Inhibitor acting on TDP1 target spot and application thereof

Abstract

The invention discloses an inhibitor acting on a TDP1 target spot and application of the inhibitor. The active ingredient of the inhibitor comprises Lawsone (2-hydroxy-1, 4-naphthoquinone) or SPI-112 (Sodium Sulfonate I-112). The Lawsone is a naphthoquinone compound with oral activity, has antibacterial, antitumor and antioxidant activity, has a molecular formula of C10H6O3, and has a molecular weight of 174.16. The SPI-112 is a protein tyrosine phosphatase inhibitor, the molecular formula of the SPI-112 is C22H17FN4O5S, and the molecular weight of the SPI-112 is 468.46. The inhibitor provided by the invention can be used for effectively reducing CTG trinucleotide repeated amplification in Mykylosing Dystrophy Type 1 (Mykylosing Dystrophy Type 1, DM1) by inhibiting the activity of TDP1 protein, and a new direction is provided for preparing a safe and effective medicine directly aiming at the CTG trinucleotide repeated amplification in DM1.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to an inhibitor acting on the TDP1 target and its application. Background Art

[0002] Myotonic Dystrophy Type 1 (DM1) is the most common muscular dystrophy disease in adults, and its inheritance pattern is autosomal dominant inheritance. DM1 mainly affects muscles, and the symptoms are myotonia, muscle atrophy, and progressive muscle weakness. At the same time, it also affects the heart, eyes, central nervous system, endocrine system, digestive system, and respiratory system, and the symptoms are arrhythmia, cataract, cognitive impairment, endocrine disorders, etc. DM1 is caused by the abnormal amplification of the CTG trinucleotide repeat sequence in the 3'UTR (3' untranslated region) of the DMPK gene located on chromosome 19. The number of CTG repeats in normal people is usually between 5 and 34 times, while the number of repeats in DM1 patients can exceed 50 times, and even reach thousands of times. The number of repeated amplifications is closely related to the severity of the disease and the age of onset. The more the number of repeats, the earlier and more severe the symptoms usually appear.

[0003] Addressing the problem of the CTG repeat sequence in the 3'UTR (3' untranslated region) of the DMPK gene on chromosome 19 is an important approach to preventing or improving DM1. Currently, the treatment methods for repeated amplified sequences are mainly based on the CRISPR / Cas9 gene editing technology. By gene editing, the amplified CTG repeats are directly excised or a PolyA signal is inserted into the DMPK gene. Direct excision of CTG repeats is achieved by designing sgRNAs targeting the flanking regions of the CTG repeat sequence, directly excising the amplified CTG repeats, eliminating the repeated amplification at the DNA level, and blocking the transcription of toxic RNA. Inserting a PolyA signal into the DMPK gene can induce premature termination of RNA transcription by inserting a PolyA signal between the CTG repeat and the gene, avoiding the production of toxic RNA while retaining DMPK transcription.

[0004] Currently, the disadvantages of directly excising CTG repeats include challenges in sgRNA design, off-target effects, and the inability to distinguish normal alleles. For sgRNA design challenges, it is necessary to balance the distance between the sgRNA and the CTG repeat. If it is too close, the abnormal structure of the repeat sequence may affect the editing efficiency; if the distance is too far, it may affect the transcription of the edited DMPK gene. The off-target effect means that CRISPR / Cas9 may accidentally cut other regions of the genome, resulting in unexpected mutations. The inability to distinguish normal and amplified alleles means that editing may occur simultaneously on normal and repeat-amplified alleles, leading to problems such as insertions / deletions or repeat inversions. Inserting a PolyA signal into the DMPK gene has the disadvantage that the repeat amplification sequence still exists in the genome and may silence the DMPK and adjacent SIX5 genes through methylation / heterochromatinization and other pathways. The CAG repeat transcription on the antisense strand of DMPK can generate toxic polypeptides through RAN translation. Therefore, developing a safe and effective method directly targeting the CTG repeat sequence within the 3'UTR (3'untranslated region) of the DMPK gene is of great significance for DM1 disease research. Summary of the Invention

[0005] One of the objectives of the present invention is to provide an inhibitor acting on the TDP1 target. The TDP1 target is a safe target with redundant pathway compensation. Knocking down or inhibiting the TDP1 target will not cause damage to cells. By inhibiting TDP1, the number of CTG trinucleotide repeat amplifications in DM1 can be reduced, thus solving the problem of CTG trinucleotide repeat amplifications in DM1.

