equivalent or DNA / RNA chimera, and
[0490] (B) SEQ ID NO:4, or its RNA equivalent or DNA / RNA chimera; and
[0491] (b) (A) SEQ ID NO:7, or its RNA equivalent or DNA / RNA chimera, and
[0492] (B) SEQ ID NO: 8, or its RNA equivalent or DNA / RNA chimera;
[0493] and
[0494] (II) the second amplification oligomer combination comprises first and second CFB-specific amplification oligomers capable of amplifying a target region of a GBS CFB target nucleic acid, wherein the first and second CFB-specific amplification oligomers respectively comprise a first (A') and a second (B') CFB-specific target hybridization sequence selected from the following:
[0495] (a)(A') is a sequence of about 17 to about 24 consecutive nucleotides contained in the sequence of SEQ ID NO: 26, or its RNA equivalent or DNA / RNA chimera, and
[0496] (B') SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0497] (b) (A') SEQ ID NO: 16, or its RNA equivalent or DNA / RNA chimera, and
[0498] (B') SEQ ID NO: 17, or its RNA equivalent or DNA / RNA chimera;
[0499] (c) (A') SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0500] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0501] (d) (A') SEQ ID NO:20, or its RNA equivalent or DNA / RNA chimera, and
[0502] (B') SEQ ID NO:21, or its RNA equivalent or DNA / RNA chimera.
[0503] 58. A kit according to item 57, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I)(a).
[0504] 59. A kit according to item 57, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I)(b).
[0505] 60. A kit according to any one of items 57-59, wherein if the kit comprises the first amplification oligomer combination, the kit further comprises a SIP-specific detection probe oligomer, wherein the SIP-specific detection probe oligomer comprises a SIP-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and being configured to hybridize to a target sequence contained in a SIP amplicon that can be amplified by the first and second SIP-specific amplification oligomers.
[0506] 61. A kit according to item 60, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I)(a), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 9, or its RNA equivalent or DNA / RNA chimera.
[0507] 62. A kit according to item 60, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I)(b), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 11, or its RNA equivalent or DNA / RNA chimera.
[0508] 63. A kit according to any one of items 60-62, wherein the SIP-specific detection probe oligomer further comprises a detectable label.
[0509] 64. A kit according to item 63, wherein the detectable label is a fluorescent or chemiluminescent label.
[0510] 65. A kit according to item 63, wherein the detectable label is a fluorescent label and the SIP-specific detection probe oligomer further comprises a non-fluorescent quencher.
[0511] 66. A kit according to any one of items 57-65, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(b).
[0512] 67. A kit according to any one of items 57-65, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(d).
[0513] 68. A kit according to any one of items 57-65, wherein the CFB-specific target hybridization sequence is the target hybridization sequence of (II)(a).
[0514] 69. A kit according to item 68, wherein the first CFB-specific target hybridization sequence of (II)(a) comprises at least the sequence of SEQ ID NO: 28, or its RNA equivalent or DNA / RNA chimera.
[0515] 70. A kit according to item 69, wherein the first CFB-specific target hybridization sequence of (II)(a) is contained in the sequence of SEQ ID NO: 27, or its RNA equivalent or DNA / RNA chimera.
[0516] 71. A kit according to item 70, wherein the first CFB-specific target hybridization sequence of (II)(a) is SEQ ID NO: 12 or SEQ ID NO: 14, or an RNA equivalent or DNA / RNA chimera thereof.
[0517] 72. A kit according to item 68, wherein the first CFB-specific target hybridization sequence of (II)(a) is SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera.
[0518] 73. A kit according to item 68, wherein the first (A') and second (B') CFB-specific target hybridization sequences of (II)(a) are selected from
[0519] (i) (A') SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0520] (B') SEQ ID NO: 13, or its RNA equivalent or DNA / RNA chimera;
[0521] (ii) (A') SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0522] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera;
[0523] (iii) (A') SEQ ID NO: 14, or its RNA equivalent or DNA / RNA chimera, and
[0524] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0525] (iv) (A') SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0526] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera.
[0527] 74. A kit according to any one of items 57-65, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(c).
[0528] 75. A kit according to any one of items 57-74, wherein if the kit comprises the second amplification oligomer combination, the kit further comprises a CFB-specific detection probe oligomer, wherein the CFB-specific detection probe oligomer comprises a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and being configured to hybridize to a target sequence contained in a CFB amplicon that can be amplified by the first and second CFB-specific amplification oligomers.
[0529] 76. A kit according to item 75, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(b), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:24, or its RNA equivalent or DNA / RNA chimera.
[0530] 77. A kit according to item 75, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(d), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:25, or its RNA equivalent or DNA / RNA chimera.
[0531] 78. A kit according to claim 75, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(a), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:22 or SEQ IDNO:23, or its RNA equivalent or DNA / RNA chimera.
[0532] 79. A kit according to item 75, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(c), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:23, or its RNA equivalent or DNA / RNA chimera.
[0533] 80. A kit according to any one of items 75-79, wherein the CFB-specific detection probe oligomer further comprises a detectable label.
[0534] 81. A kit according to item 80, wherein the detectable label is a fluorescent or chemiluminescent label.
[0535] 82. A kit according to item 80, wherein the detectable label is a fluorescent label and the detection probe oligomer further comprises a non-fluorescent quencher.
