Nucleic acid aptamer for specifically recognizing 2019-nCoV spike protein S1 as well as screening method and application of nucleic acid aptamer

Abstract

The invention relates to a nucleic acid aptamer for specifically recognizing 2019-nCoV spike protein S1 as well as a screening method and application of the nucleic acid aptamer. A nucleic acid sequence of the nucleic acid aptamer comprises any one or a combination of at least two of sequences shown in SEQ ID NO.1-SEQ ID NO.7. The nucleic acid aptamer provided by the invention is obtained by screening through an SELEX (systematic evolution of ligands by exponential enrichment) technology of nickel-agarose microspheres; the antibody has good affinity and specificity, can be artificially synthesized, can be specifically and stably combined with a 2019-nCoV spike protein S1 subunit, and shows excellent recognition capability on virus mutation subtypes Omicron and Delta.

Description

Technical Field

[0001] The present invention relates to the field of detection technologies, and particularly to a nucleic acid aptamer that specifically recognizes the spike protein S1 of 2019-nCoV, a screening method thereof, and an application thereof. Background Art

[0002] Nucleic acid aptamers are single-stranded DNA or RNA molecules obtained by screening through the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology, and can bind to target molecules (such as proteins, small molecules, cells, etc.) with high specificity and high affinity through a specific three-dimensional structure. Since being discovered in the 1990s, nucleic acid aptamers have been regarded as important supplementary or alternative tools to traditional antibodies (such as monoclonal antibodies) due to their unique molecular recognition ability. Compared with antibodies, nucleic acid aptamers have significant advantages such as small molecular weight, high chemical stability, easy modification and functionalization, short preparation period, and low cost. Based on this, nucleic acid aptamers have shown broad application prospects in the fields of disease diagnosis, targeted therapy, environmental monitoring, and biosensor development.

[0003] Currently, the conventional methods applied to virus diagnosis include: virus isolation and culture, immunological techniques, and molecular biological techniques, etc. Although virus culture and identification are the gold standards for virus diagnosis, due to the complexity of the method, high requirements for personnel and facilities costs, it cannot be carried out in ordinary clinical laboratories; immunological techniques are limited by the relatively late appearance time of specific proteins of the novel coronavirus, and are generally used for monitoring in the middle and late stages of the disease, and the accuracy needs to be improved; it is reported that the false negative ratio of nucleic acid detection by molecular biological techniques is relatively high, and the results of protein detection kits are not only related to their own quality and detection upper and lower limits, but also limited by the virus itself and the strict control of the whole process of sampling and detection, so the sensitivity and specificity need to be improved. However, antibodies and other proteins as probe molecules are easily denatured by environmental factors, while ssDNA aptamers have a smaller molecular weight than proteins. After in vitro screening and enrichment, they can have similar sensitivity to antigen-antibody binding, and are simple to synthesize and have better stability.

[0004] The protein capsid of the novel coronavirus (2019-nCoV) includes N and S proteins. Compared with aptamers that bind to the N protein, aptamers that specifically bind to the S protein can avoid cross-reaction with other coronaviruses (such as common cold viruses) during detection, significantly improving the detection specificity. However, the existing aptamer detection based on the S protein needs to be improved for the detection effect of virus variants, and aptamers targeting the conserved region of the S protein need to be screened out to deal with various variants of the novel coronavirus.

[0005] In summary, providing a novel nucleic acid aptamer targeting the conserved region of the S protein of the novel coronavirus has become one of the urgent problems to be solved in the current field. Summary of the Invention

[0006] To solve the above technical problems, the present invention provides a nucleic acid aptamer that specifically recognizes the spike protein S1 of 2019-nCoV, a screening method thereof, and an application. The nucleic acid aptamer is obtained by screening through the SELEX technology of nickel-agarose microspheres, has good affinity and specificity, can be artificially synthesized, and can specifically and stably bind to the S1 subunit of the 2019-nCoV spike protein.

[0007] To achieve this purpose, the present invention adopts the following technical solutions:

[0008] In the first aspect, the present invention provides a nucleic acid aptamer that specifically recognizes the spike protein S1 of 2019-nCoV, and the nucleic acid sequence of the nucleic acid aptamer includes any one or a combination of at least two of the sequences shown in SEQ ID NO.1 to SEQ ID NO.7.

[0009] SEQ ID NO.1: ACCAGCTTATTCAATTGGGGGACCAGGAATGTAGCCGC AAGACCCCTAGAATCTCGAGATAGTAAGTGCAATCT.