[0006] Another objective of the present invention is to provide the application of the above inhibitor.

[0007] The present invention provides an inhibitor acting on the TDP1 target. The active ingredient of the inhibitor includes Lawsone (2-hydroxy-1,4-naphthoquinone) or SPI-112.

[0008] The Lawsone is an orally active naphthoquinone compound with antibacterial, antitumor, and antioxidant activities. Its molecular formula is C 10 H 6 O 3 , with a molecular weight of 174.16. Its chemical structural formula is shown as follows:

[0009]

[0010] The SPI-112 is a protein tyrosine phosphatase inhibitor. Its molecular formula is C 22 H 17 FN 4 O 5 S, with a molecular weight of 468.46. Its chemical structural formula is as follows:

[0011]

[0012] The TDP1 is tyrosine-DNA phosphodiesterase 1, and TDP1 affects the repeat expansion or contraction in genes by regulating the DNA repair process.

[0013] The present invention also provides an application of the inhibitor in targeting the CTG trinucleotide repeat expansion in DM1.

[0014] Further, the application specifically is to inhibit the TDP1 protein activity using the inhibitor, thereby solving the problem of CTG trinucleotide repeat expansion in DM1.

[0015] Further, the application object is a DM1 Drosophila or a DM1 human cell model.

[0016] When the application object is a DM1 Drosophila, the use process includes the following steps:

[0017] Dissolve the inhibitor using DMSO to obtain inhibitor solution 1;

[0018] Add the obtained inhibitor solution 1 into a food culture medium according to a preset final concentration 1, and mix evenly to obtain a drug Drosophila culture medium;

[0019] Place the newly emerged DM1 Drosophila in the obtained drug Drosophila culture medium for culturing to complete the inhibition of the TDP1 protein activity of the DM1 Drosophila.

[0020] Preferably, the concentration of the inhibitor solution 1 is 2.5 mM to 10 mM; in the drug Drosophila culture medium, the final concentration of the inhibitor is 0.5 μM to 2 μM.

[0021] Preferably, the temperature for culturing the newly emerged DM1 Drosophila in the drug Drosophila culture medium is 25 °C, and the time is 15 to 30 days.

[0022] When the application object is a DM1 human cell model, the use process includes the following steps:

[0023] Dissolve the inhibitor using DMSO respectively to obtain inhibitor solution 2;

[0024] Add the obtained inhibitor solution 2 into a DEME complete cell culture medium according to a preset final concentration 2, and mix evenly to obtain a drug cell culture medium;

[0025] Add the obtained drug cell culture medium into a 12-well plate containing a DM1 human cell model for culturing to complete the inhibition of the TDP1 protein activity of the DM1 human cell model.

[0026] Preferably, the inhibitor solution 2 is SPI-112 solution 2 or Lawsone solution 2; the concentration of SPI-112 solution 2 is 100 mM to 150 mM; the concentration of Lawsone solution 2 is 40 mM to 100 mM; in the drug cell culture medium, when the added inhibitor solution is SPI-112 solution 2, the final concentration of SPI-112 is 100 μM to 150 μM; when the added inhibitor solution is Lawsone solution 2, the final concentration of Lawsone is 40 μM to 100 μM.

[0027] Preferably, the specific conditions for culturing the drug cell culture medium in a 12-well plate containing a DM1 human cell model are: culturing in a 37°C sterile incubator for 7 to 10 days.

[0028] The present invention also provides an application of the inhibitor in the preparation of a drug for myotonic dystrophy type 1.

[0029] The drug is a drug for preventing or treating myotonic dystrophy type 1.