[0536] 83. A kit according to any one of items 57-82, wherein the kit comprises both the first and second amplification oligomer combinations.
[0537] 84. A kit for determining the presence or absence of Group B Streptococcus (GBS) in a sample, the kit comprising:
[0538] An amplification oligomer combination comprising first and second SIP-specific amplification oligomers capable of amplifying a target region of a GBS SIP target nucleic acid, wherein the first and second SIP-specific amplification oligomers respectively comprise a first (A) and a second (B) SIP-specific target hybridization sequence selected from the group consisting of:
[0539] (a)(A) SEQ ID NO:3, or its RNA equivalent or DNA / RNA chimera, and
[0540] (B) SEQ ID NO:4, or its RNA equivalent or DNA / RNA chimera; and
[0541] (b) (A) SEQ ID NO:7, or its RNA equivalent or DNA / RNA chimera, and
[0542] (B) SEQ ID NO: 8, or its RNA equivalent or DNA / RNA chimera.
[0543] 85. A kit according to item 84, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (a).
[0544] 86. A kit according to item 84, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (b).
[0545] 87. A kit according to any one of items 84-86, wherein the kit further comprises a SIP-specific detection probe oligomer, wherein the SIP-specific detection probe oligomer comprises a SIP-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained in a SIP amplicon that can be amplified by the first and second SIP-specific amplification oligomers.
[0546] 88. A kit according to item 87, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (a), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 9, or its RNA equivalent or DNA / RNA chimera.
[0547] 89. A kit according to item 88, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (b), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 11, or its RNA equivalent or DNA / RNA chimera.
[0548] 90. A kit according to any one of items 87-89, wherein the detection probe oligomer further comprises a detectable label.
[0549] 91. A kit according to item 90, wherein the detectable label is a fluorescent or chemiluminescent label.
[0550] 92. A kit according to item 90, wherein the detectable label is a fluorescent label and the detection probe oligomer further comprises a non-fluorescent quencher.
[0551] 93. A kit according to any one of items 84-92, further comprising a second amplification oligomer combination capable of amplifying a target region of the GBSCFB target nucleic acid.
[0552] 94. A kit for determining the presence or absence of Group B Streptococcus (GBS) in a sample, the kit comprising:
[0553] An amplification oligomer combination comprising first and second CFB-specific amplification oligomers capable of amplifying a target region of a GBS CFB target nucleic acid, wherein the first and second CFB-specific amplification oligomers respectively comprise a first (A) and a second (B) CFB-specific target hybridization sequence selected from the group consisting of:
[0554] (a)(A) a sequence of about 17 to about 24 consecutive nucleotides contained in the sequence of SEQ ID NO: 26, or its RNA equivalent or DNA / RNA chimera, and
[0555] (B) SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0556] (b) (A) SEQ ID NO: 16, or its RNA equivalent or DNA / RNA chimera, and
[0557] (B) SEQ ID NO: 17, or its RNA equivalent or DNA / RNA chimera;
[0558] (c) (A) SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0559] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0560] (d) (A) SEQ ID NO: 20, or its RNA equivalent or DNA / RNA chimera, and
[0561] (B) SEQ ID NO: 21, or its RNA equivalent or DNA / RNA chimera.
[0562] 95. A kit according to item 94, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (b).
[0563] 96. A kit according to item 94, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (d).
[0564] 97. A kit according to item 94, wherein the CFB-specific target hybridization sequence is the target hybridization sequence of (a).
[0565] 98. A kit according to item 97, wherein the first CFB-specific target hybridization sequence of (a) comprises at least the sequence of SEQ ID NO: 28, or its RNA equivalent or DNA / RNA chimera.
[0566] 99. The kit of claim 98, wherein the first CFB-specific target hybridization sequence of (a) is contained in the sequence of SEQ ID NO: 27, or its RNA equivalent or DNA / RNA chimera.
[0567] 100. A kit according to item 99, wherein the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 12 or SEQ ID NO: 14, or an RNA equivalent or DNA / RNA chimera thereof.
[0568] 101. A kit according to claim 97, wherein the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera.
[0569] 102. A kit according to item 97, wherein the first (A) and second (B) CFB-specific target hybridization sequences of (a) are selected from
[0570] (i) (A) SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0571] (B) SEQ ID NO: 13, or its RNA equivalent or DNA / RNA chimera;
[0572] (ii) (A) SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0573] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera;
[0574] (iii) (A) SEQ ID NO: 14, or its RNA equivalent or DNA / RNA chimera, and
[0575] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0576] (iv) (A) SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0577] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera.
[0578] 103. A kit according to item 94, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (c).
[0579] 104. A kit according to any one of items 94-103, wherein the kit further comprises a CFB-specific detection probe oligomer, wherein the CFB-specific detection probe oligomer comprises a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained in a CFB amplicon that can be amplified by the first and second CFB-specific amplification oligomers.
[0580] 105. A kit according to item 104, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (b), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 24, or its RNA equivalent or DNA / RNA chimera.
[0581] 106. A kit according to item 104, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (d), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 25, or its RNA equivalent or DNA / RNA chimera.
[0582] 107. A kit according to item 104, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (a), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:22 or SEQ ID NO:23, or its RNA equivalent or DNA / RNA chimera.
[0583] 108. A kit according to item 104, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (c), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:23, or its RNA equivalent or DNA / RNA chimera.