[0010] SEQ ID NO.2: ACCAGCTTATTCAATTCGGCTTATCATGTTGTGGGGGAA TGACAGGTCTCATAGGGAGATAGTAAGTGCAATCT.

[0011] SEQ ID NO.3: TACCAGCTTATTCAATTGCATATTCGACAGTGGTTGGCG TAGGGGTAGGCGGGTGGAGATAGTAAGTGCAATCT.

[0012] SEQ ID NO.4: AGATTCAATTGGGGGACCAGGAATGTAGCTGCAATCT.

[0013] SEQ ID NO.5: GTACCAGCTTATTCAATTCGGCTTATCATGTTGTGGGGG AATGACAGGTTAC.

[0014] SEQ ID NO.6: ATACCAGCTTATTCAATTGCATATTCGACAGTGGTTGGC GTAGGGGTAT.

[0015] SEQ ID NO.7: GCTTATTCAATTGCATATTCGACAGTGGTTGGCGTAGG GGTAGGC.

[0016] The present invention utilizes SELEX technology to screen out a nucleic acid aptamer that can specifically recognize the spike protein S1 of 2019-nCoV, providing a scientific basis and theoretical foundation for the application of this nucleic acid aptamer in detecting the spike protein S1 of 2019-nCoV. The nucleic acid aptamer provided by the present invention has good affinity and specificity, a short screening period for in vitro screening, is convenient for artificial synthesis with low cost, is easy to label various functional groups and reporter molecules, has a short production cycle, good repeatability between different batches, stable properties, and can be stored and used for a long time.

[0017] Preferably, the nucleic acid sequence of the nucleic acid aptamer is as shown in SEQ ID NO.4.

[0018] The nucleic acid sequence of the nucleic acid aptamer GT-04-3 provided by the present invention is as shown in SEQ ID NO.4. This nucleic acid aptamer has the ability to specifically recognize the S1 proteins of 2019-nCoV and two mutants, Delta (B.1.617.2) and Omicron (B.1.1.52). The binding site is located in the conserved region of the S1 protein, and it has the advantages of high stability, convenient synthesis, and easy labeling of functional groups, and has the potential to be widely used in the detection of COVID-19 virus proteins.

[0019] Preferably, the nucleic acid aptamer specifically recognizes and stably binds to the target protein, the spike protein S1 of 2019-nCoV.

[0020] In a second aspect, the present invention provides the application of the nucleic acid aptamer as described in the first aspect in the preparation of products for capturing, purifying, or detecting coronaviruses.

[0021] Preferably, the coronavirus includes any one or a combination of at least two of 2019-nCoV, the 2019-nCoV variant Omicron, or the 2019-nCoV variant Delta.

[0022] In a third aspect, the present invention provides a kit for specifically detecting the spike protein S1 of 2019-nCoV, and the kit includes the nucleic acid aptamer as described in the first aspect.

[0023] Preferably, the nucleic acid aptamer further includes a label.

[0024] Preferably, the label includes any one of biotin, a luminescent group, or an enzyme.

[0025] In a fourth aspect, the present invention provides a method for detecting 2019-nCoV virus, and the detection method includes: using the nucleic acid aptamer as described in the first aspect or the kit as described in the third aspect to detect a sample to be tested.

[0026] Preferably, the detection method specifically includes: mixing the sample to be detected with the nucleic acid aptamer described in the first aspect or the nucleic acid aptamer in the kit described in the third aspect, incubating, washing, and detecting the labeling signal of the label.

[0027] Fifthly, the present invention provides an application of the nucleic acid aptamer described in the first aspect in the preparation of a drug for preventing and / or treating 2019-nCoV virus infection.

[0028] Sixthly, the present invention provides a method for screening a nucleic acid aptamer, and the screening method includes:

[0029] (1) Using nickel beads as a solid-phase carrier, flowing the ssDNA screening library through the solid-phase carrier, and undergoing a negative screening step to obtain a non-specific adsorption sequence removed from binding to the solid-phase carrier;

[0030] (2) Fixing the 2019-nCoV spike protein S1 on the surface of the solid-phase carrier, and washing to remove the free 2019-nCoV spike protein S1;

[0031] (3) Incubating and binding the solid-phase carrier with the 2019-nCoV spike protein S1 and the ssDNA screening library collected after negative screening in a screening buffer;

[0032] (4) Using the screening buffer to wash out the unbound free DNA sequences, and retaining the DNA sequences bound to the 2019-nCoV spike protein S1 on the solid-phase carrier;

[0033] (5) Incubating and binding the above solid-phase carrier with the 2019-nCoV spike protein S1 solution, competitively eluting the ssDNA from the 2019-nCoV spike protein S1 on the solid-phase carrier, and obtaining a solution containing the ssDNA and 2019-nCoV spike protein S1 conjugate;

[0034] (6) Performing PCR amplification using the solution containing the ssDNA and 2019-nCoV spike protein S1 conjugate as a template;

[0035] (7) Treating the double-stranded DNA of the PCR product with an alkaline reagent to make it into ssDNA to obtain a secondary library for the next round of screening.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] (1) The nucleic acid aptamer provided by the present invention is derived from in vitro screening, has a short screening period, is convenient for synthesis, is easy to label various functional groups, and can be stored and used for a long time.