[0030] Advantages of the present invention:

[0031] (1) The present invention provides a solution to the problem of CTG trinucleotide repeat expansion in DM1, and for the first time proposes to inhibit the activity of TDP1 protein by an inhibitor to promote the reduction of the number of CTG trinucleotide repeats in DM1, which is of great significance for medical research;

[0032] (2) The TDP1 target used in the application of the inhibitor provided by the present invention is a safe target. Heterozygous mutation carriers have no phenotype, and inhibiting TDP1 will not cause serious damage to normal cells, having the characteristic of safety;

[0033] The two compounds, Lawsone and SPI-112, of the inhibitor disclosed in the present invention have a significant inhibitory effect on the activity of TDP1 protein in in vitro and in vivo experiments. Description of the drawings

[0034] Figure 1 It is a result diagram of the effect of genetic knockdown of TDP1 on the CTG repeat number in DM1 Drosophila in Example 1; wherein, Figure 1 A is the result diagram of GC-PCR and capillary electrophoresis after extracting DNA from DM1 Drosophila; Figure 1 B is the statistical chart of the CTG repeat length of DM1 Drosophila;

[0035] Figure 2 It is a result diagram of the effect of genetic knockdown of TDP1 on the CTG repeat number in a DM1 human cell model in Example 2; wherein, Figure 2A is the result graph of high GC-PCR and DNA chip after extracting DNA from the DM1 human cell model; Figure 2 B is the statistical graph of the CTG repeat length of the DM1 human cell model;

[0036] Figure 3 It is the result of verifying the effect of the TDP1 inhibitor in Example 3. Figure 3 A is the effect graph of inhibiting the TDP1 protein by in vitro verification of the inhibitor, Figure 3 B is the effect graph of inhibiting the TDP1 protein by in vivo verification of the inhibitor in Drosophila;

[0037] Figure 4 It is the result graph of the influence of Lawsone and SPI-112 on the CTG repeat number of DM1 Drosophila in Example 4;

[0038] Figure 5 It is the result graph of the influence of Lawsone and SPI-112 on the CTG repeat number of the DM1 human cell model in Example 5;

[0039] Figure 6 It is the result graph of the influence of Lawsone and SPI-112 on the CTG repeat number of lymphocytes of DM1 patients in Example 6. Detailed implementation manners

[0040] The present invention will be described in detail below in conjunction with embodiments. It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other.

[0041] The present invention will be further described in detail below in conjunction with embodiments, but the implementation manners of the present invention are not limited thereto.

[0042] The Drosophila strains used in the embodiments of the present invention include: UAS-(CTG) 270 Drosophila and Mef2-Gal4 Drosophila, purchased from the Bloomington Drosophila Stock Center; TDP1 RNAi Drosophila, purchased from The Vienna Drosophila Resource Center.

[0043] The cell lines used in the embodiments of the present invention include: The DM1 human cell model is from Central South University, and the CTG repeat number is about 400. The lymphocytes of DM1 patients are from Central South University, and the CTG repeat number is about 700.

[0044] The primer sequences, siRNA sequences and probe sequences used in the present invention are as follows:

[0045] DM1-F: GTTGGAAGACTGAGTGCCCG,

[0046] DM1-R: CCTGGCCGAAAGAAAGAAATG,

[0047] pCDNA-F: GCAGTACATCAATGGGCGTG

[0048] pCDNA-R: CTAGAAGGCACAGTCGAGGC,

[0049] TDP1-siRNA (sense strand): GACCATATCTAGTAGTGAT,

[0050] TDP1 active substrate probe: FAM-AAAGCAGGCTTCAACGCAACTGTGAAGATCGCTTGGGTGCGTTGAAGCCTGCTTT-BHQ1

[0051] The experimental reagents used in the examples include:

[0052] Lawsone and SPI-112 were purchased from MCE.

[0053] AmpliTaq Gold DNA 360 polymerase was purchased from Applied Biosystems.

[0054] The genomic DNA extraction kit was purchased from Novoprotein.

[0055] Hi-Di Formamide and GeneScan TM 1000ROX were purchased from Applied Biosystems.

[0056] High sensitivity DNA chip was purchased from Agilent.

[0057] 6% TBE-PAGE gel was purchased from Beyotime.

[0058] Ethanol, glacial acetic acid, silver nitrate, NaOH, formaldehyde were purchased from Sinopharm Chemical Reagent Co., Ltd. H2AvD was purchased from Abcam.