[0584] 109. A kit according to any one of items 104-108, wherein the detection probe oligomer further comprises a detectable label.
[0585] 110. A kit according to item 109, wherein the detectable label is a fluorescent or chemiluminescent label.
[0586] 111. A kit according to item 109, wherein the detectable label is a fluorescent label and the detection probe oligomer further comprises a non-fluorescent quencher.
[0587] 112. A kit according to any one of items 94-111, further comprising a second amplification oligomer combination capable of amplifying a target region of a GBSSIP target nucleic acid.
[0588] 113. A method for determining the presence or absence of Group B Streptococcus (GBS) in a sample, the method comprising:
[0589] (1) contacting a sample suspected of containing GBS with at least one of a first amplification oligomer combination and a second amplification oligomer combination, wherein
[0590] (I) The first amplification oligomer combination comprises first and second SIP-specific amplification oligomers for amplifying a target region of a GBS SIP target nucleic acid, wherein the first and second SIP-specific amplification oligomers respectively comprise first (A) and second (B) SIP-specific target hybridization sequences selected from the following:
[0591] (a)(A) SEQ ID NO:3, or its RNA equivalent or DNA / RNA chimera, and
[0592] (B) SEQ ID NO:4, or its RNA equivalent or DNA / RNA chimera; and
[0593] (b) (A) SEQ ID NO:7, or its RNA equivalent or DNA / RNA chimera, and
[0594] (B) SEQ ID NO: 8, or its RNA equivalent or DNA / RNA chimera;
[0595] and
[0596] (II) the second amplification oligomer combination comprises first and second CFB-specific amplification oligomers for amplifying a target region of a GBS CFB target nucleic acid, wherein the first and second CFB-specific amplification oligomers respectively comprise a first (A') and a second (B') CFB-specific target hybridization sequence selected from the following:
[0597] (a)(A') is a sequence of about 17 to about 24 consecutive nucleotides contained in the sequence of SEQ ID NO: 26, or its RNA equivalent or DNA / RNA chimera, and
[0598] (B') SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0599] (b) (A') SEQ ID NO: 16, or its RNA equivalent or DNA / RNA chimera, and
[0600] (B') SEQ ID NO: 17, or its RNA equivalent or DNA / RNA chimera;
[0601] (c) (A') SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0602] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0603] (d) (A') SEQ ID NO:20, or its RNA equivalent or DNA / RNA chimera, and
[0604] (B') SEQ ID NO:21, or its RNA equivalent or DNA / RNA chimera;
[0605] (2) performing an in vitro nucleic acid amplification reaction, wherein any GBS SIP and / or CFB target nucleic acid when present in the sample is used as a template to generate one or more amplicons corresponding to at least one of the SIP and CFB target regions; and
[0606] (3) detecting the presence or absence of the one or more amplicons, thereby determining the presence or absence of GBS in the sample.
[0607] 114. A method according to item 113, wherein the method comprises contacting the sample with both the first and second amplification oligomer combinations.
[0608] 115. A method according to item 114, wherein the method is a multiplexed method, comprising contacting the sample with both the first and second amplification oligomer combinations within the same reaction mixture.
[0609] 116. A method according to any one of items 113-115, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I)(a).
[0610] 117. A method according to items 113-115, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I)(b).
[0611] 118. A method according to any one of items 113-117, wherein if the method includes contacting the sample with the first amplification oligomer combination, the detection step includes contacting the in vitro nucleic acid amplification reactant with a SIP-specific detection probe oligomer, wherein the SIP-specific detection probe oligomer comprises a SIP-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained in a SIP amplicon that can be amplified by the first and second SIP-specific amplification oligomers.
[0612] 119. A method according to item 118, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I)(a), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 9, or its RNA equivalent or DNA / RNA chimera.
[0613] 120. A method according to item 118, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I)(b), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO:11, or its RNA equivalent or DNA / RNA chimera.
[0614] 121. A method according to any one of items 118-120, wherein the SIP-specific detection probe oligomer further comprises a detectable label.
[0615] 122. A method according to claim 121, wherein the detectable marker is a fluorescent or chemiluminescent marker.
[0616] 123. A method according to item 121, wherein the detectable label is a fluorescent label and the SIP-specific detection probe oligomer further comprises a non-fluorescent quencher.
[0617] 124. A method according to any one of items 113-123, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(b).
[0618] 125. A method according to any one of items 113-123, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(d).
[0619] 126. A method according to any one of items 113-123, wherein the CFB-specific target hybridization sequence is the target hybridization sequence of (II)(a).
[0620] 127. A method according to item 126, wherein the first CFB-specific target hybridization sequence of (II)(a) comprises at least the sequence of SEQ ID NO:28, or its RNA equivalent or DNA / RNA chimera.
[0621] 128. A method according to item 127, wherein the first CFB-specific target hybridization sequence of (II)(a) is contained in the sequence of SEQ ID NO:27, or its RNA equivalent or DNA / RNA chimera.
[0622] 129. A method according to item 128, wherein the first CFB-specific target hybridization sequence of (II)(a) is SEQ ID NO: 12 or SEQ ID NO: 14, or its RNA equivalent or DNA / RNA chimera.
[0623] 130. A method according to item 126, wherein the first CFB-specific target hybridization sequence of (II)(a) is SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera.