[0038] (2) The nucleic acid aptamer provided by the present invention is an aptamer sequence with relatively strong affinity and specificity, and the binding site is in the conserved region of the S protein, capable of specifically recognizing the S1 protein of 2019-nCoV and two mutants, Delta (B.1.617.2) and Omicron (B.1.1.52). Description of the Drawings

[0039] Figure 1 It is a schematic diagram of screening nucleic acid aptamers based on the affinity column SELEX technique.

[0040] Figure 2 It is a diagram of the detection result of the enrichment degree of the library in the first round of screening by agarose gel electrophoresis.

[0041] Figure 3 It is a diagram of the detection result of the enrichment degree of the library in the tenth round of screening by agarose gel electrophoresis.

[0042] Figure 4 It is a diagram of the result of detecting the binding of candidate aptamers and truncated sequences to the 2019-nCoV spike protein S1 by SPR technology.

[0043] Figure 5 It is a diagram of the result of detecting the binding kinetic constant of the candidate sequence GT-04-3 to the 2019-nCoV spike protein S1 by SPR technology.

[0044] Figure 6 It is a diagram of the result of detecting the interaction between GT-04-3 and other proteins by the biofilm interference technology.

[0045] Figure 7 It is a diagram of the result of detecting the interaction between GT-04-3 and the S1 subunit of the spike protein of the Delta (B.1.617.2) virus variant by SPR technology.

[0046] Figure 8 It is a diagram of the result of detecting the interaction between GT-04-3 and the S1 subunit of the spike protein of the Omicron (B.1.617.2) virus variant by SPR technology. Detailed Embodiments

[0047] To further illustrate the technical means and effects adopted by the present invention, the present invention will be further described below in conjunction with examples and drawings. It can be understood that the specific embodiments described herein are only used to explain the present invention, rather than limiting the present invention. Unless otherwise specified, all technical and scientific terms used in this specification have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.

[0048] For those without specific technologies or conditions indicated in the examples, follow the technologies or conditions described in the literature in this field or the product specifications. For reagents or instruments without the manufacturer indicated, they are all conventional products that can be obtained by purchasing through regular channels.

[0049] Example 1 Nucleic Acid Aptamer Screening

[0050] Figure 1 The SELEX flow chart for screening aptamers that can specifically recognize the 2019 - nCoV spike protein S1 specifically includes the following steps:

[0051] (1) Negative screening: Incubate the ssDNA screening library with a chromatography column pretreated with nickel beads to obtain a DNA sequence library that does not bind to the affinity column itself;

[0052] (2) Protein immobilization: Utilize the specific binding between the His tag fused to the 2019 - nCoV spike protein S1 and the nickel ions on the agarose beads to immobilize the 2019 - nCoV spike protein S1 on the surface of the nickel beads, fill it in the chromatography column, and use Tris buffer (20 mM Tris - HCl, pH 7.4) to wash away the unbound 2019 - nCoV spike protein S1;

[0053] (3) Incubation and binding: Incubate the unbound sequences collected in step (1) with the protein affinity column prepared in step (2) for 50 min;

[0054] (4) Washing and separation: Use the screening buffer to remove the DNA sequences that do not bind to the 2019 - nCoV spike protein S1;

[0055] (5) Competitive elution: Incubate with the 2019 - nCoV spike protein S1 solution in the above (4) to perform competitive binding on the DNA sequences that bind to the 2019 - nCoV spike protein S1, causing the DNA bound to the target to dissociate from the nickel beads;

[0056] (6) PCR amplification: Use the dissociated DNA - target solution as a template for PCR amplification;

[0057] (7) Single - strand preparation and purification: Denature the PCR product with 0.1 M sodium hydroxide to ssDNA to obtain the secondary library for the next round of screening;

[0058] In addition, during the screening process, to improve the affinity and specificity of the aptamer, the screening pressure can be increased by changing some experimental conditions. For example, as the number of screening rounds increases, reduce the concentration of the 2019 - nCoV spike protein S1 and screening incubation, etc. Repeat the above screening steps in a cycle, and monitor the screening process using gel imaging after each round of screening ends.