[0059] The instruments and equipment used in the examples include: The PCR instrument was manufactured by Biorad, the 3500xL genetic analyzer was manufactured by Applied Biosystems, and the confocal microscope was manufactured by zeiss.

[0060] Example 1 Effect of TDP1 genetic knockdown on the CTG repeat number in DM1 flies

[0061] UAS-(CTG) 270The repeated amplification Drosophila was crossed with Mef2-Gal4 Drosophila to obtain DM1 Drosophila with muscle-specific expression of Mef2-Gal4>(CTG) 270 genotype.

[0062] DM1 virgin flies and TDP1RNAi male flies from the Bloomington Drosophila Stock Center were hybridized in Drosophila medium (formula: 189.6 g glucose, 94.84 g sucrose, 33.6 g agar, 233.1 g cornmeal, 90 g yeast powder, 4 L water, dispensed with 10% preservative) at a ratio of 8:3. After culturing at 25°C for 7 days to obtain fertilized eggs, the parental flies were removed, and the culture was continued for 10 days until the offspring emerged. Adult flies with the genotype Mef2-Gal4>CTG 270 +TDP1 RNAi were collected.

[0063] The obtained Mef2-Gal4>(CTG) 270 +TDP1RNAi Drosophila were crossed with DM1 Drosophila of the Mef2-Gal4>(CTG) 270 genotype. Drosophila DNA was extracted using a DNA extraction kit. After high GC-PCR, the change in the length of the repeated fragment was detected by capillary electrophoresis. The results are as Figure 1 shown.

[0064] The PCR system for the high GC-PCR is shown in Table 1 below:

[0065] Table 1

[0066]

[0067] The PCR reaction conditions for the high GC-PCR are specifically shown in Table 2 below:

[0068] Table 2

[0069]

[0070] The capillary electrophoresis specifically was as follows: Formamide and internal standard (GeneScan TM 1000ROX) were mixed, and then 2 μL of the PCR product, 8.5 μL of formamide, and 0.5 μL of the internal standard were added. After centrifugation (1000 rpm, 1 min), it was heated at 95°C for 5 min and then quickly cooled on ice. Electrophoresis analysis was performed using a 3500xL genetic analyzer.

[0071] As Figure 1 shown, the capillary electrophoresis results showed that DM1 Drosophila of the Mef2-Gal4>(CTG) 270 genotype had only one product peak between 800 - 900 bp, and Mef2-Gal4>(CTG) 270+TDP1 RNAi Drosophila showed a diffuse and shortened product peak before 900 bp. The CTG repeat number was counted, and the results showed that knocking down TDP1 in DM1 Drosophila could promote CTG repeat reduction, demonstrating that TDP1 could be used as a target to reduce the CTG repeat number in DM1 Drosophila.

[0072] Example 2 Effect of genetic knockdown of TDP1 on CTG repeat length in DM1 human cell model

[0073] Dilute TDP1 siRNA to 50 μM with RNase-free water, take 1 μL and mix it with 100 μL of Opti-MEM and let it stand for 5 min; take another 1 μL of Lipofectamine 2000 transfection reagent and mix it with 100 μL of Opti-MEM and let it stand for 5 min. Mix the two and let it stand for 30 min to form a complex, then mix it with 800 μL of complete DMEM medium and add it to DM1 cells in a 12-well plate for transfection.

[0074] Respectively extract cell DNA from DM1 human cell model (CTG) 400 and transfected DM1 human cell model (CTG) 400 +TDP1 siRNA, perform high GC-PCR, and detect the change of repeat number by DNA chip. The results are as Figure 2 shown.

[0075] As Figure 2 shown, the DNA chip results showed that DM1 human cell model (CTG) 400 had only a clear band at about 1300 bp, while transfected DM1 human cell model (CTG) 400 +TDP1 siRNA showed obvious shortened products below 1300 bp. The CTG repeat number was counted, and the results showed that knocking down TDP1 in DM1 human cell model could promote CTG repeat reduction, demonstrating that TDP1 could be used as a target to solve the CTG repeat sequence problem on DM1 human cells

[0076] Example 3 Verification of the effect of TDP1 inhibitor

[0077] The inhibitory ability of Lawsone and SPI-112 on TDP1 protein activity was determined in vitro by TDP1 probe luminescence method, specifically as follows:

[0078] Synthesize an oligonucleotide probe as a TDP1 substrate. The 5'-end and 3'-end of the probe are respectively connected to a FAM fluorophore and a BHQ1 quencher through phosphodiester bonds. Under the condition of 37 °C, the probe will spontaneously form a hairpin structure through complementary base pairing. The fluorophore and the BHQ1 quencher approach each other, and the probe does not emit light. After adding TDP1 protein, the protein hydrolyzes the phosphodiester bond, the fluorophore and the BHQ1 quencher are separated, and the system starts to emit light. The rate of change of fluorescence intensity reflects the strength of TDP1 protein activity.

[0079] The experimental results are as Figure 3 shown in Figure 3 Figure A (left), the oligonucleotide probe is shown. Figure 3 Figure A (right) shows that Lawsone and SPI-112 exhibit significant inhibitory effects, reducing the TDP1 protein activity to 47.67% and 48.33% of the DMSO control. In vitro experiments show that Lawsone and SPI-112 can effectively inhibit the activity of TDP1 protein.

[0080] To further verify their inhibitory effects, the inhibitory effects of Lawsone and SPI-112 on TDP1 were detected in W1118 (wild-type) Drosophila. DMSO was used as the negative control, and camptothecin (CPT) was used as the positive control.

[0081] CPT is a TOP1 inhibitor that can bind to the TOP1-DNA complex, resulting in DNA breaks and the formation of TOPcc. TDP1 has a certain repair effect on this DNA break. When TDP1 is inhibited, TOPcc cannot be repaired, thereby exacerbating the accumulation of DNA breaks. The DNA breaks in the nucleus were labeled by γ-H2AvD staining, and the fluorescence brightness is proportional to the degree of DNA breakage. Dissect the thoracic muscles of adult Drosophila and fix them overnight at 4 °C in a fixative (195 μL of 4% PFA and 5 μL of 1% PBST). Permeabilize with 0.3% PBST for 20 min, block with 5 μL of goat serum and 195 μL of a blocking solution of 0.3% PBST at room temperature for 1 h. Dilute the primary antibody with the blocking solution as required and incubate overnight at 4 °C. Wash with 0.3% PBST three times, 15 minutes each time. Add the secondary antibody diluted with 0.3% PBST and incubate at room temperature for 4 h. Wash with 0.3% PBST three times, 15 minutes each time. Mount the slides with an anti-fluorescence quencher and take pictures under a confocal microscope, and statistically analyze the fluorescence intensity of γ-H2AvD in the nucleus.

[0082] The above experiments were divided into four groups, namely:

[0083] The group of W1118 Drosophila fed with DMSO: Raise W1118 Drosophila in the non-drug medium, collect male Drosophila, and take confocal microscope pictures after γ-H2AvD staining.

[0084] W1118 Drosophila melanogaster fed with CPT group: W1118 Drosophila melanogaster were raised in the CPT drug medium, male Drosophila melanogaster were collected, and after γ-H2AvD staining, confocal microscopy was performed.

[0085] W1118 Drosophila melanogaster fed with CPT + Lawsone group: W1118 Drosophila melanogaster were raised in the CPT + Lawsone drug medium, male Drosophila melanogaster were collected, and after γ-H2AvD staining, confocal microscopy was performed.

[0086] W1118 Drosophila melanogaster fed with CPT + SPI-112 group: W1118 Drosophila melanogaster were raised in the CPT + SPI-112 drug medium, male Drosophila melanogaster were collected, and after γ-H2AvD staining, confocal microscopy was performed.

[0087] The experimental results are as Figure 3 shown in B. There were no double-strand breaks in the nuclei of Drosophila melanogaster treated with DMSO, and a small number of double-strand break points appeared in the nuclei of Drosophila melanogaster treated with CPT, indicating that the TOP1 inhibitor promoted the production of TOPcc and DNA breakage. Compared with Drosophila melanogaster treated with CPT alone, a large number of double-strand breaks appeared in the nuclei of Drosophila melanogaster treated with CPT + Lawsone and CPT + SPI-112. It shows that TDP1 cannot repair TOPcc generated by CPT in time, resulting in the accumulation of DNA double-strand breaks, and Lawsone and SPI-112 can effectively inhibit the protein activity of TDP1 in vivo.