[0624] 131. A method according to item 126, wherein the first (A') and second (B') CFB-specific target hybridization sequences of (II)(a) are selected from
[0625] (i) (A') SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0626] (B') SEQ ID NO: 13, or its RNA equivalent or DNA / RNA chimera;
[0627] (ii) (A') SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0628] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera;
[0629] (iii) (A') SEQ ID NO: 14, or its RNA equivalent or DNA / RNA chimera, and
[0630] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0631] (iv) (A') SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0632] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera.
[0633] 132. A method according to any one of items 113-123, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(c).
[0634] 133. A method according to any one of items 113-132, wherein if the method includes contacting the sample with the second amplification oligomer combination, the detection step includes contacting the in vitro nucleic acid amplification reactant with a CFB-specific detection probe oligomer, wherein the CFB-specific detection probe oligomer comprises a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and being configured to hybridize to a target sequence contained within a CFB amplicon that can be amplified by the first and second CFB-specific amplification oligomers.
[0635] 134. A method according to item 133, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(b), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:24, or its RNA equivalent or DNA / RNA chimera.
[0636] 135. A method according to item 133, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(d), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:25, or its RNA equivalent or DNA / RNA chimera.
[0637] 136. A method according to claim 133, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(a), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:22 or SEQ IDNO:23, or its RNA equivalent or DNA / RNA chimera.
[0638] 137. A method according to claim 133, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (II)(c), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:23, or its RNA equivalent or DNA / RNA chimera.
[0639] 138. A method according to any one of items 133-137, wherein the CFB-specific detection probe oligomer further comprises a detectable label.
[0640] 139. A method according to claim 138, wherein the detectable marker is a fluorescent or chemiluminescent marker.
[0641] 140. A method according to item 138, wherein the detectable label is a fluorescent label and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher.
[0642] 141. A method according to any one of items 188-120 and 133-137, wherein the detecting step is performed in real time.
[0643] 142. A method according to any one of items 113-141, wherein the in vitro nucleic acid amplification reaction is a PCR amplification reaction.
[0644] 143. The method of item 114 or 115, wherein the detecting step comprises contacting the in vitro nucleic acid amplification reactants with:
[0645] (i) a SIP-specific detection probe oligomer comprising a SIP-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained within a SIP amplicon amplifiable by the first and second SIP-specific amplification oligomers, and
[0646] (ii) a CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained within a CFB amplicon that can be amplified by the first and second CFB-specific amplification oligomers,
[0647] Each of the SIP-specific detection probe oligomer and the CFB-specific detection probe oligomer comprises a fluorescent label and a non-fluorescent quencher.
[0648] 144. A method according to claim 143, wherein the in vitro nucleic acid amplification reaction is a real-time PCR amplification reaction.
[0649] 145. A method for determining the presence or absence of Group B Streptococcus (GBS) in a sample, the method comprising:
[0650] (1) contacting a sample suspected of containing GBS with an amplification oligomer combination comprising first and second SIP-specific amplification oligomers for amplifying a target region of a GBS SIP target nucleic acid, wherein the first and second SIP-specific amplification oligomers respectively comprise first (A) and second (B) SIP-specific target hybridization sequences selected from the group consisting of:
[0651] (a)(A) SEQ ID NO:3, or its RNA equivalent or DNA / RNA chimera, and
[0652] (B) SEQ ID NO:4, or its RNA equivalent or DNA / RNA chimera; and
[0653] (b) (A) SEQ ID NO:7, or its RNA equivalent or DNA / RNA chimera, and
[0654] (B) SEQ ID NO: 8, or its RNA equivalent or DNA / RNA chimera;
[0655] (2) performing an in vitro nucleic acid amplification reaction, wherein any GBS SIP target nucleic acid when present in the sample is used as a template to produce an amplicon corresponding to the SIP target region; and
[0656] (3) Detecting the presence or absence of the amplicon, thereby determining the presence or absence of GBS in the sample.
[0657] 146. A method according to item 145, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (a).
[0658] 147. A method according to item 145, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (b).
[0659] 148. A method according to any one of items 145-147, wherein the detection step comprises contacting the in vitro nucleic acid amplification reactant with a SIP-specific detection probe oligomer, wherein the SIP-specific detection probe oligomer comprises a SIP-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained in a SIP amplicon that can be amplified by the first and second SIP-specific amplification oligomers.
[0660] 149. A method according to item 148, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (a), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 9, or its RNA equivalent or DNA / RNA chimera.
[0661] 150. A method according to item 148, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (b), and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 11, or its RNA equivalent or DNA / RNA chimera.
[0662] 151. A method according to any one of items 145-150, wherein the detection probe oligomer further comprises a detectable label.
[0663] 152. A method according to claim 151, wherein the detectable marker is a fluorescent or chemiluminescent marker.
[0664] 153. A method according to item 151, wherein the detectable label is a fluorescent label and the detection probe oligomer further comprises a non-fluorescent quencher.
[0665] 154. A method according to any one of items 145-150, wherein the detecting step is performed in real time.
[0666] 155. A method according to any one of items 145-154, wherein the in vitro nucleic acid amplification reaction is a PCR amplification reaction.
[0667] 156. A method according to claim 153, wherein the in vitro nucleic acid amplification reaction is a real-time PCR amplification reaction.