[0059] According to the library binding situation, the products obtained from the tenth round of screening were cloned and sequenced.

[0060] Example 2 Elution and Gel Electrophoresis Imaging of Single-Stranded Oligonucleotide Library

[0061] (1) Incubate the nucleic acid library of Example 1 with an affinity column immobilized with the 2019-nCoV spike protein S1 for 50 min; then elute with buffer, collect the washing solution, and label it as S1, S2, S3, S4, S5;

[0062] (2) Then elute with the 2019-nCoV spike protein S1, and label the eluate as SP1; elute with the screening buffer 3 times, and label the collected solutions as S6, S7, S8;

[0063] (3) Perform agarose gel electrophoresis on the above eluted and collected solutions: the gel concentration is 4%, the electrophoresis buffer is TBE solution (pH 8.0, 90 mM Tris-borate, 2 mM EDTA), electrophorese at 140 V for 50 min, and image with a gel imager after completion.

[0064] As Figure 2 and Figure 3 shown, where the S band is the collected solution of washing the nickel column with the screening buffer (SELEX buffer), and the SP band is the collected solution of competitive elution with the 2019-nCoV spike protein S1. Compared with the first round of screening, the brightness of the 10SP1 band increased significantly in the tenth round, and the ssDNA in the collected solution increased significantly, showing an enrichment effect.

[0065] Example 3 Cloning and Sequencing

[0066] A total of 45 aptamer sequences were obtained by cloning and sequencing. Analyze using software such as DNAMAN, Clustal, Mega, Mfold, etc. According to the homology comparison analysis, 3 representative candidate aptamers were selected from them, and at the same time, truncation design and optimization were carried out on them, and their binding affinity with the target was investigated according to the surface plasmon resonance (SPR) technology. Among them, the 3 full-length candidate aptamer sequences were named GT-04, GT-07, and GT-08 respectively, and the 4 truncated sequences were named GT-04-3, GT-07-1, GT-08-1, and GT-08-2 respectively. The detailed sequence information is shown in Table 1.

[0067] Table 1

[0068]

[0069] Example 4

[0070] Synthesize the above 7 candidate aptamers, use the 2019-nCoV spike protein S1 recombinant protein as the target, and use surface plasmon resonance (SPR) technology to investigate the binding affinity between the selected aptamer sequences and the target protein.

[0071] (1) Ligand protein coupling:

[0072] Dilute the ligand protein to 50 μg / mL with sodium acetate, fix the 2019-nCoV spike protein S1 on the chip at a flow rate of 10 μL / min, and block the channel with ethanolamine at a flow rate of 10 μL / min.

[0073] (2) Protein-compound interaction test:

[0074] After gradient dilution of the candidate aptamer sequences, continuously inject samples at a flow rate of 30 μL / min for 150 s. Regenerate the chip with 10 mM glycine hydrochloride (pH 2.0) solution for 5 min. The test data are as Figure 4 shown. The curves in the figure from top to bottom represent the sequences GT-04-3, GT-07, GT-08, GT-08-2, GT-04, GT-08-1, and GT-07-1 respectively, and the candidate sequence GT-04-3 shows the strongest interaction.

[0075] Example 5

[0076] Use the 2019-nCoV spike protein S1 recombinant protein as the target, and use surface plasmon resonance (SPR) technology to investigate the binding affinity between the selected candidate aptamer sequences (taking GT-04-3 as an example to show the results) and the target protein. The specific implementation plan refers to Example 3. The results are as Figure 5 shown. The curves in the figure from top to bottom represent the GT-04-3 sequence concentrations of 1000 nM, 500 nM, 250 nM, 125 nM, 62.5 nM, 31.25 nM, and 16 nM respectively. The candidate sequence GT-04-3 shows a high affinity for the target protein, and its equilibrium dissociation constant KD value is 25.77 nM.

[0077] Example 6

[0078] Use the BLI assay (biomembrane interferometry) to further study the binding specificity of the candidate aptamer sequences (taking GT-04-3 as an example to show the results). Fix the above proteins such as MUC-1, enolase 2 / ENO2 (NSE), alpha-fetoprotein (AFP), and alpha-1-acid glycoprotein 2 (α1-acid glycoprotein-2) on the activated probe using the EDC / NHS protocol. Perform binding analysis using an aptamer with a concentration of 500 nM, and use Prime(Gator Bio) record. The experimental parameters are as follows: the temperature is maintained at 25°C, the baseline period is 2 min, the association period is 5 min, and the dissociation period is 5 min. The test data are as Figure 6 shown. The curves in the figure represent S1, α1-acid glycoprotein-2, AFP, MUC1, and NSE from top to bottom. Compared with the target protein, the candidate aptamer GT-04-3 has a weaker interaction with other proteins, indicating that this candidate sequence has specificity for the binding of the target protein.