[0088] Example 4 Effects of Lawsone and SPI-112 on the CTG repeat number in DM1 Drosophila melanogaster

[0089] Dissolve Lawsone with DMSO, add 1 μL of 2.5 mM concentration of Lawsone to 500 μL of food medium (the final concentration of Lawsone is 0.5 μM), mix well with a vortex mixer, store at 4 °C after cooling, and prepare a Drosophila melanogaster medium containing Lawsone drug.

[0090] Dissolve SPI-112 with DMSO, add 1 μL of 5 mM concentration of SPI-112 to 500 μL of food medium (the final concentration of Lawsone is 1 μM), mix well with a vortex mixer, store at 4 °C after cooling, and prepare a Drosophila melanogaster medium containing SPI-112 drug.

[0091] The DM1 Drosophila melanogaster of Mef2-Gal4>CTG 270 1 day after eclosion were placed in the drug medium and fed at 25 °C for 15 days. The experiment was divided into two experimental groups and one control group, specifically:

[0092] Mef2-Gal4>(CTG)270 + DMSO group: As a negative control, Drosophila were fed in a food medium containing DMSO for 15 days. After collecting male Drosophila, DNA was extracted. After high GC-PCR, the length of the repetitive fragment was detected by silver staining of PAGE gel.

[0093] Mef2-Gal4>(CTG) 270 + Lawsone group: As an experimental group, Drosophila were fed in a food medium containing 0.5 μM Lawsone for 15 days. After collecting male Drosophila, DNA was extracted. After high GC-PCR, the change in the length of the repetitive fragment was detected by silver staining of PAGE gel.

[0094] Mef2-Gal4>(CTG) 270 + SPI-112 group: As an experimental group, Drosophila were fed in a food medium containing 1 μM Lawsone for 15 days. After collecting male Drosophila, DNA was extracted. After high GC-PCR, the change in the length of the repetitive fragment was detected by silver staining of PAGE gel.

[0095] The specific silver staining detection of PAGE gel is as follows: Prepare a 6% TBE-PAGE gel (Beyotime kit), and perform electrophoresis at a constant voltage of 60 V in 0.5× TBE buffer for 180 min. Peel the gel, fix it for 10 min (9 mL water + 1 mL ethanol + 50 μL glacial acetic acid), and wash it with water 3 times. Stain it for 10 min (0.01 g silver nitrate + 10 mL water), and wash it with water 3 times. Develop the color until the bands are clear (10 mL water + 0.075 g NaOH + 0.054 mL formaldehyde), wash it with water, and terminate it for 10 min (0.3 mL glacial acetic acid + 9.7 mL water), and then wash it with water 2 more times. Wash it with termination solution II (1 mL ethanol + 9 mL water), transfer the gel to plastic wrap, and image it with a white background.

[0096] The final results obtained from the three groups are as Figure 4 shown.

[0097] As Figure 4 shown, the silver staining results of PAGE gel showed that there was only one product peak of about 800 bp in DM1 Drosophila fed with DMSO. In the two experimental groups added with Lawsone and SPI-112, a diffuse and shortened product peak appeared before 800 bp. The number of CTG repeats was statistically analyzed, and the results showed that both Lawsone and SPI-112 could effectively reduce the number of CTG repeats in DM1 Drosophila.

[0098] Example 5 Effects of Lawsone and SPI-112 on the Number of CTG Repeats in DM1 Human Cell Model

[0099] Dissolve Lawsone in DMSO. Add 1 μL of Lawsone at a concentration of 41 mM to 1 mL of complete DEME cell culture medium (the final concentration of Lawsone is 41 μM). Mix well with a vortex mixer, store at 4°C after cooling, and prepare a cell culture medium containing Lawsone drug.

[0100] Dissolve SPI-112 in DMSO. Add 1 μL of SPI-112 at a concentration of 134 mM to 1 mL of complete DEME cell culture medium (the final concentration of Lawsone is 134 μM). Mix well with a vortex mixer, store at 4°C after cooling, and prepare a cell culture medium containing SPI-112 drug.