[0668] 157. The method according to any one of items 145-156, further comprising contacting the sample with a second amplification oligomer combination, the second amplification oligomer combination comprising first and second CFB-specific amplification oligomers for amplifying a target region of a GBS CFB target nucleic acid,
[0669] wherein in the amplification step, any GBS CFB target nucleic acid when present in the sample is used as a template to generate amplicons corresponding to the CFB target region, and wherein the detection step comprises detecting the presence or absence of the amplicons corresponding to the CFB target region.
[0670] 158. A method for determining the presence or absence of Group B Streptococcus (GBS) in a sample, the method comprising:
[0671] (1) contacting a sample suspected of containing GBS with an amplification oligomer combination comprising first and second CFB-specific amplification oligomers for amplifying a target region of a GBS CFB target nucleic acid, wherein the first and second SIP-specific amplification oligomers respectively comprise first (A) and second (B) SIP-specific target hybridization sequences selected from the group consisting of:
[0672] (a)(A) a sequence of about 17 to about 24 consecutive nucleotides contained in the sequence of SEQ ID NO: 26, or its RNA equivalent or DNA / RNA chimera, and
[0673] (B) SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0674] (b) (A) SEQ ID NO: 16, or its RNA equivalent or DNA / RNA chimera, and
[0675] (B) SEQ ID NO: 17, or its RNA equivalent or DNA / RNA chimera;
[0676] (c) (A) SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0677] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0678] (d) (A) SEQ ID NO: 20, or its RNA equivalent or DNA / RNA chimera, and
[0679] (B) SEQ ID NO: 21, or its RNA equivalent or DNA / RNA chimera;
[0680] (2) performing an in vitro nucleic acid amplification reaction, wherein any GBS CFB target nucleic acid when present in the sample is used as a template to generate amplicons corresponding to the CFB target region; and
[0681] (3) Detecting the presence or absence of the amplicon, thereby determining the presence or absence of GBS in the sample.
[0682] 159. A method according to item 158, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (b).
[0683] 160. A method according to claim 158, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (d).
[0684] 161. A method according to claim 158, wherein the CFB-specific target hybridization sequence is the target hybridization sequence of (a).
[0685] 162. A method according to item 161, wherein the first CFB-specific target hybridization sequence of (a) comprises at least the sequence of SEQ ID NO:28, or its RNA equivalent or DNA / RNA chimera.
[0686] 163. A method according to item 162, wherein the first CFB-specific target hybridization sequence of (a) is contained in the sequence of SEQ ID NO: 27, or its RNA equivalent or DNA / RNA chimera.
[0687] 164. A method according to item 163, wherein the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 12 or SEQ ID NO: 14, or its RNA equivalent or DNA / RNA chimera.
[0688] 165. A method according to claim 161, wherein the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera.
[0689] 166. A method according to item 161, wherein the first (A) and second (B) CFB-specific target hybridization sequences of (a) are selected from
[0690] (i) (A) SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0691] (B) SEQ ID NO: 13, or its RNA equivalent or DNA / RNA chimera;
[0692] (ii) (A) SEQ ID NO: 12, or its RNA equivalent or DNA / RNA chimera, and
[0693] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera;
[0694] (iii) (A) SEQ ID NO: 14, or its RNA equivalent or DNA / RNA chimera, and
[0695] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0696] (iv) (A) SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0697] (B) SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera.
[0698] 167. A method according to claim 158, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (c).
[0699] 168. A method according to any one of items 158-167, wherein the detection step comprises contacting the in vitro nucleic acid amplification reactant with a CFB-specific detection probe target hybridization sequence, wherein the CFB-specific detection probe target hybridization sequence is about 15 to about 35 nucleotides in length and is configured to hybridize with a target sequence contained within a CFB amplicon that can be amplified by the first and second CFB-specific amplification oligomers.
[0700] 169. A method according to item 168, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (b), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:24, or its RNA equivalent or DNA / RNA chimera.
[0701] 170. A method according to claim 168, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (d), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 25, or its RNA equivalent or DNA / RNA chimera.
[0702] 171. A method according to claim 168, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (a), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:22 or SEQ ID NO:23, or its RNA equivalent or DNA / RNA chimera.
[0703] 172. A method according to claim 168, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (c), and the CFB-specific detection probe target hybridization sequence is SEQ ID NO:23, or its RNA equivalent or DNA / RNA chimera.
[0704] 173. A method according to any one of items 168-172, wherein the detection probe oligomer further comprises a detectable label.
[0705] 174. A method according to claim 173, wherein the detectable marker is a fluorescent or chemiluminescent marker.
[0706] 175. A method according to item 173, wherein the detectable label is a fluorescent label and the detection probe oligomer further comprises a non-fluorescent quencher.
[0707] 176. A method according to any one of items 168-172, wherein the detection step is performed in real time.
[0708] 177. A method according to any one of items 168-176, wherein the in vitro nucleic acid amplification reaction is a PCR amplification reaction.
[0709] 178. A method according to claim 175, wherein the in vitro nucleic acid amplification reaction is a real-time PCR amplification reaction.
[0710] 179. The method according to any one of items 168-178, further comprising contacting the sample with a second amplification oligomer combination, the second amplification oligomer combination comprising first and second SIP-specific amplification oligomers for amplifying a target region of a GBS SIP target nucleic acid,
[0711] wherein in the amplifying step, any GBS SIP target nucleic acid when present in the sample is used as a template to produce an amplicon corresponding to the SIP target region, and wherein the detecting step comprises detecting the presence or absence of the amplicon corresponding to the SIP target region.