[0079] Example 7

[0080] Using the spike protein S1 recombinant proteins of the 2019-nCoV virus variants Delta B.1.617.2 and Omicron B.1.1.52 as targets, the binding of the screened aptamer sequences (taking GT-04-3 as an example to show the results) to the target proteins was investigated by surface plasmon resonance (SPR) technology.

[0081] (1) Ligand protein coupling:

[0082] Dilute the ligand protein to 50 μg / mL with sodium acetate. Fix the spike protein S1 recombinant proteins of Delta B.1.617.2 and Omicron B.1.1.52 on the chip channel at a flow rate of 10 μL / min, and block the channel with ethanolamine at a flow rate of 10 μL / min.

[0083] (2) Protein-compound interaction test:

[0084] Dilute the candidate aptamer sequences to several concentrations, and couple them with the target protein from low concentration to high concentration through the chip at a flow rate of 30 μL / min for a duration of 150 s. Regenerate the chip with 10 mM glycine hydrochloride (pH 2.0) solution for 5 min. Obtain the binding and dissociation constants by performing 1:1 binding parameter fitting using Biacore Insight. Figure 7 For the interaction between GT-04-3 and the Delta virus, where from top to bottom, the concentrations of the sequence GT-04-3 are 1000 nM, 500 nM, 250 nM, 125 nM, and 62.5 nM; Figure 8 For the interaction between GT-04-3 and the Omicron virus, where from top to bottom, the concentrations of the sequence GT-04-3 are 1000 nM, 500 nM, 250 nM, 125 nM, and 62.5 nM. It can be seen from Figure 7 and Figure 8 that the candidate aptamer sequence GT-04-3 exhibits high-affinity recognition for both mutants.

[0085] In summary, in view of the many defects existing in the prior art, the present invention is mainly dedicated to screening aptamers that can recognize the conserved region of the spike protein S1 of 2019-nCoV, and can also bind to virus variants (Delta, B.1.617.2; Omicron, B.1.1.52) to a considerable extent, providing a scientific basis and theoretical foundation for the application of the aptamer in detecting the spike protein S1 of 2019-nCoV, and thus developing an aptamer-based in vitro virus detection method.

[0086] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the public scope of the present invention.

Claims

1. A nucleic acid aptamer that specifically recognizes 2019-nCoV spike protein S1, characterized in that: The nucleic acid sequence of the nucleic acid aptamer includes any one or a combination of at least two of the sequences shown in SEQ ID NO.1 to SEQ ID NO.

7.

2. The nucleic acid aptamer according to claim 1, characterized in that The nucleic acid sequence of the nucleic acid aptamer is shown in SEQ ID NO.

4.

3. The nucleic acid aptamer according to claim 1 or 2, characterized in that The nucleic acid aptamer specifically recognizes and stably binds to the target protein 2019-nCoV spike protein S1.

4. Use of the nucleic acid aptamer according to any one of claims 1 to 3 in the preparation of products for capturing, purifying or detecting coronavirus.

5. The use according to claim 4, characterized in that: The coronavirus includes any one of 2019-nCoV, 2019-nCoV variant Omicron or 2019-nCoV variant Delta, or a combination of at least two.

6. A kit for specifically detecting 2019-nCoV spike protein S1, characterized in that: The kit comprises the nucleic acid aptamer according to any one of claims 1 to 3.

7. The kit according to claim 6, characterized in that The nucleic acid aptamer also includes a marker; Preferably, the label comprises any one of biotin, a luminescent group or an enzyme.

8. A method for detecting 2019-nCoV virus, characterized in that: The detection method comprises: using the nucleic acid aptamer according to any one of claims 1 to 3 or the kit according to claim 6 or 7 to detect the sample to be detected.

9. The detection method according to claim 8, characterized in that: The detection method specifically comprises: mixing the sample to be tested with the nucleic acid aptamer according to any one of claims 1 to 3 or the nucleic acid aptamer in the kit according to claim 6 or 7, incubating, washing, and detecting the labeling signal of the label.

10. Use of the nucleic acid aptamer according to any one of claims 1 to 3 in the preparation of a drug for preventing and / or treating 2019-nCoV virus infection.

Images