[0101] Add the drug cell culture medium to a 12-well plate containing the DM1 human cell model and culture in a sterile incubator at 37°C for 2 days. The experiment includes two experimental groups and one control group, specifically:

[0102] (CTG) 400 + DMSO group: As a negative control, culture DM1 human cells in cell culture medium containing DMSO. Extract genomic DNA after 2 days, perform high-GC PCR, and detect the change in the number of repeats by DNA chip.

[0103] (CTG) 400 + Lawsone group: As an experimental group, culture DM1 human cells in cell culture medium containing 42 μM Lawsone. Extract genomic DNA after 2 days, perform high-GC PCR, and detect the change in the number of repeats by DNA chip.

[0104] (CTG) 400 + SPI-112 group: As an experimental group, culture DM1 human cells in cell culture medium containing 134 μM Lawsone. Extract genomic DNA after 2 days, perform high-GC PCR, and detect the change in the number of repeats by DNA chip.

[0105] The results of the above experimental groups are as Figure 5 shown. The DNA chip results show that there is only a clear band at around 1300 bp in the DM1 human cell model cultured with DMSO. Diffuse and shortened product peaks appear below 1300 bp in the experimental groups with the addition of Lawsone and SPI-112. The number of CTG repeats was counted, and the results indicate that Lawsone and SPI-112 can effectively reduce the number of CTG repeats in the DM1 human cell model.

[0106] Example 6 Effects of Lawsone and SPI-112 on the CTG Repeat Number in Lymphocytes of DM1 Patients

[0107] Dissolve Lawsone in DMSO. Add 1 μL of 41 mM Lawsone into 1 mL of complete DEME cell culture medium (the final concentration of Lawsone is 41 μM). Mix well with a vortex mixer, store at 4 °C after cooling, and prepare a cell culture medium containing Lawsone drug.

[0108] Dissolve SPI-112 in DMSO. Add 1 μL of 134 mM SPI-112 into 1 mL of complete DEME cell culture medium (the final concentration of SPI-112 is 134 μM). Mix well with a vortex mixer, store at 4 °C after cooling, and prepare a cell culture medium containing SPI-112 drug.

[0109] Add the drug cell culture medium into a 12-well plate containing the lymphocyte model of DM1 patients, and culture in a sterile incubator at 37 °C for 2 days. The experiment includes two experimental groups and three control groups, specifically:

[0110] DM1 patient lymphocytes + DMSO group: As a negative control, culture DM1 human cells in cell culture medium containing DMSO. Extract genomic DNA after 2 days, perform high-GC PCR, and detect the change in the number of repeats by silver staining of PAGE gel.

[0111] DM1 patient lymphocytes + CPT group: As an experimental group, culture DM1 human cells in cell culture medium containing 15 μM CPT. Extract genomic DNA after 2 days, perform high-GC PCR, and detect the change in the number of repeats by silver staining of PAGE gel.

[0112] DM1 patient lymphocytes + Amikacin group: As an experimental group, culture DM1 human cells in cell culture medium containing 200 μM Amikacin. Extract genomic DNA after 2 days, perform high-GC PCR, and detect the change in the number of repeats by silver staining of PAGE gel.

[0113] DM1 patient lymphocytes + Lawsone group: As an experimental group, culture DM1 human cells in cell culture medium containing 42 μM Lawsone. Extract genomic DNA after 2 days, perform high-GC PCR, and detect the change in the number of repeats by silver staining of PAGE gel.

[0114] DM1 patient lymphocytes + SPI-112 group: As an experimental group, culture DM1 human cells in cell culture medium containing 134 μM SPI-112. Extract genomic DNA after 2 days, perform high-GC PCR, and detect the change in the number of repeats by silver staining of PAGE gel.

[0115] The CPT is a TOP1 inhibitor that can bind to the TOP1-DNA complex, resulting in DNA breakage.

[0116] The Amikacin is a broad-spectrum antibiotic that can non-specifically inhibit the activity of TDP1 protein.