[0712] 180. A method according to any one of items 113-179, wherein the method determines the presence or absence of any one of GBS serotypes Ia, Ib, Ic, II, III, IV, V, VI, VII, VIII and IX.
[0713] 181. A method according to claim 181, wherein the method further determines the presence or absence of a non-hemolytic strain of GBS.
[0714] 182. A detection probe oligomer, comprising:
[0715] A SIP-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained within a SIP amplicon amplifiable by a first amplification oligomer combination, the first amplification oligomer combination comprising first and second SIP-specific amplification oligomers capable of amplifying a target region of a Group B Streptococcus (GBS) SIP target nucleic acid, wherein the first and second SIP-specific amplification oligomers respectively comprise a first (A) and a second (B) SIP-specific target hybridization sequence selected from the group consisting of:
[0716] (a)(A) SEQ ID NO:3, or its RNA equivalent or DNA / RNA chimera, and
[0717] (B) SEQ ID NO:4, or its RNA equivalent or DNA / RNA chimera; and
[0718] (b) (A) SEQ ID NO:7, or its RNA equivalent or DNA / RNA chimera, and
[0719] (B) SEQ ID NO: 8, or its RNA equivalent or DNA / RNA chimera.
[0720] 183. A detection probe oligomer, comprising:
[0721] A CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained within a CFB amplicon amplifiable by a second amplification oligomer combination, the second amplification oligomer combination comprising first and second CFB-specific amplification oligomers capable of amplifying a target region of a Group B Streptococcus (GBS) CFB target nucleic acid, wherein the first and second CFB-specific amplification oligomers respectively comprise a first (A') and a second (B') CFB-specific target hybridization sequence selected from the group consisting of:
[0722] (a)(A') is a sequence of about 17 to about 24 consecutive nucleotides contained in the sequence of SEQ ID NO: 26, or its RNA equivalent or DNA / RNA chimera, and
[0723] (B') SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0724] (b) (A') SEQ ID NO: 16, or its RNA equivalent or DNA / RNA chimera, and
[0725] (B') SEQ ID NO: 17, or its RNA equivalent or DNA / RNA chimera;
[0726] (c) (A') SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0727] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0728] (d) (A') SEQ ID NO:20, or its RNA equivalent or DNA / RNA chimera, and
[0729] (B') SEQ ID NO:21, or its RNA equivalent or DNA / RNA chimera.
[0730] 184. The detection probe oligomer according to item 182 or 183, wherein the detection probe oligomer further comprises a detectable label.
[0731] 185. A detection probe oligomer according to item 184, wherein the detectable label is a fluorescent or chemiluminescent label.
[0732] 186. A composition comprising:
[0733] (1) a SIP-specific detection probe oligomer comprising a SIP-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained within a SIP amplicon amplifiable by a first amplification oligomer combination, wherein the first amplification oligomer combination comprises first and second SIP-specific amplification oligomers capable of amplifying a target region of a Group B Streptococcus (GBS) SIP target nucleic acid, wherein the first and second SIP-specific amplification oligomers respectively comprise a first (A) and a second (B) SIP-specific target hybridization sequence selected from the group consisting of:
[0734] (a)(A) SEQ ID NO:3, or its RNA equivalent or DNA / RNA chimera, and
[0735] (B) SEQ ID NO:4, or its RNA equivalent or DNA / RNA chimera; and
[0736] (b) (A) SEQ ID NO:7, or its RNA equivalent or DNA / RNA chimera, and
[0737] (B) SEQ ID NO: 8, or its RNA equivalent or DNA / RNA chimera;
[0738] and
[0739] (2) a CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence having a length of about 15 to about 35 nucleotides and configured to hybridize to a target sequence contained within a CFB amplicon that can be amplified by a second amplification oligomer combination, wherein the second amplification oligomer combination comprises first and second CFB-specific amplification oligomers capable of amplifying a target region of a Group B Streptococcus (GBS) CFB target nucleic acid, wherein the first and second CFB-specific amplification oligomers respectively comprise a first (A') and a second (B') CFB-specific target hybridization sequence selected from the group consisting of:
[0740] (a)(A') is a sequence of about 17 to about 24 consecutive nucleotides contained in the sequence of SEQ ID NO: 26, or its RNA equivalent or DNA / RNA chimera, and
[0741] (B') SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof;
[0742] (b) (A') SEQ ID NO: 16, or its RNA equivalent or DNA / RNA chimera, and
[0743] (B') SEQ ID NO: 17, or its RNA equivalent or DNA / RNA chimera;
[0744] (c) (A') SEQ ID NO: 18, or its RNA equivalent or DNA / RNA chimera, and
[0745] (B') SEQ ID NO: 15, or its RNA equivalent or DNA / RNA chimera; and
[0746] (d) (A') SEQ ID NO:20, or its RNA equivalent or DNA / RNA chimera, and
[0747] (B') SEQ ID NO:21, or its RNA equivalent or DNA / RNA chimera.
[0748] 187. A composition according to item 186, wherein the SIP-specific detection probe oligomer further comprises a detectable label.
[0749] 188. A composition according to item 186 or 187, wherein the CFB-specific detection probe oligomer further comprises a detectable label.
[0750] 189. A composition according to item 187 or 188, wherein the detectable label is a fluorescent or chemiluminescent label.
[0751] 190. An aqueous formulation for amplifying Group B Streptococcus (GBS) nucleic acid, wherein the aqueous formulation comprises:
[0752] A composition according to any one of items 1 to 56, and
[0753] Organic buffer.
[0754] 191. An aqueous formulation according to claim 190, further comprising a DNA polymerase.
[0755] 192. An aqueous formulation according to item 190 or 191, further comprising reverse transcriptase.
[0756] 193. An aqueous formulation according to any one of items 190-192, further comprising a detection probe oligomer.
[0757] 194. The aqueous formulation according to any one of items 190-193, further comprising a bulking agent selected from trehalose, raffinose and combinations thereof.
[0758] 195. An aqueous formulation according to any one of items 190 to 194, wherein the formulation contains an inorganic salt at a concentration of 4 mM or less.
[0759] 196. A dry formulation for amplifying Group B Streptococcus (GBS) nucleic acid, wherein the aqueous formulation comprises:
[0760] A composition according to any one of items 1 to 56, and
[0761] Bulking agent.
[0762] 197. A dry formulation according to item 196, wherein the bulking agent is selected from trehalose, raffinose and combinations thereof.
[0763] 198. The dry formulation of item 196 or 197, further comprising an inorganic salt, wherein the percentage of the mass of the inorganic salt relative to the mass of the dry formulation is 0.249% or less.
[0764] 199. The dry formulation of any one of items 196-198, further comprising a DNA polymerase.
[0765] 200. The dry formulation of any one of items 196-199, further comprising a reverse transcriptase.
[0766] 201. The dry formulation of any one of items 196-200, further comprising a detection probe oligomer.
[0767] 202. The dry formulation of any one of items 196-201, wherein the formulation is a lyophilized formulation.
[0768] 203. An aqueous formulation for detecting Group B Streptococcus (GBS) nucleic acid, wherein the aqueous formulation comprises:
[0769] A detection probe oligomer according to any one of items 182 to 185 or a composition according to any one of items 186 to 189, and
[0770] Organic buffer.
[0771] 204. The aqueous formulation of claim 203, further comprising a surfactant.
[0772] 205. An aqueous formulation according to item 204, wherein the surfactant is a non-linear surfactant.
[0773] 206. An aqueous formulation according to item 204, wherein the surfactant is selected from
[0774] Polyethylene glycol mono[4-(1,1,3,3-tetramethylbutyl)phenyl]ether,
[0775] Polysorbate 20, and
[0776] Its combination.
[0777] 207. An aqueous formulation according to any one of items 204-206, further comprising a DNA polymerase.
[0778] 208. An aqueous formulation according to any one of items 204-207, further comprising reverse transcriptase.
[0779] 209. The aqueous formulation of any one of items 204-208, further comprising at least one amplification oligomer.
[0780] 210. The aqueous formulation according to any one of items 204-209, further comprising a bulking agent selected from trehalose, raffinose and combinations thereof.
[0781] 211. An aqueous formulation according to any one of items 204-210, wherein the formulation contains an inorganic salt at a concentration of 4 mM or less.
[0782] 212. A dry formulation for detecting Group B Streptococcus (GBS) nucleic acid, wherein the dry formulation comprises:
[0783] A detection probe oligomer according to any one of items 182 to 185 or a composition according to any one of items 186 to 189, and
[0784] Bulking agent.
[0785] 213. The dry formulation of item 212, wherein the bulking agent is selected from trehalose, raffinose, and combinations thereof.
[0786] 214. The dry formulation according to item 212 or 213, further comprising an inorganic salt, wherein the percentage of the mass of the inorganic salt relative to the mass of the dry formulation is 0.249% or less.
[0787] 215. The dry formulation according to any one of items 212-214, further comprising a DNA polymerase.
[0788] 216. The dry formulation according to any one of items 212-215, further comprising a reverse transcriptase.
[0789] 217. The dry preparation of any one of items 212-216, further comprising at least one amplification oligomer.
[0790] 218. The dry formulation according to any one of items 212-217, further comprising a surfactant.
[0791] 219. A dry formulation according to item 218, wherein the surfactant is a non-linear surfactant.
[0792] 220. A dry formulation according to item 218, wherein the surfactant is selected from
[0793] Polyethylene glycol mono[4-(1,1,3,3-tetramethylbutyl)phenyl]ether,
[0794] Polysorbate 20, and
[0795] Its combination.
[0796] 221. The dry formulation of any one of items 212-220, wherein the formulation is a lyophilized formulation.
[0797] 222. A reaction mixture for amplifying Group B Streptococcus (GBS) nucleic acid, wherein the reaction mixture comprises an aqueous formulation according to any one of items 190-195.
[0798] 223. A reaction mixture for amplifying Group B Streptococcus (GBS) nucleic acid, wherein the reaction mixture is reconstituted from a dry formulation according to any one of items 196-202 with water or an organic buffer.
[0799] 224. A reaction mixture according to claim 223, wherein the reaction mixture contains an inorganic salt.
[0800] 225. A reaction mixture according to item 224, wherein the inorganic salt is selected from magnesium, potassium and sodium.