[0117] The results of the above experiments are as Figure 6 shown. In the DMSO treatment group, clear amplified allele bands were present near 2000bp, and normal allele bands were present near 700bp, with no diffuse bands between the two. The CPT and Amikacin treatment groups were similar to the DMSO group, indicating that CPT and Amikacin had no effect on reducing the CTG repeat number in lymphocytes of DM1 patients. However, in the Lawsone and SPI-112 treatment groups, there were also diffuse fragments between the amplified and normal alleles, indicating that they could reduce the CTG repeat number in lymphocytes of DM1 patients.

[0118] It can be seen from the results of Examples 4 to 6 that the inhibitor acting on the TPD1 target provided by the present invention can be applied to Drosophila and human cells, and can promote the contraction of the repeated amplification sequence for the problem of CTG trinucleotide repeat amplification in DM1.

Claims

1. An inhibitor acting on a TDP1 target, characterized in that: The active ingredient of the inhibitor is Lawsone or SPI-112.

2. The inhibitor acting on the TDP1 target according to claim 1, characterized in that Lawsone is an orally active naphthoquinone compound with antibacterial, antitumor and antioxidant activities. Its molecular formula is C 10 H6O3, molecular weight is 174.16, its chemical structure is as follows:

3. The inhibitor acting on the TDP1 target according to claim 1, characterized in that The SPI-112 is a protein tyrosine phosphatase inhibitor, and its molecular formula is C 22 H 17 FN4O5S, molecular weight is 468.46, and its chemical structure is as follows:

4. The inhibitor acting on the TDP1 target according to claim 1, characterized in that TDP1 is tyrosine-DNA phosphodiesterase 1, which reduces the number of CTG trinucleotide repeat expansions in myotonic dystrophy type 1 by regulating the DNA repair process.

5. An application of the inhibitor according to any one of claims 1 to 4 for the treatment of CTG trinucleotide repeat expansion in myotonic dystrophy type 1; the application is specifically to use the inhibitor to inhibit the activity of TDP1 protein, thereby solving the problem of CTG trinucleotide repeat expansion in myotonic dystrophy type 1.

6. The use according to claim 5, characterized in that: The object of application is DM1 fruit fly or DM1 human cell model.

7. The use according to claim 6, characterized in that: When the application object is DM1 fruit fly, the use process includes the following steps: Dissolve the inhibitor using DMSO to obtain inhibitor solution 1; Add the obtained inhibitor solution 1 to the food culture medium at a preset final concentration of 1, mix well, and obtain a drug fruit fly culture medium; The DM1 fruit flies that have emerged are placed in the obtained drug fruit fly culture medium for cultivation, thereby inhibiting the activity of the DM1 fruit fly TDP1 protein; The concentration of the inhibitor solution 1 is 2.5 mM to 10 mM; in the drug fruit fly culture medium, the final concentration of the inhibitor is 0.5 μM to 2 μM; The temperature of culturing the DM1 fruit flies after eclosion in the medicated fruit fly culture medium is 25° C. and the time is 15 to 30 days.

8. The use according to claim 6, characterized in that: When the application object is the DM1 human cell model, the use process includes the following steps: Dissolve the inhibitors respectively using DMSO to obtain inhibitor solution 2; The obtained inhibitor solution 2 is added into the DEME cell complete culture medium at a preset final concentration of 2, and mixed to obtain a drug cell culture medium; The obtained drug cell culture medium is added to a 12-well plate containing a DM1 human cell model for culturing, thereby inhibiting the activity of TDP1 protein in the DM1 human cell model; The inhibitor solution 2 is SPI-112 solution 2 or Lawsone solution 2; the concentration of the SPI-112 solution 2 is 100mM to 150mM; the concentration of the Lawsone solution 2 is 40mM to 100mM; in the drug cell culture medium, when the inhibitor solution added is SPI-112 solution 2, the final concentration of SPI-112 is 100μM to 150μM; when the inhibitor solution added is Lawsone solution 2, the final concentration of Lawsone is 40μM to 100μM; The specific conditions for adding the drug cell culture medium to a 12-well plate containing a DM1 human cell model for culture are: culture in a sterile incubator at 37°C for 7 to 10 days.

9. Use of the inhibitor according to any one of claims 1 to 4 in the preparation of a medicament for myotonic dystrophy type 1.

10. The use according to claim 9, characterized in that: The medicine is a medicine for preventing or treating myotonic dystrophy type 1.

Images