[0801] 226. A reaction mixture according to item 224 or 225, wherein the concentration of the inorganic salt is 4 mM or less.
[0802] 227. A reaction mixture for detecting Group B Streptococcus (GBS) nucleic acid, wherein the reaction mixture comprises an aqueous formulation according to any one of items 203-211.
[0803] 228. A reaction mixture for detecting Group B Streptococcus (GBS) nucleic acid, wherein the reaction mixture is reconstituted from a dry formulation according to any one of items 212-221 with water or an organic buffer.
[0804] 229. A reaction mixture according to claim 228, wherein the reaction mixture contains an inorganic salt.
[0805] 230. A reaction mixture according to claim 229, wherein the inorganic salt is selected from magnesium, potassium and sodium.
[0806] 231. A reaction mixture according to item 229 or 230, wherein the concentration of the inorganic salt is 4 mM or less.
Claims
1. A kit or composition for determining the presence or absence of Group B Streptococcus (GBS) in a sample, the reagent or composition comprising a first amplification oligomer containing a first target hybridization sequence and a second amplification oligomer containing a second target hybridization sequence, in: (a) the first target hybridization sequence comprises SEQ ID NO: 3 or its RNA equivalent or DNA / RNA chimera, and the second target hybridization sequence comprises SEQ ID NO: 4 or its RNA equivalent or DNA / RNA chimera; or (b) the first target hybridization sequence comprises SEQ ID NO:7 or its RNA equivalent or DNA / RNA chimera, and the second target hybridization sequence comprises SEQ ID NO:8 or its RNA equivalent or DNA / RNA chimera; The first amplification oligomer and the second amplification oligomer are capable of amplifying the SIP target region of the GBS SIP target nucleic acid.
2. The kit or composition according to claim 1, further comprising a detection probe oligomer, wherein the detection probe oligomer comprises a detection probe target hybridization sequence, wherein the detection probe target hybridization sequence is about 15 to about 35 nucleotides in length and is configured to hybridize with a target sequence contained in an amplicon that can be amplified by the first amplification oligomer and the second amplification oligomer.
3. The kit or composition of claim 2, wherein the detection probe oligomer further comprises at least one detectable label.
4. The kit or composition according to claim 2, wherein the detectable label further comprises: (a) Fluorescent labeling; (b) chemiluminescent labeling; or (c) Fluorescent label and non-fluorescent quencher.
5. The kit or composition according to claim 4, wherein (a) the first target hybridization sequence comprises SEQ ID NO: 3 or its RNA equivalent or DNA / RNA chimera, and the second target hybridization sequence comprises SEQ ID NO: 4 or its RNA equivalent or DNA / RNA chimera; and the detection probe target hybridization sequence comprises SEQ ID NO: 9 or its RNA equivalent or DNA / RNA chimera; or (b) the first target hybridization sequence comprises SEQ ID NO:7 or its RNA equivalent or DNA / RNA chimera, and the second target hybridization sequence comprises SEQ ID NO:8 or its RNA equivalent or DNA / RNA chimera; and the detection probe target hybridization sequence comprises SEQ ID NO:11 or its RNA equivalent or DNA / RNA chimera.
6. The kit or composition according to any one of claims 1 to 5, further comprising a CFB-specific amplification oligomer combination, wherein the CFB-specific amplification oligomer combination comprises a first CFB-specific target hybridization sequence and a second CFB-specific amplification oligomer containing a second CFB-specific target hybridization sequence, in: The first CFB-specific target hybridization sequence comprises SEQ ID NO: 18 or its RNA equivalent or DNA / RNA chimera, and the second CFB-specific target hybridization sequence comprises SEQ ID NO: 15 or its RNA equivalent or DNA / RNA chimera, wherein the first CFB-specific target hybridization sequence and the second CFB-specific target hybridization sequence are capable of amplifying the CFB target region of the GBS CFB target nucleic acid.
7. The kit or composition according to claim 6, further comprising a CFB-specific detection probe oligomer containing a CFB-specific detection probe target hybridization sequence, wherein the CFB-specific detection probe target hybridization sequence is about 15 to about 35 nucleotides in length, comprises SEQ ID NO: 22 or 23 or its RNA equivalent or DNA / RNA chimera, and comprises at least one detectable label.
8. A method for determining the presence or absence of Group B Streptococcus (GBS) in a sample, the method include: (a) contacting a sample suspected of containing GBS with a kit or composition according to any one of claims 1 to 5, (b) performing an in vitro nucleic acid amplification reaction, wherein any GBS SIP target nucleic acid when present in the sample is used as a template to produce an amplicon corresponding to the SIP target region; as well as (c) detecting the presence or absence of the amplicon, thereby determining the presence or absence of GBS in the sample.
9. The method according to claim 8, wherein the in vitro nucleic acid amplification reaction is a PCR amplification reaction.
10. The method of claim 8, wherein the detecting step comprises contacting the in vitro nucleic acid amplification reactants with a SIP-specific detection probe oligomer.
Citation Information
Patent Citations
Method for detecting a target nucleic acid sequence
EP0320308A2
Adduct protection assay
EP0747706A1
Methods and compositions to detect nucleic acids in a biological sample
US20060068417A1
Compositions and methods of detecting an analyte by using a nucleic acid hybridization switch probe
US20060194240A1
Methods of nonspecific target capture of nucleic acids
US20130209992A1